Use of Bacterial Source Tracking to Characterize Texas Watersheds
|
|
- Brice McCarthy
- 6 years ago
- Views:
Transcription
1 Use of Bacterial Source Tracking to Characterize Texas Watersheds Terry Gentry 1, George Di Giovanni 2, Kevin Wagner 3, Elizabeth Casarez 2, Pauline Wanjugi 1 1 Texas A&M University; 2 University of Texas School of Public Health, Houston, El Paso Branch Campus; 3 Texas Water Resources Institute
2 Where did the Bacteria (E. coli) Come From? Potential sources Humans Domesticated animals Wildlife Methods for determining sources Source survey Modeling Bacterial source tracking
3 What is Bacterial Source Used to determine the sources of fecal contamination Tracking (BST)? Based on uniqueness of bacteria from individual sources A variety of different methods are used Often works best as part of a toolbox approach
4 BST Target Organisms Bacterial v. Microbial Source Tracking Different targets: E. coli Bacteroidales Bacteriophage Human viruses Chemicals
5 History of BST Use in Texas Lake Waco/Belton Project initiated Sep Funded by TSSWCB Evaluated utility & methods Completed Feb. 2006
6 History of BST Use in Texas Lake Waco/Belton Project Findings 4-method composite performed better than individual methods 2-method composites appeared promising ERIC-ARA = lower cost but more sample & data processing ERIC-RP = higher cost but automated TMDL Task Force Report 2007 Confirmed ERIC-RP as recommended method
7 Methods: Library-Dependent BST Methods 1 2 M 3 M4 1M M5 76 M8 7M M M M DNA fingerprinting Enterobacterial repetitive intergenic consensus sequence-polymerase chain reaction (ERIC-PCR) RiboPrinting (RP) Advantages/Disadvantages: More discriminating Allows (A) ranking of sources More expensive (B) (B)
8 Development of Texas E. coli BST Library Sources M 3 4 M 5 6 M 7 8 M M M Isolate E. coli DNA Fingerprint Add to Library (B)
9 Texas E. coli BST Library (v. 6-13) Contains 1,524 E. coli isolates from 1,358 different human and animal samples Developed by collecting over 3,500 domestic sewage, wildlife, livestock, and pet fecal samples and screening over 6,000 isolates for clones and host specificity Samples from 13 watersheds across Texas for BST including: Waco / Belton Lake San Antonio Lake Granbury Oyster Creek / Trinity River Buck Creek Little Brazos River Tributaries Attoyac Bayou Human 25% Domestic Animals 34% Wildlife 41% Additional isolates being added from ongoing and future BST projects in other areas of Texas
10 Use of Texas E. coli BST Library for Identifying Water Isolates 3 4 M 5 6 M 7 8 M M M 7 8 Isolate E. coli DNA Fingerprint Compare to Library Source ID (B)
11 Comparison to Texas E. coli BST Library Best match approach with 80% minimum similarity cutoff based on laboratory QC data Water isolate must match library isolate 80% similarity or it is considered unidentified Identification to single library isolate with highest similarity max similarity approach Similarity: 96.94% Similarity: 95.82% RP ERIC-PCR
12 Three-way v. Seven-way Split of Results Using the results Is it from human sources? Is it from livestock? Is it from wildlife? Biology Large variety of wildlife Cosmopolitan strains Geographical and temporal differences Statistics Number of isolates collected May only use three-way split for limited studies (1) Human (2) Livestock & Pets (3) Wildlife vs. Human (1) Pets (2) Cattle (3) Other livestock, avian (4) Other livestock, non-avian (5) Wildlife, avian (6) Wildlife, non-avian (7)
13 Texas E. coli BST Library Composition & Rates of Correct Classification (RCC)
14 Approach: Library-Independent BST Genotypic detection of microorganisms based on marker genes (DNA) Does not require known-source library Most common approach targets Bacteroidales Presence/absence Relative abundance M
15 What are Bacteroidales? More abundant in feces than E. coli Not pathogens Obligate anaerobes less likely to multiply in environment Subgroups appear to be host specific Markers available for humans, ruminants, horse, hog Others being tested (e.g., poultry) site/_images/bacteroidetes.jpg Limited wildlife markers
16 Use of BST Results Reconcile with: Land use Watershed source survey Modeling Stakeholder input Common sense
17 13 Studies Completed
18 BST for Attoyac Bayou Limited, library-dependent Analyze E. coli from ~100 water samples from across the study area using both ERIC-PCR and RP fingerprinting Add ~100 known-source E. coli isolates from the area to the Texas E. coli BST Library Wastewater, poultry, cattle, wildlife, etc. Library-independent Analyze ~250 water samples from across the study area using Bacteroidales PCR for human, ruminant, hog, and horse markers
19 Bacteroidales BST Results Base Flow Samples (n=225)
20 Bacteroidales BST Results Base Flow vs Storm Flow Human Ruminant Hog Horse Attoyac Bayou at SH 21 Big Iron Ore at FM 354
21 E. coli BST Results Base + Storm Samples 3-Way Split Unidentified (n=13) 13% Livestock and Domesticated Animals (n=21.5) 21% Humans (n=6) 6% Wildlife (n=63.5) 61%
22 E. coli BST Results Base + Storm Samples (7-Way Split) Humans (n=6) 6% Unidentified (n=13) 13% Cattle (n=10.5) 10% Other livestock, avian (n=3) 3% Other livestock, non-avian (n=3) 3% Wildlife, non-avian (n=47.5) 46% Pets (n=5) 5% Wildlife, avian (n=16) 15%
23 BST Summary Library-Independent Analysis Ruminant and hog (feral) markers most common Spike in ruminant and hog hits during storm events Limited Library-Dependent Analysis Major E. coli sources in watershed appear to be wildlife (feral hogs, small mammals, avian wildlife) as well as domesticated animals (cattle) Texas E. coli BST Library additions from Attoyac Bayou Significant effort to include isolates from poultry litter
24 E. coli BST Results - Lampasas (Monthly 4-way Split All Sites Combined)
25 Summary of Texas BST Studies (n=11) 3-Way Split Unidentified 12% Livestock and [CATEGORY NAME] [PERCENTAGE] Wildlife 51% Human 10%
26 Summary of Texas BST Studies (n=7) 7-Way Split Unidentified 12% Human 10% Non-Avian Wildlife 32% Cattle 13% Avian Livestock 5% Other Non-Avian Livestock 5% Pets 5% Avian Wildlife 18%
27 Future Methods & Approaches 1. Identify the Unidentified Continue expansion of BST library Evaluating naturalized E. coli 2. Improve Library-Independent BST Limited markers, but new markers being developed Geographic stability of markers Quantification?
28 BST for Plum Creek? What is the Goal of BST? Characterize watershed or monitor specific sources? How many potential sources? All, most numerous One or a few (e.g., human) What level of resolution is needed? Individual species Groups (e.g., humans, domesticated animals, and wildlife) Presence/absence, relative ranking, or absolute number for various sources
29 BST for Plum Creek? Current BST costs: ERIC-RP = $250/isolate Bacteroidales PCR General + one specific marker = $300/sample General + four specific markers = $350/sample Possible initial approach for Plum Creek BST: Three sites Samples collected monthly for one year ERIC-RP five isolates per sample 3 sites x 12 sampling events x 5 isolates/sample x $250/isolate = $45,000 Initial sample processing = $65/sample [$2,340] Does not include sample collection and transport to lab
30 Questions? Terry Gentry Texas A&M University 2474 TAMU College Station, TX Phone: (979)
Bacterial Source Tracking Plum Creek
Bacterial Source Tracking Plum Creek Terry Gentry 1, Maitreyee Mukherjee 1, and Elizabeth Casarez 2 1 Texas A&M University, Soil & Aquatic Microbiology Laboratory 2 University of Texas School of Public
More informationReview of Bacterial Source Tracking in Texas. Kevin Wagner, George DiGiovanni, Terry Gentry, Elizabeth Casarez, Emily Martin
Review of Bacterial Source Tracking in Texas Kevin Wagner, George DiGiovanni, Terry Gentry, Elizabeth Casarez, Emily Martin Bacteria The #1 Cause of Water Quality Impairment in Texas Where did the Bacteria
More informationIV. RESULTS AND DISCUSSION. A total of 1,248 isolates were tested from the five sources and the isolates
IV. RESULTS AND DISCUSSION A. Classification of Known Isolates (Library Composition) A total of 1,248 isolates were tested from the five sources and the isolates collected from these known fecal sources
More informationPersistence of Fecal Indicator Bacteria in the Environment: from Indicators to Pathogens and Metagenomes
Persistence of Fecal Indicator Bacteria in the Environment: from Indicators to Pathogens and Metagenomes Michael J. Sadowsky University of Minnesota Department of Soil, Water and Climate; and BioTechnology
More informationCRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping
Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing
More informationDr. Robin Brinkmeyer. Department of Marine Sciences. Dr. John Schwarz Department of Marine Biology. Texas A&M University at Galveston
Population Dynamics of Escherichia coli and Enterococcus spp. in Buffalo Bayou and White Oak Bayou Dr. Robin Brinkmeyer Dr. Rainer Amon Department of Marine Sciences Dr. John Schwarz Department of Marine
More informationMicrobial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity
Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Cat. no. 330043 BBID-1507ZR-3 For real-time PCR-based, application-specific microbial identification or profiling The Clostridium
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationRelationship between rainfall and beach bacterial concentrations on Santa Monica Bay beaches
85 IWA Publishing 2003 Journal of Water and Health 01.2 2003 Relationship between rainfall and beach bacterial concentrations on Santa Monica Bay beaches Drew Ackerman and Stephen B. Weisberg ABSTRACT
More informationWater Quality Monitoring Results. Angela Kilpatrick Trinity River Authority May 18, 2017
Water Quality Monitoring Results Angela Kilpatrick Trinity River Authority May 18, 2017 Monitoring Plan and Lab Analysis Samples collected by PS staff are dropped off at CRWS lab for analysis of:. coli
More informationWater Pollution Studies for the Lower Grand River, Michigan
Water Pollution Studies for the Lower Grand River, Michigan Dr. Joan B. Rose rosejo@msu.edu Dr. Phanikumar Mantha phani@msu.edu Rebecca Ives, Shikha Singh and Theng Theng Fong and Chao Peng Grand River,
More informationbelonging to the Genus Pantoea
Emerging diseases of maize and onion caused by bacteria belonging to the Genus Pantoea by Teresa Goszczynska Submitted in partial fulfilment of the requirements for the degree Philosophiae Doctoriae in
More informationEric D. Stein Biology Department
Eric D. Stein Biology Department The Promise of Molecular Methods Faster answers Weeks vs. months Less expensive Better data Recognizing misidentifications Improving taxonomic keys Helping with difficult
More informationKingdom Monera(Archaebacteria & Eubacteria)
Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.
More informationHuman indicator persistence in the environment
Human indicator persistence in the environment Patricia A. Holden, Ph.D. Professor, Bren School of Environ. Sci. Mgmt. Director, UCSB Natural Reserve System State-of-the-Science: Fecal Source Identification
More informationExploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University
Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires
More informationMolecular Markers, Natural History, and Evolution
Molecular Markers, Natural History, and Evolution Second Edition JOHN C. AVISE University of Georgia Sinauer Associates, Inc. Publishers Sunderland, Massachusetts Contents PART I Background CHAPTER 1:
More informationBurnet Jean-Baptiste. Dinh Quoc T., Ceccantini J., Servais P., M. Prévost and S. Dorner
Burnet Jean-Baptiste Dinh Quoc T., Ceccantini J., Servais P., M. Prévost and S. Dorner 2017 AWWA Water Quality Technology Conference Portland, Oregon November 12-16, 2017 Introduction Monitoring of microbiological
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationChronology-Sensitive Hierarchical Clustering of Pyrosequenced DNA Samples of E. coli: A Case Study
Chronology-Sensitive Hierarchical Clustering of Pyrosequenced DNA Samples of E. coli: A Case Study Aldrin Montana Alex Dekhtyar Computer Science Department California Polytechnic State University San Luis
More informationMicrobial Ecology and Microbiomes
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University Packet #16 Chapter #26 Microbial Ecology and Microbiomes Environmental Microbiology Studies the microorganisms
More information2017 Annual Report for the Molecular Plant Pathogen Detection Lab
2017 Annual Report for the Molecular Plant Pathogen Detection Lab The Molecular Plant Pathogen Detection Lab The Molecular Plant Pathogen Detection (MPPD) Lab utilizes two molecular techniques to identify
More informationThe Role of the Horizontal Gene Pool and Lateral Gene Transfer in Enhancing Microbial Activities in Marine Sediments
The Role of the Horizontal Gene Pool and Lateral Gene Transfer in Enhancing Microbial Activities in Marine Sediments Patricia A. Sobecky School of Biology Georgia Institute of Technology 310 Ferst Drive
More informationBIOAG'L SCI + PEST MGMT- BSPM (BSPM)
Bioag'l Sci + Pest Mgmt-BSPM (BSPM) 1 BIOAG'L SCI + PEST MGMT- BSPM (BSPM) Courses BSPM 102 Insects, Science, and Society (GT-SC2) Credits: 3 (3-0-0) How insects develop, behave, and affect human activity.
More informationDrought. Jeffrey Lindner Meteorologist Harris County Flood Control District September 20, 2011
2010-2011 Drought Jeffrey Lindner Meteorologist Harris County Flood Control District September 20, 2011 Texas Annual Rainfall Texas Annual Rainfall 1895-2010 Texas Annual Temperature 1895-2010 Notice Any
More informationTHE TRINITY RIVER VISION/ GATEWAY PARK / PANTHER ISLAND
Quarterly Project Status Report May 2018 THE TRINITY RIVER VISION/ GATEWAY PARK / PANTHER ISLAND Flood Control Project Update Construction of North Main Street Bridge by TxDOT s bridge contractor, Texas
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationTHE TRINITY RIVER VISION/ GATEWAY PARK / PANTHER ISLAND Flood Control Project Update
Quarterly Project Status Report September 2018 THE TRINITY RIVER VISION/ GATEWAY PARK / PANTHER ISLAND Flood Control Project Update TxDot s contractor has nearly completed the superstructure false work
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationDevelopments in Microbial Source Tracking
"Starcross and the Brunel Pumping Station from the Exe - geograph.org.uk - 1285641" by Sarah Charlesworth. Licensed under CC BY-SA 2.0 via Commons "Devon UK location map" by Contains Ordnance Survey data
More informationDid Severe Rains and Flooding in May 2015 Affect Texas Poison Center Call Patterns?
Did Severe Rains and Flooding in May 2015 Affect Texas Poison Center Call Patterns? Mathias Forrester Epidemiologist Texas Department of State Health Services (DSHS) mathias.forrester@dshs.state.tx.us
More informationPress Release BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION
Press Release 12 172 BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION Genomic analysis of E. coli shows multiple steps to evolve new trait View Video Postdoc researcher Zachary Blount discusses discovering
More informationWhat are viruses? Marine Viruses I & II. OCN 626 Marine Microplankton Ecology. Characteristics, Abundance, and Diversity
OCN 626 Marine Microplankton Ecology Marine Viruses I & II Characteristics, Abundance, and Diversity What Are Viruses? What are they made of? How do they replicate? Are they alive? What are viruses? Infectious
More informationMicrobiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes
More informationAlabama Department of Environmental Management Auburn / Opelika Intensive Fecal Coliform Study January February 2007
Alabama Department of Environmental Management Auburn / Opelika Intensive Study January February 2007 Introduction In October 2006 the Alabama Department of Environmental Management (ADEM) was contacted
More informationChapter 2 Roanoke River Subbasin Including: Dan and Mayo Rivers, Pawpaw and Jacobs Creek
Chapter 2 Roanoke River Subbasin 03-02-02 Including: Dan and Mayo Rivers, Pawpaw and Jacobs Creek 2.1 Subbasin Overview Subbasin 03-02-02 at a Glance Land and Water Area Total area: 231 mi 2 Land area:
More informationDEPARTMENT OF ANIMAL HEALTH TECHNOLOGY COURSE OUTLINE - FALL 2014 LAB PROCEDURES AND MICROBIOLOGY AH 174 E- MAIL:
DEPARTMENT OF ANIMAL HEALTH TECHNOLOGY COURSE OUTLINE - FALL 2014 LAB PROCEDURES AND MICROBIOLOGY AH 174 INSTRUCTOR: Dr. Chris Mizzi Kristy Mergeart, RAHT PHONE: 780-835-6617 780-835-6779 OFFICE: AS 133
More informationThe Road to the Six Kingdoms
Bio 2201 Unit 2 The Road to the Six Kingdoms A 2011study estimated there are about 8.6 million species on earth. Only 1.8 million species have been identified and named. *Chromista is a sub-kingdom group
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationTexas Geography. Understanding the physical and human characteristics of our state
Texas Geography Understanding the physical and human characteristics of our state To understand Texas you must first learn about its Geography. Geography- The study of the world, its people, and the interaction
More informationLeptospira: The disease and its diagnosis.
Leptospira: The disease and its diagnosis. Julie Collins-Emerson Lepto forum 06 March 2017 http://r6kbio.wikia.com/wiki/leptospira_interrogans Are bacteria Leptospira Most mammals can be infected A number
More informationMicrobiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
More informationA statistical appraisal of disproportional versus proportional microbial source tracking libraries
A statistical appraisal of disproportional versus proportional microbial source tracking libraries Brian J. Robinson 1, Kerry J. Ritter and Rudolph D. Ellender 2 ABSTRACT Library-based microbial source
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationNon Brazos County Space Change - ASF and E&G
00 - TAMUG-Campus Dean Non Brazos County Space Change - and 0050 - VICE PRESIDENT-TAMU GALVESTON 7,132 7,132 0 2,016 2,016 0 00 - TAMUG-Campus Dean Total: 7,132 7,132 0 2,016 2,016 0 01 - TAMUG-Academic
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: https://digitalcontentmarket.org/download/test-bank-formicrobiology-a-systems-approach-3rd-edition-by-cowan Chapter
More informationCARTERVILLE SCHOOL DISTRICT SCIENCE CURRICULUM GRADE 8 Revised 2009
CARTERVILLE SCHOOL DISTRICT SCIENCE CURRICULUM GRADE 8 Revised 2009 The following Inquiry Skills will be taught throughout the year. Identify the three main branches of Science as Earth, Life and Physical
More informationFecal Coliform Data Report
How Animal Wastes Pollute Water, and What You Can Do About It : An Integrated Monitoring and Education Project Ipswich River Watershed Association 218 Boston Street #204, Topsfield, MA 01983 978.887.8404
More informationAssessment of Lake Forest Lake Sediment Trapping Efficiency and Capacity. Marlon R. Cook Groundwater Assessment Program Geological Survey of Alabama
Assessment of Lake Forest Lake Sediment Trapping Efficiency and Capacity Marlon R. Cook Groundwater Assessment Program Geological Survey of Alabama Impacts of the Lake at Lake Forest on the connectivity
More informationObjectives. Understand the different physical & human characteristics of each region
TEXAS REGIONS Objectives Know the 4 regions of Texas Understand the different physical & human characteristics of each region Understand how physical differences affect human characteristics (way of life)
More informationProkaryotes & Viruses. Practice Questions. Slide 1 / 71. Slide 2 / 71. Slide 3 / 71. Slide 4 / 71. Slide 6 / 71. Slide 5 / 71
Slide 1 / 71 Slide 2 / 71 New Jersey Center for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of
More informationChapter 4 French Broad River Subbasin Including the: French Broad River, Little Ivy Creek (River), Ivy Creek, California Creek and Bull Creek
Chapter 4 French Broad River Subbasin 04-03-04 Including the: French Broad River, Little Ivy Creek (River), Ivy Creek, California Creek and Bull Creek 4.1 Subbasin Overview Subbasin 04-03-04 at a Glance
More informationMICROBIOLOGY CHAPTER 7 QUIZLET PDF
MICROBIOLOGY CHAPTER 7 QUIZLET PDF ==> Download: MICROBIOLOGY CHAPTER 7 QUIZLET PDF MICROBIOLOGY CHAPTER 7 QUIZLET PDF - Are you searching for Microbiology Chapter 7 Quizlet Books? Now, you will be happy
More informationBOOK ASSIGNMENT: SCIENCE MATTERS-ACHIEVING SCIENTIFIC LITERACY INSTRUCTOR: IVAN IÑIGUEZ EL PASO COMMUNITY COLLEGE BIOLOGY DEPARTMENT
BOOK ASSIGNMENT: SCIENCE MATTERS-ACHIEVING SCIENTIFIC LITERACY INSTRUCTOR: IVAN IÑIGUEZ EL PASO COMMUNITY COLLEGE BIOLOGY DEPARTMENT STUDENT NAME: GRADE: DATE: This assignment is designed to accompany
More informationKINGDOM MONERA. Bacterial Cell Shape 8/22/2010. The Prokaryotes: Archaebacteria and Eubacteria
KINGDOM MONERA The Prokaryotes: Archaebacteria and Eubacteria Bacteria are the most organisms living on the Earth. (i.e. 10mL of soil contains 1 x 10 10 bacteria. They are found in nearly every habitat
More informationMPCA Water Quality Database
Appendix : MPCA Water Quality Database meta-data descriptions and requirements Project information 1 Project ID Project name Project purpose Start date Name of the monitoring project Reason why the monitoring
More informationUse of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches
Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches Christine E. Edwards 1, Denise L. Lindsay 2, Thomas Minckley 3, and Richard F. Lance 2 1
More informationEmpirical, Dimensionless, CumulativeRainfall Hyetographs Developed From Storm Data for Selected Small Watersheds in Texas
In cooperation with the Texas Department of Transportation Empirical, Dimensionless, CumulativeRainfall Hyetographs Developed From 1959 86 Storm Data for Selected Small Watersheds in Texas Scientific Investigations
More information2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
More informationWake Acceleration Academy - Biology Note Guide Unit 6: Evolution & The Diversity of Life
Wake Acceleration Academy - Biology Note Guide Unit 6: Evolution & The Diversity of Life Extra Resources Website: http://waa-science.weebly.com Module 1: Darwin and Natural Selection Vocabulary Term Charles
More informationChapter 2 Microbes in Perspective: Of Collectors and Classifiers
Chapter 2 Microbes in Perspective: Of Collectors and Classifiers Objectives: After reading Chapter Two, you should understand The schemes used throughout history to classify organisms. How microorganisms
More informationMicrobiology BIOL 202 Lecture Course Outcome Guide (COG) Approved 22 MARCH 2012 Pg.1
Microbiology BIOL 202 Lecture Course Outcome Guide (COG) Approved 22 MARCH 2012 Pg.1 Course: Credits: 3 Instructor: Course Description: Concepts and Issues 1. Microbial Ecology including mineral cycles.
More informationChapter 21 PROKARYOTES AND VIRUSES
Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More information9/12/2014 O V E RV I E W
K E E P I N G T H E N E W M I S S I O N R E AC H C L E A N T R A S H & F L O ATA B L E S B M P S T U D Y Russell Persyn, P.E., Ph.D. (SARA) Cris Parker, P.E., CFM (HDR) September 4, 2014 O V E RV I E W»
More informationComparison of Escherichia coli and Bacteriodes fragilis Transport within Saturated Quartz Sands
Comparison of Escherichia coli and Bacteriodes fragilis Transport within Saturated Quartz Sands Jennifer J. Johanson, Lucia Feriancikova, Shangping Xu* Department of Geosciences University of Wisconsin
More informationWarmup. geography compass rose culture longitude
Warmup geography compass rose culture longitude ecosystem latitude 1. study of the special physical and human characteristics of a place or region 2. learned system of shared beliefs, traits, and values
More informationAppendix M. Lower Sandusky River and Sandusky Bay Bacteria Watershed TMDLs
Appendix M. er Sandusky River and Sandusky Bay Bacteria Watershed TMDLs Contents M-1. Background... 1 M-2. Linkage Discussion... 5 M-3. Analysis Methods... 5 M-3.1. Load Duration Curves for Escherichia
More informationSection B - Chapter 13 Neuse River Subbasin Bay River and Pamlico Sound
Section B - Chapter 13 Neuse River Subbasin 3-4-13 Bay River and Pamlico Sound 13.1 Subbasin Overview Subbasin 3-4-13 at a Glance Land and Water Area Total area: 277 mi 2 Land area: 145 mi 2 Water area:
More informationIUCN Red List Process. Cormack Gates Keith Aune
IUCN Red List Process Cormack Gates Keith Aune The IUCN Red List Categories and Criteria have several specific aims to provide a system that can be applied consistently by different people; to improve
More informationTexas Geography Portfolio Book
Texas Geography Portfolio Book Note: All maps must be labeled and colored. Follow directions carefully. Neatness counts! 1. Cover (10 points) Design a cover on the Texas shape and cut out. The cover design
More informationPRELIMINARY TAMU - Galveston - Qatar Combined * 20th Class Day SCH Data Spring
TAMU - Galveston - Qatar Combined * Lower Division 330,266 5,923 336,189 336,259 6,322 342,581 6,392 Upper Division 290,335 5,316 295,651 304,322 4,626 308,948 13,297 Master's 55,760 309 56,069 55,713
More informationE-BOOK # ARE ALL ANIMALS EUKARYOTIC
28 January, 2018 E-BOOK # ARE ALL ANIMALS EUKARYOTIC Document Filetype: PDF 357.89 KB 0 E-BOOK # ARE ALL ANIMALS EUKARYOTIC In eukaryotes, mostly DNA is stored inside the cell nucleus, but some are found
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationSRM UNIVERSITY DEPARTMENT OF CIVIL ENGINEERING. Subject code: EN0701- Environmental Microbiology. Topic / Content Book Learning outcomes
SRM UNIVERSITY DEPARTMENT OF CIVIL ENGINEERING Subject code: EN0701- Environmental Microbiology Semester: I Course: M. Tech Envn. Eng. LESSON PLAN Year: 2011 Lecture in hours Topic / Content Book Learning
More informationAbstract: Contents. Literature review. 2 Methodology.. 2 Applications, results and discussion.. 2 Conclusions 12. Introduction
Abstract: Landfill is one of the primary methods for municipal solid waste disposal. In order to reduce the environmental damage and to protect the public health and welfare, choosing the site for landfill
More informationBy Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD
By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)
More informationIn vitro the effect of intestinal normal flora on some pathogenic bacteria.
In vitro the effect of intestinal normal flora on some pathogenic bacteria. Abstract: Dr.abbass shaker Ali adel Leena abd Al-Redha The effect of two types of intestinal bacterial normal floral ( and klebsiella)
More informationCIVIL 3136 TAMU College Station, Texas (979) FAX (979) CVEN
CVEN 489-501 Special Topics in Mixing and Transport in the Environment Midterm Exam #2 April 22-25, 2005 Name: CIVIL 3136 TAMU College Station, Texas 77843-3136 (979) 845-4517 FAX (979) 862-8162 Instructions:
More informationInfluence of Enterococcal Surface Protein (esp) on the Transport of Enterococcus faecium within Saturated Quartz Sands
Influence of Enterococcal Surface Protein (esp) on the Transport of Enterococcus faecium within Saturated Quartz Sands Jennifer J. Johanson, Lucia Feriancikova, Shangping Xu* Department of Geosciences
More informationLedyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005
Ledyard Public Schools Science Curriculum Biology Level-2 1422 Instructional Council Approval June 1, 2005 Suggested Time: Approximately 9 weeks Essential Question Cells & Cell Processes 1. What compounds
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More information2.2 Variation and interdependence
1 of 5 The National Strategies Secondary 2.2 Variation and interdependence 7 describe how organisms can vary and how this may lead to their survival in changing environments describe how the major taxonomic
More informationRapid Flood Mapping Using Inundation Libraries
Rapid Flood Mapping Using Inundation Libraries Jude Kastens, Kevin Dobbs, James Halgren, Katherine Balster 2017 ASFPM Conference May 3, 2017 5 mi Kansas River Valley between Manhattan and Topeka Email:
More informationNatural Genetic Resistance to Infection
Natural Genetic Resistance to Infection The Discovery of Natural Determinants of Susceptibility to Infection in Cattle, especially Tarentaise Steve A Carlson, DVM PhD Tim A Day, PhD PSR Genetics, LLC Scott
More informationRick Faber CE 513 Geostatistical Analyst Lab # 6 6/2/06
Rick Faber CE 513 Geostatistical Analyst Lab # 6 6/2/06 2 1. Objective & Discussion: Investigate and utilize Kriging methods of spatial interpolation. This lab is meant to highlight some of the strengths
More informationPDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE
19 January, 2018 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE Document Filetype: PDF 222.61 KB 0 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE How to Tell the Difference Between Prokaryotes and Eukaryotes.
More information2007 Area Source Emissions Inventory Methodology 670 RANGE IMPROVEMENT
San Joaquin Valley AIR POLLUTION CONTROL DISTRICT 2007 Area Source Emissions Inventory Methodology 670 RANGE IMPROVEMENT I. Purpose This document describes the Area Source Methodology used to estimate
More informationIntroduction to de novo RNA-seq assembly
Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies
More informationSTUDY OF THE DIVERSITY OF E. COLI STRAINS ISOLATED FROM AQUATIC ENVIRONMENTS
STUDY OF THE DIVERSITY OF E. COLI STRAINS ISOLATED FROM AQUATIC ENVIRONMENTS Papatzitze O. 2,3, *, Pappa O. 4, Karagouni A.D. 3, Lymperopoulou D.S. 3, Kalkani E. 1, Papanastasiou A. 2, Spanakos G. 4, Keramydas
More informationA Study of Several Statistical Methods for Classificaiton with Application to Microbial Source Tracking. Xiao Zhong
A Study of Several Statistical Methods for Classificaiton with Application to Microbial Source Tracking by Xiao Zhong A Project Report Submitted to the Faculty of WORCESTER POLYTECHNIC INSTITUTE in partial
More informationInterpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder
Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder nrpace@colorado.edu Outline What is the Tree of Life? -- Historical Conceptually
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationVT EPSCoR Streams Project: Highlights & Future Plans. Streams Project Symposium April 27, 2009
VT EPSCoR Streams Project: Highlights & Future Plans Streams Project Symposium April 27, 2009 What is the Streams Project? Collaborative effort by high schools, colleges and community partners around the
More informationBiology Assessment. Eligible Texas Essential Knowledge and Skills
Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More informationMicrobes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng
Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS Elizabeth Tseng Dept. of CSE, University of Washington Johanna Lampe Lab, Fred Hutchinson Cancer
More information