Journal of Bacteriology

Transcription

1 JB Accepts, published online ahead of print on 30 December 2011 J. Bacteriol. doi: /jb Copyright 2011, American Society for Microbiology. All Rights Reserved. 1 Submitted to: Journal of Bacteriology Corresponding Author: Brian A. Federici Department of Entomology University of California, Riverside Riverside, California Tel: Fax: brian.federici@ucr.edu A 54-kDa protein encoded by pbtoxis is required for parasporal body structural integrity in Bacillus thuringiensis subsp. israelensis Mercedes Diaz-Mendoza 1, Dennis K. Bideshi 1,2, and Brian A. Federici 1, Department of Entomology, University of California, Riverside, Riverside, California 92521; 2 Department of Natural and Mathematical Sciences, California Baptist University, 8432 Magnolia Avenue, Riverside, California 92504; 3 Interdepartmental Graduate Programs in Genetics and Cell, Molecular and Developmental Biology, University of California Riverside, Riverside, California Abstract: 249 words; Text: 4442 words 21 1

2 Abstract Strains of Bacillus thuringiensis such as B. thuringiensis subsp. israelensis (ONR-60A) and B. thuringiensis subsp. morrisoni (PG-14) pathogenic for mosquito larvae produce a complex parasporal body consisting of several protein endotoxins synthesized during sporulation that form an aggregate of crystalline inclusions bound together by a multilamellar fibrous matrix. Most studies of these strains focus on the molecular biology of the endotoxins, and although it is known that parasporal body structural integrity is important to achieving high toxicity, virtually nothing is known about the matrix that binds the toxin inclusions together. In the present study, we undertook a proteomic analysis of this matrix to identify proteins that potentially mediate assembly and stability of the parasporal body. In addition to fragments of their known major toxins, namely Cry4Aa, Cry4Ba, Cry11Aa and Cyt1Aa, we identified peptides with 100% identity to regions of Bt152, a protein coded for by pbtoxis of B. thuringiensis subsp. israelensis, the plasmid that encodes all endotoxins of this subspecies. As it is known that Bt152 is expressed in B. thuringiensis subsp. israelensis, we disrupted its function and showed that inactivation destabilized the parasporal body matrix, and concomitantly, inclusion aggregation. Using fluorescence microscopy, we further demonstrate that Bt152 localizes to the parasporal body in both strains, is absent in other structural or soluble components of the cell, including the endospore and cytoplasm, and in ligand blots binds to purified multilamellar fibrous matrix. Together the data show that Bt152 is essential for stability of the parasporal body of these strains. 42 2

3 Introduction The bacterium Bacillus thuringiensis consists of a complex of subspecies, many of which are pathogens of insects. Pathology is initiated through the action of proteins known as Cry (crystal) and Cyt (cytolytic) endotoxins synthesized during sporulation and assembled into one or more crystalline parasporal bodies. Most subspecies are toxic to lepidopteran larvae, but several subspecies are also toxic to coleopteran or dipteran larvae (30). The endotoxin proteins are actually protoxins coded for by plasmids in which protoxin gene expression is controlled by sporulation-dependent promoters. In insects sensitive to Cry and Cyt proteins, the parasporal bodies dissolve in the midgut lumen after ingestion, and are then proteolytically activated by midgut proteases. Activated Cry proteins bind to midgut microvillar proteins, oligomerize, and insert into the membrane where they kill epithelial cells through formation of cation channels or pores and induction of cell death pathways (30, 5). Alternatively, Cyt proteins are lipophilic, found primarily in subspecies toxic to dipterans, and do not require midgut microvillar proteins for binding, but instead insert directly to the lipid bilayer, in which they form ion channels or lipid faults that lead to cell lysis (4, 19). Within a subspecies, strains of B. thuringeinsis with the highest toxicity and broadest host ranges typically contain several Cry proteins, in the case of those toxic to lepidopteran species, or a combination of Cry and Cyt proteins in dipteran-toxic strains. The HD1 isolate of B. thuringiensis subsp. kurstaki (H3a3b3c), for example, typically produces three Cry1 proteins (Cry1Aa, Cry1Ab, and Cry1Ac) and at least one Cry2 protein (Cry2Aa). Those most toxic to and with the broadest activity against dipteran species include B. thuringiensis susbp. israelensis (H14) and the PG-14 isolate of B. thuringiensis subsp. morrisoni (H8a8b) that are primarily pathogenic to larvae of the dipteran suborder Nematocera, which includes insects such as 3

4 mosquitoes and black flies (8). These strains differ from B. thuringiensis subsp. kurstaki (HD1) in that they produce three major mosquitocidal Cry proteins (Cry4Aa, Cry4Ba, and Cry11Aa), and at least one Cyt protein (Cyt1A). In addition to the multiplicity of toxins, structural studies of parasporal bodies suggest that high toxicity combined with broad host range evolved through the origin of traits that bound the protoxins together until ingested. In B. thuringiensis subspecies kurstaki (HD1), the three Cry1A proteins co-crystallize to form a single bipyramidal crystal (30). Even more interestingly, during sporulation the Cry2A inclusion assembles with and is partially embedded at the short axis of the bypryamidal crystal (22). In the above mosquitocidal isolates of B. thuringiensis, parasporal body structure is even more complex (14, 23). Cry and Cyt inclusions are surrounded individually as well as bound together by a peripheral multilaminate fibrous matrix of unknown composition. This association of protoxins is important to the toxicity and host range of these mosquitocidal strains, as numerous studies have shown that in addition to synergistic interactions among the Cry proteins, the Cyt proteins, which make up more than 50% of the parasporal body, strongly synergize Cry proteins, and even more importantly, delay expression of mosquito resistance to these (38). Nothing is known about the underlying molecular mechanisms through which Cry and Cyt proteins in the mosquitocidal isolates are targeted to the parasporal body matrix or how the structural integrity of this matrix is maintained. It is known, however, that all the protoxins in B. thuringiensis subsp. israelensis, as well as many other genes of unknown function are coded for by a large plasmid (128 kb), pbtoxis (2), and that in addition to protoxin genes, many of these are expressed during sporulation (32). The coordination of the synthesis and assembly of several protoxins and their association with the parasporal body fibrous matrix during the period when 4

5 other pbtoxis proteins are synthesized suggests that one or more of the latter are important in parasporal body formation and stability. To investigate this possibility, we undertook a proteomic approach to identify proteins other than endotoxin proteins associated with the parasporal body. Here we show that a 54-kDa protein coded for by pbtoxis gene Bt152, associates with the parasporal body as it develops, and that deletion of this protein results in a loss of parasporal body structural integrity MATERIAL AND METHODS Bacterial strains, propagation and transformation The PG-14 isolate of B. thuringiensis subsp. morrisoni and crystalliferous and acrystalliferous strains B. thuringiensis subsp. israelensis, respectively, 4Q5 and 4Q7, have been previously described (14, 23, 34). These strains were routinely cultured and maintained on Nutrient agar (NA) (Difco) and Nutrient broth + glucose (NBG) (14). All strains were transformed by electroporation (34) and transformants were selected on Luria-Bertani agar with appropriate antibiotics (below). Plasmids propagated in Escherichia coli DH5α and strains 4Q5 and PG14 were purified using, respectively, the Wizard Plus Miniprep kit (Promega) and Nucleobond Plasmid Midi kit (Clontech) Purification of parasporal bodies and crystalline inclusions. The PG-14 isolate, strain 4Q5, and 4Q7 strains producing Cyt1Aa, Cry11Aa, Cry4Aa and Cry4Ba (39, 37) were grown in 500 ml NBG at 30 C, 250 rpm for 4 days to optimize sporulation (>95%) and parasporal body formation. The spore-crystal mixture was harvested by centrifugation at 18,000 rpm for 30 min at 4 C in a Sorvall SS-34 rotor and washed 5x thoroughly with ddh 2 0 and pelleted using the same centrifugation protocol. Washed pellets were resuspended in 10 ml ddh 2 0, sonicated for 5 5

6 min (Ultrasonic Homogenizer 4710 series, Cole Palmer), and layered onto discontinuous sucrose gradients ( %) for isopycnic centrifugation at 20,000 rpm for 1 h at 4 C using a Beckman SW-27 rotor. Bands containing parasporal bodies were extracted and taken through two additional rounds of gradient centrifugation to optimize purity. Isolated parasporal bodies were washed 5x in ddh 2 0 and collected each time by centrifugation in a Sorvall SS-34 rotor at 18,000 rpm for 30 minutes at 4 C. Purified parasporal bodies were dialyzed in ddh 2 0 overnight at 4 C using a MWCO 12-14,000 Spectra/Por Membrane (Spectrum Laboratories, Inc.) and lyophilized for storage and further studies Enrichment and preparation of multilammelar fibrous matrix for mass spectrometry. To enrich the matrix that binds the protoxin inclusions together, Cry and Cyt1A proteins were removed by dissolution in alkaline buffers for proteomic analysis. Approximately 12 µg of purified parasporal bodies was incubated for 4 h at 37 C in 35 µl of NE buffer (50 mm NaOH, 10 mm EDTA; ph 12.8) to solubilize protoxin inclusions. After incubation, the sample was spun at 10,000 rpm, 30 min at 4 C in a Beckman TA-15 rotor and the supernatant was discarded. The pellet was resuspended in 35 μl of NE buffer. A control sample was prepared using an identical quantity of parasporal bodies in ddh 2 O. Aliquots of the alkali treated and untreated samples were analyzed by MS Q-TOF (Mass Spectrometry, Quadrupole time-of-flight mass spectrometry; Genomics Core Facility, University of California, Riverside) and by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (17). Peptide sequences derived from the MS Q-TOF analysis were compared with those of predicted peptides encoded by pbtoxis (GenBank AL731825), as the complete sequence of this plasmid is known (2), and sequences in the DDBJ/EMBL/GenBank databases. 6

7 Transmission electron microscopy (TEM). Purified parasporal bodies from recombinant strains (see below) and enriched multilamellar fibrous matrix were examined by electron microscopy. Pellets were fixed in 3% glutaraldehyde in 0.1 M cacodylate buffer for 2 hours, followed by fixation in 1% OsO 4 in the same buffer for 1 hour, dehydrated in an ethanol series to propylene oxide and embedded in Epon-Araldite. Ultrathin sections were stained with lead citrate and uranyl acetate, and examined and photographed with a Hitachi 600 transmission electron microscope. Negative staining was also performed using treated and untreated parasporal bodies with 1% (w/v) phosphotungstic acid (K-PTS) in 0.1 M sodium phosphate (ph 5-7) adjusted with 1 N KOH Sequence analysis of Bt152. The amino acid sequence of Bt152 was analyzed using various online programs, including BLAST (blastp and cdart; Secondary structures were identified using the PSIPRED protein structure predictor program ( Disruption and recovery of Bt152 function. A fragment containing the Bt152 ORF (2.3 kbp) in pbtoxis (2) was amplified by PCR using the primer pairs 152F 5 - CCCATGCATAGAAGTTTATGATAGCGTAATAC-3 and 152R 5 - CCCGAGCTCAAGCATACCATAGGTATGCCAC-3 and the Expand Long Template PCR System (Boehringer GmbH, Mannheim, Germany) for 30 cycles as follows: 94 C for 1 min, 55 C for 1 min, and 72 C for 2 min. The amplicon was cloned in pgem-t Easy (Promega, Madison, USA) to generate plasmid pgem-orf152. The nucleotide sequence of the amplicon 7

8 was determined to confirm its genetic integrity. To generate plasmid ppg-bt152, the 2.3 kb SmaI/SacI fragment from pgem-orf152 was cloned in the same site in the E.coli-B. thuringiensis shuttle vector ppg, a vector we constructed by cloning the 2.4 kb amplicon of pgdv1 (29) amplified with primers containing AflIII sites (GVD-F 5 ACATGTCGAGATAGAGGTATGCATTTATAG-3 and GDV-R 5 - ACATGTGCTCTAGCCACTCATAGTTCAAG-3 ), in the AflIII site in puc18 (Biolabs). ppg harbors ampicillin and chloramphenicol resistance genes for selection in, respectively, E. coli and B. thuringienisis. To disrupt the Bt152 gene in strain 4Q5 by homologous recombination, the open reading frame (ORF) of Bt152 in pgem-orf152 was eliminated by inverse PCR with the primer pair d152f 5 -ACCGCTCGAGGAAGTAGCTGGTTCGCAAACTACTAATGG-3 and d152r 5 - ACCGCTCGAGGGAAATGAGATACTATCCTGACAATCTGTC-3, each containing an added XhoI site, using the Expand Long Template PCR System (Boehringer GmbH, Mannheim, Germany) for 30 cycles as follows: 94 C for 1 min, 55 C for 1 min, and 72 C for 2 min. The amplicon, which contained sequences flanking the Bt152 ORF and the intact pgem-t Easy vector, was digested with XhoI, and the 1.2 kbp SalI fragment from puce (35) containing the erythromycin resistance (erm r ) gene originating from pht3101 (18) was cloned into this site to generate the plasmid pgem-erm-dorf152. The 4Q5 strain was electroporated with pgem- Erm-dORF152 and transformants (4Q5-Erm-dORF152) with the disrupted Bt152 gene were selected on Brain Heart Infusion agar (BHI) with erythromycin (12.5 μg/ml). Disruption of Bt152 was confirmed by PCR using primer pairs, 152F 5 - CCCATGCATAGAAGTTTATGATAGCGTAATAC-3 and 152R 5 - CCCGAGCTCAAGCATACCATAGGTATGCCAC-3 ; and ErmF 5-8

9 ACGCGTCGACAGAAGCAAACTTAAGAGTGTG-3 and ErmR 5 ACGCGTCGACATCGATACAAATTCCCCGTAG-3. To recover the function of Bt152, 4Q5- Erm-dORF152 was transformed with ppg-orf152 and transformants (4Q5-ErmdORF152/pPG-Bt152) were selected on BHI with erythromycin (12.5 μg/ml) and chloramphenicol (2.5 μg/ml) In vivo localization of Bt152. To construct the chimeric Bt152-GFP, the Bt152 gene sequence containing its native promoter and open reading frame (ORF) was amplified by PCR as described above using the primer pair: DB152F 5 - CCATCTAGAAGAAGTTTATGATAGCGTAATACATTGG-3 and DB152R 5 - GGCGCCAATTGGTTGTATTAAGAATGTTTGATTTC-3, the gfp coding sequence in pizt- V5/His (Nitrogen) was amplified with GFPF 5 - GGCGCCATGGCTAGCAAAGGAGAAGAACTT-3 and GFPR 5 - GAATTCTTAATCCATGCCATGTGTAATCCC-3, and the terminator sequence from Bt157 (157ter) (Tang et al. 2007) was amplified the primer pair 157GterF 5 - GAATTCAAAAGCAGGTCTAATGACCTGCT-3 and 157terR ACATGCATGCTAAATAGTCTTTTGGTTCTTTTAA-3. The Bt152, gfp, and 157ter amplicons were cloned into pgem-t Easy to confirm sequence integrity, digested with, respectively, XbaI and NarI, NarI and EcoRI, and EcoR1 and Sph1 (restriction sites are underlined in primer sequences), and the three fragments together were ligated to pht3101 digested with Xba1 and SphI, to generate plasmid pht152-gfp. The orientation of the fragments in pht152g was confirmed by restriction analysis. The 4Q5 and PG14 isolates were transformed with pht152-gfp by electroporation, and transformants were selected on LB with 9

10 erythromycin (12.5 μg/ml). Three colonies harboring pht152g were subcultured on NA and sporulating cells were monitored by fluorescence microscopy (Leica DMRE fluorescent microscope) for localization of the Bt152-GFP chimera Recombinant Bt152-(6x)his. A fragment containing The Bt152 ORF, its ribosome binding site, and 6 artificially introduced histidine codons at the carboxy-terminus followed by a stop codon was amplified by PCR, as described above, using the primer pair, DB152Fhis and DB152Rhis, respectively. 5 -CCTCTAGATGAATAAAGTGGGGAAATAATATG-3 (XbaI site underlined) and 5 - GGCATGCTTAATGATGATGATGATGATGTCCGCTAGCAATTGGTTGTATTAAGAATG TTTGATTTC-3 (SphI site underlined). The 1480 bp amplicon was sequenced to confirm its integrity, digested with XbaI and SphI and cloned in the same sites in pstab for overexpression using the cyt1a-p/stab-sd promoters (24) in strain 4Q7. The recombinant Bt152-his protein was purified under denaturing conditions using 6 M guanidine hydrochloride and 8 M urea buffers and nickel-nitrilotriacetic acid resin columns, according to the manufacturer's protocol (QIAGEN). The InVision His-tag In-gel Stain (Invitrogen) was used to confirm the presence and purity of Bt152-his. The purified protein was desalted and concentrated using Centricon centrifugal filters (Millipore), and assayed using the Coomassie protein assay kit (Pierce) Ligand binding assays. From 1-4 μg of purified and solubilized parasporal bodies (matrixenriched fraction) from strain 4Q5, isopycnic gradient-purified Cry4Aa, Cry4Ba, Cry11Aa, Cyt1Aa, bovine serum albumin (BSA), and Bt152-his were dot-blotted to nitrocellulose membrane (NitroBind, Micron Separations Inc.) and immobilized by drying the membrane at 10

11 ambient temperature overnight. The membrane was incubated with blocking reagent (5% BSA in phosphate-buffered saline [PBS], ph 7.5) for 2 h. The blocking reagent was removed and the membrane was incubated in 10 ml PBS + 0.2% Tween 20 (PBST) containing purified Bt152-his (100 μg/ml). After two 15-min washes in 100 ml PBST, the membrane was incubated for 2 h with Anti-His (C-term)-HRP Antibody (Invitrogen) and binding was detected using the ECL chemiluminescent detection reagent (GE Healthcare Life Sciences), according to manufacturer s protocols. Assays were replicated 5 times RESULTS Microscopy of purified parasporal body and multilamellar fibrous matrix. Transmission electron microscopy of isolated parasporal bodies from B. thuringiensis subsp. morrisoni (PG- 14) showed densely packed protein inclusions surrounded by the multilamellar fibrous matrix (Fig. 1A), as previously observed (14, 23). Treatment of parasporal bodies with NE buffer (50 mm NaOH, 10 mm EDTA; ph 12.8) dissolved the protoxin crystalline inclusions, but exhibited little or no degradation of the multilamellar matrix (Fig. 1B, C). It is known that the matrix is excreted from the alkaline midgut of mosquito larvae following crystal solubilization (14) MS Q-TOF analysis of purified parasporal bodies identifies a novel protein, Bt152. Many of the peptide sequences identified by mass spectrometry of intact parasporal bodies corresponded to sequences present in Cry4Aa, Cry4Ba, Cry11A and Cyt1Aa (Table 1). In addition, database searches also identified peptide sequences with high levels of identity to those found in five proteins (Bt073, Bt075, Bt113, Bt148 and Bt152) coded for by pbtoxis (Table 1) of B. thuringiensis subsp. israelensis (2, 32). Of these, only Bt113 and Bt152 contained conserved 11

12 domains that were readily identified by in silico analyses (Fig. 2A, B). Bt113 contained a conserved domain (residues 30-78) in DUF2602 superfamily (pfam10782). The function of this bacterial family of proteins is unknown at present. The Bt152 protein is bipartite in composition, as it contains two well characterized domains of which the occurrence of both in other proteins in the database has not been previously reported (Fig. 2B, C). The N-terminal region of Bt152 harbors a metallophosphatase (MPP) domain (cd00838, residues ), whereas the C-terminal region is composed of a ricin-type beta-trefoil fold (pfam00652). The MPP domain is found in a wide variety of protein superfamilies, including phosphoprotein phosphatases, YfcE-like phosphatase, purple acid phosphatases, Mre11/SbcD-like exonucleases, Dbr1-like RNA lariat debranching enzymes, Ybbf-like UDP-like UDP-2-3-diacylglucosamine hydrolases, and acid sphingomyelinases. The architecture of the MPP domain is a double beta-sheet sandwich with a di-metal active site made up of residues located at the C-terminal side of the sheets. This domain is thought to allow for productive metal coordination. The beta-trefoil fold domain is characterized by twelve beta strands folded into three similar beta-beta-beta-loop-beta (trefoil) units, where the overall fold has pseudo-threefold symmetry and consists of a six-stranded barrel capped by a triangular hairpin triplet. The connecting loops of the beta strands are known to vary in length and structure and provide specificity for binding to ligands such as other proteins, DNA, lipid membranes and carbohydrates. The ricin-type beta-trefoil fold is found in a number of lectin-binding proteins, including ricin, hemagglutinin-related proteins including the HA-33 protein of Clostridium botulinum and its homologue in C. acetobutylicum, Cry (Cry41Ab1, Cry42Ab1) and Cyt (Cyt1Ca) of B. thuringiensis, and the mosquitocidal toxins (Mtx) produced by Bacillus 12

13 sphaericus during vegetative growth (13, 12, 7, 6, 9). The most characteristic feature of the betatrefoil fold domain in lectin-binding proteins is the presence of three spatially separated glutamine-x-tryptophan (QXW) 3 repeats, although the sequence is not absolutely conserved (13). Interestingly, Bt152 lacks three copies of the QXW 3 motif, but contains one strictly conserved (QKW) and one degenerate (HYW) triplet at corresponding positions in other proteins with this domain (Fig. 2C). However, the overall secondary structure of the C-terminal region of Bt152, and especially surrounding the triplets, is rich in beta strands and devoid of alpha helices, thus being structurally similar to its orthologues (Fig. 2C; Fig. 3) Bt152 is essential for structural stability of parasporal body. To determine its role in parasporal body stability, the gene coding for Bt152 in pbtoxis in B. thuringiensis subsp. israelensis 4Q5 was inactivated by recombination using a homologous fragment harboring an erythromycin resistance gene marker (Fig. 4). We used this strain because it is cured of all plasmids native to this subspecies, except pbtoxis. In addition, we assumed that gene orthologues in PG14, for which the number of plasmids and their complete sequences have not been reported, has the same function, particularly as we sequenced the Bt152 homologue and showed that it was 100% identical to Bt152 (GenBank accession No. NC_010076). Transmission electron micrographs showed the presence of three enveloped crystalline inclusions in parasporal bodies produced by 4Q5 surrounded by the multilamellar fibrous matrix (Fig. 4a-c), identical to that described previously (14, 23). In contrast, structurally uniform parasporal bodies were not observed in the 4Q5 mutants (4Q5-Erm-dORF152) lacking Bt152 (Fig. 4d-f). In these mutants, each crystalline inclusion was surrounded by a layer of the fibrillar matrix that was thinner compared to the matrix around the periphery of the wild type parasporal body. More importantly, 13

14 the inclusions in the deleted Bt152 mutant lacked the thick fibrillar matrix at the periphery of the parasporal body characteristic of that in the wild type strain. To demonstrate that Bt152 was essential for parasporal body stability, the shuttle vector ppg-bt152 was used to reintroduce intact Bt152 into 4Q5-Erm-dORF152. Micrographs of parasporal bodies isolated from the resultant strain, 4Q5-Erm-dORF152/pPG-Bt152, showed a regeneration of the wild type parasporal body phenotype in which crystalline inclusions aggregated and were bound by the peripheral mulilamellar fibrous matrix (Fig. 4g- i) Cellular localization of Bt152. The gene disruption and replacement data above showed that Bt152 was required for parasporal body stability, but not whether stability resulted from a direct or indirect interaction of this protein with components of the parasporal aggregate. To determine whether Bt152 was involved with stabilization through direct interaction with the parasporal body, B. thuringiensis subsp. israelensis 4Q5 was transformed with a Bt152-GFP chimera. Fluorescence microscopy demonstrated that the labeled protein localized to the parasporal body, and was not found elsewhere in the cytoplasm or with other structural components of the cell, such as the cell wall or spore (Fig. 5a-c). The B. thuringiensis subsp. morrisoni (PG-14) Bt152 homologue is identical to B. thuringiensis 4Q5 protein, and thus it is likely its function is similar if not the same. When PG-14 was transformed with the Bt152-GFP chimera, and as observed with 4Q5, fluorescence was localized to the parasporal body, and not to other cellular structures (Fig. 5d-f) Bt152 binds to the fibrous multilamellar matrix. To determine whether recombinant Bt152 (Fig. 6A) could interact directly with the fibrous matrix, crystalline protoxins, or both, dot blot 14

15 assays were performed with solubilized composite parasporal bodies and each of its purified components. We used dot-blot analysis because we were unable to separate or detect the fibrous matrix by SDS-PAGE. The results of 5 replicate assays showed more robust binding of Bt152 to the enriched fibrous matrix when compared with binding to the other components (Fig. 6B). We further observed that the protein could bind solubilized parasporal body that contained all of its composite structures. In comparison, a low level of binding occurred between Bt152 and Cry11Aa, Cry4Ba, Cyt1Aa. No signal was observed with Bt152 and Cry4Aa and bovine serum albumin (BSA), an unrelated eukaryotic protein used as a negative control. In addition, as no signal was detected in the control blot with the various immobilized components, except Bt152- his, and liquid phase containing the anti-his tag antibody but not Bt152-his, the observed intermolecular interactions described above were not the result of non-specific binding between the antibody and the various components assayed. Interestingly, a qualitatively stronger signal was observed with immobilized Bt152-his in the presence of mobilized Bt152-his and the antihis antibody, an observation that suggests a Bt152-Bt152 intermolecular interaction. However, such a conclusion requires further quantitative approaches. Nevertheless, these results show clearly that Bt152 could directly interact with at least the miltilamellar fibrous matrix and possibly the protoxins. In addition, similar results were observed in ligand blots with crystalline proteins fractionated by SDS-PAGE and blotted to nitrocellulose membrane (data not shown) DISCUSSION In the present study we provide genetic, ultrastructural and biochemical evidence demonstrating that Bt152 coded for by pbtoxis is essential for parasporal body stability in B. 15

16 thuringiensis subsp. israelensis. This finding is supported by our Bt152-GFP fluorescence microscopy studies using the Bt152 homologue in B. thuringiensis subsp. morrisoni (PG-14), which indicate the function of this protein is similar if not identical in both strains. The specificity of Bt152 for the parasporal body, but not cytoplasmic or other structural components of the cell, including the spore and cell wall, suggests that specific domains have evolved in this protein that target it to the parasporal body fibrous matrix where it is involved in maintaining the stability of this structure. Although further studies are required to elucidate the precise mechanism of its stabilizing effect on the parasporal composite, the presence of the highly conserved metallophosphatase (MPP) and ricin-like beta-trefoil fold domains is suggestive of its function. In this regard, the structural and functional characterization of the carbohydrate-binding activity of the ricin-like beta-trefoil fold has been well characterized in proteins of eukaryotic and prokaryotic origin, including plant ricin, the hemagglutinating protein (HA33/A) of the botulin neurotoxin of Clostridium botulinum, and a few Cry and Cyt proteins of B. thuringiensis and Mtx toxins of Bacillus sphaericus (1, 7, 6, 15, 12, 13, 28). Thus, Bt152 could be a novel lectin that putatively interacts with carbohydrate moieties of the multilammelar fibrous matrix and/or in Cry11Aa, Cy4Ba and Cyt1Aa. At present, the nature of the chemical linkages between sugars and the protoxins has not been well defined, although several putative sites for O- and N- glycosylation are present in their primary structures (11). Moreover, experimental data have suggested that these toxins contain the aminosugar N-acetyl-D-glucosamine (GlcNAc) linked to asparagine residues (20, 27, 26). Whether GlcNAc is a component of the multilammelar fibrous matrix is unknown, but if so, it could be a focus of binding for Bt152. A potential function of the MPP domain is less clear as it is present in wide variety of proteins in the metallophosphatase superfamily (NCBI accession cl13995; 16

17 including enzymes involved in proteolysis, and nucleic acid, lipid and carbohydrate metabolism. Importantly, the phosphatase activity of many of these enzymes is necessary for both down-regulation and upregulation of many cellular pathways, particularly the cell cycle in eukaryotes and prokaryotes. It is known that phosphatases modulate expression patterns of sporulation genes in Bacillus subtilis, where for example, SpoOA that is required to initiate sporulation is activated by the socalled phosphorelay system (41, 42). Moreover, sequences within or around MPP could be required for dimerization, as has been reported for the purple acid phosphatase (16, 33). Therefore it is tempting to speculate that the MPP of Bt152 could modulate sporulation allowing for more efficient synthesis of the parasporal body, or it could be involved with dimerization of Bt152, which together with the putative carbohydrate-binding lectin domain results in aggregation of the crystalline inclusions and ultimately stability of the parasporal body. The chemical composition of the fibrous matrix is not known. In preliminary studies aimed at characterizing its enzymatic sensitivity, we observed that the multilamellar fibrous matrix is resistant to proteolysis with proteinase K and chymotrypsin, lipolyis with lipases, saccharolysis with amylases, and no apparent effect has been observed with lysozyme that degrades peptidoglycan (data not shown). Therefore, the fibrous matrix is a resilient component of the parasporal body that is not only resistant to alkaline environments, in vivo and in vitro (14, 23), but also to degradation by the many digestive enzymes encountered in the digestive tract of mosquito larvae. Regardless, we think that the multilamellar fibrous matrix is a carbohydrate polymer, or has carbohydrate moieties to which its interaction with Bt152 is mediated though the lectin-like beta-trefoil fold. A simplistic model could be that binding of Bt152 to the periphery of the matrix together with homodimeric or homooligomeric intermolecular interactions of the 17

18 protein, or interactions with additional molecular intermediates, facilitates both aggregation of the crystalline inclusions and ultimately structural stability of the parasporal body. Thus, our ongoing work is focused on elucidating the biochemical composition of the fibrous matrix and the specific function(s) of the two conserved domains in Bt152. Regarding the other proteins (Bt073, Bt075, Bt113 and Bt148) identified in the proteomic screen of purified parasporal bodies, their functions remain unresolved at present. Whether these proteins, like Bt152, are part of the parasporal body composite or artifacts due to inadvertent contamination as a result of the purification scheme could be deciphered using the fluorescence and ligand-binding techniques described here. Indeed, it would be an interesting finding if these proteins interact with Bt152 in aggregating and/or stabilizing, respectively, the crystalline inclusions and parasporal body, or function independently or in concert in the morphogenesis of these. As such, their functions could also include packaging of nascent protoxins into stable crystalline inclusions. Further studies are required to resolve their significance in the structural biology of the parasporal body. Finally, the combination of crystalline protoxins in a single parasporal body has been selected during the evolution of these bacterial species to produce a highly efficacious larvicide in which individual toxin components presumably have different, and perhaps overlapping molecular targets in the midgut epithelium. Thus Cry4A, Cry4B, Cry11A, cooperatively produce the lethal effect observed in susceptible larvae (37, 38). Moreover, studies over the past decade have clearly established that Cyt1Aa, a lipophilic toxin with a different mode of action than the Cry proteins (4, 19), synergizes the toxicity of Cry4A, Cry4B and Cry11A, and delays the evolution of resistance to these in Culex quinquefasciatus (37, 38, 25). As a result of the complex interactions among these toxins, resistance to B. thuringiensis subsp. israelensis has not been 18

19 observed in field populations of mosquitoes. Indeed, it is likely that the success of B. thuringiensis subsp. israelensis as a robust pathogen of mosquito larvae is in part due to the delivery of a stable composite of crystalline protoxins bound by the multilamellar fibrous matrix to its targets. Interestingly, this strategy may not be unique to B. thuringiensis subsp. morrisoni (PG-14) and B. thuringiensis subsp. israelensis as similar enveloped inclusions have been described in less known B. thuringiensis strains toxic to lepidopterans and dipterans, including the mosquito-specific B. thuringiensis serovar. fukuokaensis (10, 21, 31, 36) ACKNOWLEDGMENTS 422 We thank Jeffrey J. Johnson for technical assistance during this study and the services provided by 423 Proteomic Core and Electron Microscope facilities at the University of California, Riverside. This research 424 was supported by a grant from the National Institutes of Health (1 RO1 AI45817) to B. A. Federici

20 REFERENCES 1. Arndt, J.W., Gu, J., Jaroszewski,L., Schwarzenbarcher, R. Hanson, M.A., Lebeda, D., and Stevens, R. C The structure of the neurotoxin-associated protein HA33/A from Clostridium botulinum suggests a reoccuring B-trefoil fold in the progenitor toxin complex. J.Mol.Biol Berry, C., O Neil, S., Ben-Dov, E., Jones, A. F., Murphy, L., Quail M. A., Holden M. T., Harris, D., Zaritsky, A., and Parkhill, J Complete sequence and organization of pbtoxis, the toxin-coding plasmid of Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 68: Bravo, A. Gill, S.S., Soberon, M Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon. 49: Butko, P Cytolytic toxin Cyt1A and its mechanism of membrane damage: data and hypotheses. Appl. Environ. Microbiol. 69: Cancino-Rodezno A, Porta H, Soberon M, Bravo A Defense and death responses to pore forming toxins. Biotechnol. Genet. Eng. Rev. 26: Carpusca I, Jank T, Aktories K Bacillus sphaericus mosquitocidal toxin (MTX) and pierisin: the enigmatic offspring from the family of ADP-ribosyltransferases. Mol. Microbiol. 357: de Maagd, R. A., Bravo, A., Berry, C., Crickmore, N., Schnepf, E. 2993, Structure, diversity, and evolution of protein toxins from spore-froming entomopathogenic bacteria. Ann.u. Rev. Genet. 37: Federici, B. A., Park, H.-W., Bideshi, D. K Overview of the basic biology of Bacillus thuringiensis with emphasis on genetic engineering of bacterial larvicides for mosquito control. The Open Toxinology J. 3:

21 Feng, J., Li, M., Huang, Y., Xiao, Y Symmetric key structural residues in symmetric proteins with beta-trefoil fold. PLoS One. 5(11):e Fitz-James, P.C., Gillespie, J.B., and Loewy, D A surface net on parasporal inclusions of Bacillus thuringiensis. J. Invertebr. Path. 43, Gill, S.S., Cowles, E.A., and Pietrantonio P.V The mode of action of Bacillus thuringiensis endotoxins. Annu. Rev. Entomol. 37: Hazes, B. and Read R.J A mosquitocdal toxin with a ricin-like cell-binding domain. Nat,. Struct. Biol. 2: Hazes B The (QxW)3 domain: a flexible lectin scaffold. Protein Sci. 5: Ibarra, J.E. and Federici, B.A Parasporal bodies of Bacillus thuringiensis subsp. morrisoni (PG-14) and Bacillus thuringiensis subsp. israelensis are similar in protein composition and toxicity. FEMS Microbiol. Lett. 34: Itsko, M., Manasherob, R., Zaritsky, A Partial restoration of antibacterial activity of the protein encoded by a crptic open reading frame (Cyt1Ca) from Bacillus thuringiensis subsp. israelensis by site-directed mutagenesis. J. Bacteriol. 187: Klabunde, T.,Strater, N., Frolichm R., Witzel, H. & Krebs, B. (1996). Mechanism of Fe(III)-Zn(II) purple acid phosphatase based on crystal structures. J. Mol. Biol. 259, Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4. 49:

22 Lereclus D, Arantès O, Chaufaux J, Lecadet M Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol Lett. 51: Manceva, S. D., Pusztai,-Carey, M., Butko, P A detergent-like mechanism of action of the cytolytic toxin Cyt1A from Bacillus thuringiensis var. israelensis. Biochemistry 44: Messner, P Bacterial glycoproteins. Glycoconjugate J. 14: Mikkola, A.R., Carlberg, G.A., Vaara, T., and Gyllenberg, H.G Comparison of inclusions in different Bacillus thuringiensis strains. An electron microscope stude. FEMS Microbiol Lett. 13, Moar, W.J., Trumble, J.T., Federici, B.A Comparative toxicity of spores and crystals from the NRD-12 and HD-1 strains of Bacillus thuringiensis subsp. kurstaki to neonate beet armyworm (Lepidoptera: Noctuidae). J. Econ. Entomol. 82: Padua, L., Federici, B.A Development of mutants of the mosquitocidal bacterium Bacillus thuringiensis subsp. morrisoni PG-14 toxic to lepidopterous and dipterous insects. FEMS Microbiol. Lett. 54: Park HW, Ge B, Bauer LS, Federici BA Optimization of Cry3A yields in Bacillus thuringiensis by use of sporulation-dependent promoters in combination with the STAB- SD mrna sequence. Appl. Environ. Microbiol. 64: Perez, C, Fernandez LE, Sun J, Folch JL, Gill SS, Soberón M, Bravo A Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor. Proc Natl Acad Sci USA 102:

23 Pfannenstiel, M. A., Cray, W. C., Jr.; Couche, G. A.; and Nickerson, K. W Toxicity of protease-resistant domains from the delta-endotoxin of Bacillus thuringiensis subsp. israelensis in Culex quinquefasciatus and Aedes aegypti bioassays. Appl. Environ. Microbiol. 56, Pfannenstiel, M. A., G. Muthukumar, G. A. Couche, and K. W. Nickerson Amino sugars in the glycoprotein toxin from Bacillus thuringiensis subsp. israelensis. J. Bacteriol. 169: Rutenber E, Ready M, Robertus JD Structure and evolution of ricin B chain. Nature 326: Sarkar, A., Yardley, K., Atkinson, P. W., James, A. A., O Brochta, D. A. (1997) Transposition of the Hermes element in embryos of the vector mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 27, Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62: Shisa, N., Maeda, M. and Obha, M Unusual envelopes associated with parasporal inclusions of a mosquitocidal Bacillus thuringiensis serovar fukuokaensis isolate. J. Basic Microbiol. 46, Stein, C., Jones, G.W., Chlamers, T,. and Berry, C Transcriptional analysis of the toxin-coding plasmid pbtoxis from Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 72: Strater, N., Klabunde, T., Tucker, P., Witzel, H. & Krebs, B. (1995). Crystal structure of a purple acid phosphatase containing a dinuclear Fe(III)-Zn(II) active site. Science 268,

24 Tang M, Bideshi DK, Park HW, Federici BA Minireplicon from pbtoxis of Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 72: Tang M, Bideshi DK, Park HW, Federici BA Iteron-binding ORF157 and FtsZlike ORF156 proteins encoded by pbtoxis play a role in its replication in Bacillus thuringiensis subsp. israelensis. J. Bacteriol. 189: Wasano, N., Yasynaga,-Aoki, C., Sato, R., Obha, M., Kawarabata, T., and Iwanhana, H. (2000). Spherical parasporal inclusions of the lepidoptera-specific and coleopteranspecific Bacillus thuringiensis strains: A comparative electron microscope study. Curr. Microbiol. 40, Wirth, M.C., Georhiou, G.P., and Federici, B.A CytA enables CryIV endotoxins of Bacillus thuringiensis to overcome high levels of CryIV resistances in the mosquito, Culex quinquefasciatus. Proc.Nat;. Acad. Sci. USA. 94: Wirth MC, Walton WE, Federici BA Inheritance patterns, dominance, stability, and allelism of insecticide resistance and cross-resistance in two colonies of Culex quinquefasciatus (Diptera: Culicidae) selected with cry toxins from Bacillus thuringiensis subsp, israelensis. J. Med. Entomol. 47: Wu, D., and Federici, B.A. (1993). A 20-kilodalton protein preserves cell viability and promotes CytA crystal formation in Bacillus thuringiensis. J. Bacteriol. 175: Wu, D. and Federici, B.A. (1995). Improved production of the insecticidal CryIVD protein in Bacillus thuringiensis using cry1a(c) promoters to express the gene for an associated 20-kDa protein. Appl. Microbiol. Biotech. 52: Veening, J. W., Hamoen, L. W, Kuipers, O.P Phosphatases modulate the bistable sporulation gene expression patter in Bacillus subtilis. Mol. Microbiol. 56:

25 Veening, W. J., Murray, H., Errington, J A mechanism for cell cycle regulation of sporulation in Bacillus subtilis. 23:

26 FIGURE LEGENDS Figure 1. Transmission electron micrograph showing intact purified parasporal bodies containing electron dense crystalline inclusions from Bacillus thuringiensis serovar. morrisoni (PG-14) (A), and parasporal bodies treated with 50 mm sodium hydroxide (ph 12.8) for 240 min to solubilize and remove crystalline protein protoxins (B). (C) SDS-PAGE showing protein profiles of intact parasporal body with major crystalline protoxin bands at ~135 kda (Cry4A, Cry4B), ~65 kda (Cry11A) and ~28 kda (Cyt1) (lane 1), and parasporal bodies treated with 50 mm sodium hydroxide (ph 12.8) for 1 min (lane 2)or 240 min (lane 3). MW, molecular mass standards; kda, kilodaltons; bar, 0.5 μm. Figure 2. Conserved domains and secondary structure predictions of multilamellar fibrous matrix-associated proteins coded by pbtoxis of Bacillus thuringiensis subsp. israelensis. (A) Bt113 contains a conserved domain (pfam 10782) of unknown function found in a few bacterial proteins, for example, Bacillus licheniformis ATCC gi (B. lic); Staphylococcus epidermidis RP62A, gi (S. epi); Staphylococcus haemolyticus JCSC1435, gi (S. hae); Staphylococcus saprophyticus subsp. saprophyticus ATCC15305, gi (S. sap); highly conserved residues, respectively, cysteine (C) and glycine (G), and leucine (L)/isoleucine(I) or phenyalanine (F) and tyrosine (Y) are also shown (asterick). Bt152 has a novel bipartite architecture compose of well conserved amino-terminal metallophosphatase (cd00838, residues ) and C-terminal ricin-type (pfam 00652, residues ) domains (respectively, B and C). The putative active site residues (#) involved in catalysis are shown

27 Figure 3. Predicted secondary structures in Bt152. Helices, beta strands and coils were identified using the PSIPRED program that ranks the confidence of a specific residue at a given position from 0 (-, unshaded) to 9 (+, deep blue). Note the beta strand-rich carboxy-terminal domain characteristic of the lectin-like beta-trefoil fold Figure 4. Transmission electron micrographs showing Bt152 is required for terminal morphogenesis of the parasporal body in Bacillus thuringiensis subsp. israelensis strain 4Q5. (ac), aggregation of crystalline inclusions to form intact parasporal body in 4Q5 containing functional the Bt152 gene; (d-f) mutant strain 4Q5-Erm-dORF152 lacking Bt152 function showing crystalline inclusions do not aggregate to from intact parasporal bodies; (g-i) replacement of functional Bt152 in 4Q5-Erm-dORF152 rescues aggregation of crystalline inclusions to form intact parasporal body. Lamellar (envelope) matrices are shown (arrowheads); Bar, 200 nm Figure 5. Fluorescence microscopy showing that recombinant Bt152-GFP specifically localizes to the parasporal body of Bacillus thuringiensis subsp. israelensis 4Q5 (A-C) and B. thuringiensis subsp. morrisoni isolate PG-14 (D-F). Spores (s) and parasporal bodies (p) are indicated. Fluorescence was not detected in other cellular structures, including the aqueous cytosol, spore, or cell wall Figure 6. Example of ligand blot showing that Bt152 binds purified multilamellar fibrous matrix (MFM) of the parasporal body of Bacillus thuringiensis subsp. israelensis 4Q5. (A) SDS-PAGE of purified Bt152-his stained with Coomassie blue (a) and the fluorescent InVision His-tag In-gel 27

28 stain (b), and Bt152-his detected by Western blot using an anti-c-terminal his-tag antibody (c). (B) From 1-4 μg of MFM, solubilized composite 4Q5 parasporal bodies (4Q5 PB), isopycnicpurified crystalline protoxins (Cry11Aa, Cyt1Aa, Cry4Aa, Cry4Ba) lacking MFM, bovine serum albumin (BSA), and histidine-tagged Bt152 control (Bt152-his) were dot-blotted onto nitrocellulose membranes and incubated with (+) or without (-) Bt152-his. Binding was detected with an anti-histidine tag antibody (Anti-his Ab). Note strong binding occurred with purified MFM and 4Q5 PB in comparison to trace binding detected with Cry11Aa, Cyt1Aa and Cry4Ba in replicate assays

29 Table 1. Peptides in purified parasporal body-associated proteins identified by mass spectrometry ORF (pbtoxis) Bt038 Bt054 Bt055 Bt110 Bt073 Bt075 Bt113 Bt148 Bt152 Examples of matched peptide sequences KMLLLDEVKN KGHYLHMSGARD KEKMLLLDEVKN RYPADKIDNTKL KTVDVFPDTDRVRI RGLGIATHVYPRA KAIPIGFEISAYIARE RSFLNLKR RSFLNLKRG RGDCIYVYSGGTLEAQGRY KRGDCIYVYSGGTLEAQGRY KMLLLDEVKN KGHYLHMSGARD KQLLQSTNYKD KEIASTYISNANKI KEKMLLLDEVKN KETLDQAKSFIKY KIILFAPEQVLLEWNRH KTVRTEGSEIVVHKT MALNAQAQFLSILELTKG KTWPVGLALGSQAALASVKN KTWPVGLALGSQAALASVKNVAI KRLQHLEVFPFHHVEGDSLRY MGKMESIVLRK RILDLQDQHCMGCKHYNGVRT KLTLSPEGLKQ KQLLAELEQYKV RTQLETARI RHPLNTSLRN RGIPSTQFDYRT KHQMLYDQYKN RTYLIIEQFSNRL Assigned known or putative function Cry4Ba, mosquito larvicidal protein Crystalline component of parasporal body in Bacillus thuringiensis subsp. israelensis Cyt1A, mosquito larvicidal protein Crystalline component of parasporal body in Bacillus thuringiensis subsp. israelensis Cry11A, mosquito larvicidal protein Crystalline component of parasporal body in Bacillus thuringiensis subsp. israelensis Cry4Aa, mosquito larvicidal protein Crystalline component of parasporal body in Bacillus thuringiensis subsp. israelensis 25% identical and 47% similar to hypothetical protein of Ralstonia pickettii 12J (YP_ ); function unknown 24% identical and 40% similar to major structural phage protein in Pseudomonas phage YuA (YP_ ) and Xanthomonas phage Xp15 (YP_239278) Contains conserved domain in DUF2602 superfamily (pfam10782), residues The function of this bacterial family of proteins is not known at present Putative transcriptional regulator Similar to Bacillus subtilis transition state regulatory protein AbrB or CpsX SW:ABRB_MACSU (P08874) and putative transition state regulator, Abh (P39758) Hemagglutinin-related protein; Similar to Clostridium botulinum hemagglutinin Ha- 33 protein TR:Q45868 (X79103) and TR:45871 (X79104); contains a metallophosphatase domain (cd00838), residues , and a ricin-type betatrefoil lectin domain (pfam 00652), residues Molecular mass (kda)

30

31

32

33

34

35