Mutations in CHLOROPLAST RNA BINDING provide evidence for the involvement of the chloroplast in the regulation of the circadian clock in Arabidopsis

Transcription

1 The Plant Journal (2007) 51, doi: /j X x Mutations in CHLOROPLAST RNA BINDING provide evidence for the involvement of the chloroplast in the regulation of the circadian clock in Arabidopsis Miriam Hassidim, Esther Yakir, David Fradkin, Dror Hilman, Ido Kron, Nir Keren, Yael Harir, Shai Yerushalmi and Rachel M. Green * Department of Plant and Environmental Sciences, Institute for Life Sciences, Hebrew University, Givat Ram, Jerusalem 91904, Israel Received 19 November 2006; revised 29 March 2007; accepted 5 April * For correspondence (fax , rgreen@vms.huji.ac.il). Summary The Arabidopsis circadian system regulates the expression of up to 36% of the nuclear genome, including many genes that encode photosynthetic proteins. The expression of nuclear-encoded photosynthesis genes is also regulated by signals from the chloroplasts, a process known as retrograde signaling. We have identified CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein, and have shown that it is important for the proper functioning of the chloroplast. crb plants are smaller and paler than wild-type plants, and have altered chloroplast morphology and photosynthetic performance. Surprisingly, mutations in CRB also affect the circadian system, altering the expression of both oscillator and output genes. In order to determine whether the changes in circadian gene expression are specific to mutations in the CRB gene, or are more generally caused by the malfunctioning of the chloroplast, we also examined the circadian system in mutations affecting STN7, GUN1, and GUN5, unrelated nuclear-encoded chloroplast proteins known to be involved in retrograde signaling. Our results provide evidence that the functional state of the chloroplast may be an important factor that affects the circadian system. Keywords: circadian, chloroplast, Arabidopsis, signaling, RNA binding, retrograde signaling. Introduction Plants, in common with a range of other organisms, have accurate, robust endogenous rhythms that enable them to time molecular and physiologic processes to fit their environmental conditions. The most widely studied of such rhythms are those with approximately 24-h periods that are controlled by the circadian system. In plants, the circadian clock system regulates a diverse range of processes, from gene expression and protein phosphorylation to cellular calcium oscillations, leaf movements, and photoperiodic flowering (Barak et al., 2000). It is likely that one of the most important functions of the circadian clock is to control temporal synchronization of a range of interconnected pathways, both with each other and with the daily changes of environmental light conditions and temperature. Consistent with this idea, it has been demonstrated that plants that lack a functional circadian system show lower rates of growth, photosynthesis, and survival (Dodd et al., 2005; Green et al., 2002). Over the past decade, considerable progress has been made in understanding the molecular basis of the Arabidopsis circadian system. At the core of the circadian system is the oscillator that is responsible for generating the daily rhythms. This oscillator appears to be made up of one or more positive/negative feedback loops. The first such positive/negative feedback loop to be described consists of the positive element TIMING OF CAB1, TOC1 (Makino et al., 2002; Strayer et al., 2000), which is responsible for activating the expression of two single Myb proteins CIRCADIAN CLOCK ASSOCIATED 1, CCA1, (Wang and Tobin, 1998), and LATE ELONGATED HYPOCOTYL, LHY (Schaffer et al., 1998). These Myb proteins act as negative elements in the loop repressing the activity of the positive element (Alabadi 551 Journal compilation ª 2007 Blackwell Publishing Ltd

2 552 Miriam Hassidim et al. et al., 2001). The resulting cycle of activation and repression, probably with several as yet unknown modification steps, takes around 24 h. Subsequently, additional feedback loops have been identified suggesting that the oscillator may be composed of several interlocking feedback loops. Such an arrangement is likely to be important for conferring stability to the oscillator, and is part of the mechanism ensuring that the circadian system is able to function accurately under a range of environmental conditions (Edwards et al., 2005; Gould et al., 2006; Locke et al., 2005). In order to be biologically relevant, the oscillator must be able to both respond to changes in the plant s environment and to be connected to pathways that regulate circadian processes within the plant. Changes in light and temperature conditions can entrain the oscillator so that it will function with the correct phase relative to the environment, so as to ensure that clock-regulated processes occur at the appropriate time of day. The input pathways by which signals from the light receptors, phytochrome, and cryptochrome, are transduced to the oscillator are beginning to be understood (Salome and McClung, 2004). However, although it has recently been shown that two homologs of TOC1 may confer temperature sensitivity to the oscillator (Salome and McClung, 2005), less is known about how changes in environmental temperature can entrain the oscillator. Finally, output pathways from the oscillator regulate the various plant processes that are under circadian control, including, as several studies have demonstrated, the expression of up to 36% of the nuclear genome (Edwards et al., 2006; Harmer et al., 2000; Michael and McClung, 2003; Schaffer et al., 2001). An important subset of the circadian-regulated nuclear genes encodes chloroplast proteins (Harmer et al., 2000). Chloroplasts have evolved from a prokaryotic cyanobacterium-like ancestor that was taken up by a eukaryotic host cell (Dyall et al., 2004). During the course of evolution, the majority of the chloroplast genes, including those encoding the light-harvesting antenna complex (LHC), were transferred from the chloroplast genome to the nucleus (Martin et al., 2002). The chloroplast retained around genes, the plastome, and the mechanism to express the plastome genes. However, most of the approximately 3000 proteins required for chloroplast function (Richly and Leister, 2004) are encoded by the nucleus. The circadian system may have an important role in regulating the expression of nuclearencoded chloroplast genes to ensure that they are produced at the time of day when they are most needed (Harmer et al., 2000). For example, LHC transcript levels rise before dawn and peak in the morning (Harmer et al., 2000). Clearly, the dual location of the chloroplast genes necessitates coordination between the nucleus and chloroplast in regulating nuclear gene expression. A number of reports have shown that there are several mechanisms by which the chloroplast may influence nuclear gene expression, a process known as retrograde signaling (Leister, 2005). It has been demonstrated that signals generated by changes in photosynthetic electron transport may affect nuclear gene expression. For example, in some systems, changes in the redox state of the chloroplast plastoquinone pool can regulate the activity of nuclear genes (Pfannschmidt et al., 2001). The chlorophyll biosynthesis pathway has also been associated with the control of nuclear gene expression. Experiments carried out with several of the genome uncoupled (gun) mutants suggest that the tetrapyrrole intermediate in the chlorophyll biosynthesis pathway, Mg-protoporphyrin IX, may be a signaling molecule between the chloroplasts and the nucleus (Strand et al., 2003). Furthermore, in young seedlings, plastid proteins may also be involved in the signaling pathway from the chloroplasts (Gray et al., 2003). Finally, sugar status (Rolland et al., 2002) and reactive oxygen species (ROS) caused by high levels of light stress may also regulate nuclear gene expression (Karpinski et al., 1999; Vandenabeele et al., 2004). Systematic analyses of mrna expression have shown that the nuclear-encoded genes that are regulated by the chloroplast fall into several groups. The largest group appears to be regulated coordinately by a master switch, whereas a smaller group, which mostly encode proteins of the photosystems and proteins necessary for plastome gene expression, are coordinated by an alternative mechanism (Biehl et al., 2005; Richly et al., 2003). These results indicate that there are different levels of transcriptional control for nuclear-encoded chloroplast genes. However, little is known about how nuclear gene transcription is regulated by chloroplast signals. In a functional screen to identify putative RNA-binding proteins involved in regulating the circadian system, we have isolated a gene we have called CHLOROPLAST RNA BINDING (CRB). Mutations in CRB have profound effects on the chloroplast morphology and photosynthetic performance, as well as on the functioning of the circadian system in Arabidopsis. In order to determine whether the effect of the CRB mutations on the circadian system is specific or, alternatively, is representative of a more general phenomenon in which signals from the chloroplasts can affect the circadian oscillator, we also examined the effect of mutations in genes encoding STN7, GUN5, and GUN1, unrelated chloroplast proteins involved in retrograde signaling (Bellafiore et al., 2005; Bonardi et al., 2005; Strand et al., 2003; Susek et al., 1993). Our results show that the circadian system in plants is regulated not only by extracellular signals from the environment but also may be controlled by intracellular signals from the chloroplasts. We suggest that because the circadian system regulates the expression of many chloroplast genes, entrainment of the circadian oscillator by chloroplast signals may be an important factor in chloroplast regulation of nuclear gene expression.

3 Circadian regulation and the chloroplast 553 Table 1 List of putative RNA-interacting proteins identified as being under circadian control in the microarray database Gene name At4g18470 At4g31180 At5g11200 At3g47160 At4g13850 At1g09340 Gene identity RNA helicase-like protein Aspartate trna ligase-like protein DEAD BOX RNA helicase RH15 RNA-binding protein-like protein Glycine-rich RNA binding protein Putative RNA-binding protein Results Identification of CRB In order to identify RNA-binding proteins that have a role in regulating the circadian system, we carried out a functional screen. The rationale behind the screen is based on the observation that most of the genes that are important for regulating the circadian system, in both plants and other organisms, are themselves under circadian control. We therefore used publicly available microarray data to find circadian-regulated genes that encode RNA-binding proteins ( expression_set&id= ). We identified six genes in the microarray database that encode putative RNA-binding factors or other proteins that interact with RNA (Table 1). T-DNA insertion mutants (Alonso et al., 2003) were obtained for these putative RNA-binding proteins and examined (as described in the Experiments below) to see which of them showed altered physiologic and circadian phenotypes. One of the genes identified encodes a putative RNAbinding protein with homology to the spinach chloroplast endoribonuclease, CSP41 (Bollenbach et al., 2003). Based on its sequence homology to a nuclear-encoded chloroplast RNA binding protein, we called the gene CHLOROPLAST RNA BINDING (CRB). Figure 1 confirms that CRB is under circadian control with a peak in expression in the evening. In order to determine the function of CRB, we examined two T-DNA insertion lines, crb-1 and crb-2. The T-DNA insertion in crb-1 is in the seventh exon (Figure 2a) and results in a truncated CRB transcript (Figure 2b). In crb-2 the T-DNA insertion is at the beginning of the first exon (Figure 2a) of CRB, and there is no detectable CRB mrna (Figure 2b). CRB mutants have a distinctive phenotype Both crb-1 and crb-2 plants have a characteristic phenotype. Figure 3a shows that both mutants, but especially crb-1, are smaller and paler than wild-type plants. Total fresh weight Figure 1. Circadian oscillations of CRB transcript accumulation. Wild-type plants were transferred to constant light after entrainment over long days. The levels of CRB mrna were determined by Northern analysis (shown above the graph) and plotted on a graph relative to the maximum levels of expression. Aliquots of 1.5 lg of each RNA sample were also run on an agarose gel to check for quality and verify quantitation (shown below the graph). The yellow and grey-hatched bars represent subjective light and dark periods in constant light, respectively. accumulation in both the crb mutants is correspondingly lower than in wild type (Figure 3b). We examined the chlorophyll levels in the crb plants compared with wild-type plants and found that there is a reduction in both chlorophyll a and chlorophyll b (Figure 3c). However, the reduction in chlorophyll a levels is more severe resulting in an average chlorophyll a/b ratio of 2.86 in wild type (SD 0.08), 2.01 (SD 0.07) in crb-1, and 2.2 (SD 0.11) in crb-2 plants. crb-1 mutants also show higher levels of protochlorophyllide, the precursor of chlorophyll (Figure 3d). Photosynthesis is also impaired in the crb mutants and the fluorescence parameters are profoundly altered. The maximum quantum yield of photosystem II (F v /F m, Variable Fluorescence/Maximum Fluorescence) is significantly reduced in crb plants compared with wild type (Figure 3e). This is a result of a high proportion of the light energy absorbed by chlorophyll molecules in crb plants being re-emitted as fluorescence. Thus, it is likely that during photosynthesis less light is funneled toward photochemical processes in crb plants compared with wild type. Moreover, the light that reaches the photosystem-ii (PSII) reaction centers is not utilized optimally as the proportion of open PSII centers (qp) is lower in crb plants than in wild type (Figure 3f). Furthermore, the blue shift in the position of the PSII and PSI fluorescence bands indicates a larger proportion of antenna to reaction centers in mutant plants (Figure 3g).

4 554 Miriam Hassidim et al. Figure 2. Structure of the CRB gene and accumulation of CRB transcripts in wild-type and mutant plants. (a) The CRB gene with introns (black lines), exons (black boxes), and 3 - and 5 -untranslated regions (grey lines). The positions of the two T-DNA insertions (crb-2, SALK_107566, and crb-1, SALK_021748) are shown above the gene. The positions of the two RNA probes (CRB probe 1 and CRB probe 2) specific to CRB are shown as black lines under the gene. (b) The two CRB-specific probes were used in Northern analyses to measure CRB mrna accumulation in wild-type, crb-1, and crb-2 plants. Aliquots of 1.5 lg of each RNA sample were also run on an agarose gel to check for quality and verify quantitation. The black arrow indicates the position of the full-length CRB transcript; the white arrow shows the truncated transcript in crb-1. Our results suggest that CRB may be important for chloroplast structure and function. crb mutants show a distinctive pale phenotype, a blue shift in the position of PSI and PSII fluorescence bands, deficiency in chlorophyll and impaired photosynthesis. There is also evidence, from two independent proteomic studies on the Arabidopsis chloroplast, that CRB may be targeted to the chloroplast (Kleffmann et al., 2004; Ytterberg et al., 2006). Consistent with these findings, electron microscopy studies show that the chloroplasts of the crb-1 mutant tend to be aberrantly shaped (Figure 4b,d) compared with wild-type plants (Figure 4a,c). Moreover, thylakoid organization is usually altered in the crb-1 mutant. Whilst a few crb-1 plastids are almost normal (Figure 4d, open arrow) compared with wild type (Figure 4c), most crb-1 plastids contain a much higher number of membranes in each granal stack and fewer interconnecting stromal lamellae (Figure 4f) than in wild type (Figure 4e). In addition, in many cases the crb-1 photosynthetic membranes are not aligned parallel to the plastid axis, and there are large areas of the chloroplasts in the mutants that appear to be devoid of thylakoids (Figure 4d, closed arrow). Mutations in CRB affect circadian rhythms We investigated whether CRB has a role in regulating circadian rhythms by examining the expression pattern of key components of the Arabidopsis circadian oscillator, CCA1 and LHY, in crb plants. Northern and quantitative real-time PCR analyses show that in crb-1 plants that have been transferred to continuous light after growing under longday conditions (14-h light:10-h dark), CCA1 and LHY transcript accumulation is rhythmic and appears to oscillate with the same period as in the wild-type control (Figure 5a c). However, the pattern of CCA1 and LHY mrna accumulation was altered in crb-1 plants, with a greater amplitude and with a delay in the timing of increases and decreases in transcript accumulation. CCA1 and LHY transcript accumulation is affected in a similar way in crb-2 plants (Figure S1a,b). In order to determine whether circadian output pathways are also affected by the changes in the oscillator, we examined the expression of two output genes, LHCB (also known as CAB) and ATGRP7 (also known as CCR2; Heintzen et al., 1997). Figure 5d shows that in constant light LHCB transcript levels are elevated in crb-1 plants. Furthermore, the timing of the increases and decreases in LHCB mrna levels are delayed compared with wild-type plants. Similar results were obtained for the crb-2 plants (Figure S1c). In crb-1 plants ATGRP7 transcript levels also show an altered phase of accumulation but are lower than in wild type (Figure 5e). Examining gene expression under conditions of constant light and temperature shows the effect of the mutations on the circadian clock, but plants usually grow in conditions of daily changes of light and dark. Under dark:light conditions, both the circadian system and light signals play a role in regulating gene expression. We therefore examined the expression of CCA1 in wild-type and crb-1 plants growing over long days (14-h light:10-h dark). Figure 6a shows that over long days there is a large increase in the amplitude of CCA1 mrna accumulation in crb-1 plants compared with wildtype plants. However, there appeared to be little difference in the timing of the increases and decreases in expression

5 Circadian regulation and the chloroplast 555 Figure 3. The phenotype of the crb mutants. (a) Three-week-old wild-type and crb plants grown over long days on 1% sucrose. (b) The average fresh weight of wild-type and crb plants grown over long days for 5 weeks on 1% sucrose is shown together with the standard error. (c) The amount of chlorophyll mg )1 fresh weight in WT and crb plants grown over long days for 5 weeks on 1% sucrose is shown together with the standard error. (d) Fluorescence emission spectra at 77 K of acetone extracts from wild-type (dashed line) and mutant (black line) plants. Spectra were normalized to the intensity at 670 nm. The arrow indicates the position of the protochlorophyllide. (e) F v /F m, Variable Fluorescence/Maximum Fluorescence (the efficiency of photosystem II, PS II). (f) qp (photochemical quenching) were measured in wild-type and crb plants grown over long days for 3 weeks on 1% sucrose. The experiment was repeated twice. The results are shown together with the standard error. (g) Chlorophyll fluorescence emission spectra at 77 K of crude membrane extracts from wild-type (dashed line) and mutant (black line) plants. Spectra were normalized to the intensity at 730 nm. The fluorescence bands for PSII and PSI complexes in the wild-type spectrum peak at 683 and 730 nm, respectively. In the mutant spectrum the PSII peak is blue shifted by 3.5 nm, and the PSI peak is blue-shifted by 4.5 nm. All the experiments were repeated at least three times. of CCA1 in crb-1 plants. The timing of flowering is one of the most important physiologic processes under the control of the clock. Figure 6b shows that in long-day conditions, crb-1 plants flower earlier than their wild-type counterparts. Hypocotyl growth is not affected in the CRB mutant plants The part of phytochrome, the red-light receptor, that recognizes light is a tetrapyrrolic chromophore called phytochromobilin (PB), which is synthesized in the chloroplasts. Given the abnormal phenotype of the chloroplasts in the crb plants, it is possible that there is substantially less PB being synthesized in these mutants. As phytochrome is one of the main photoreceptors for the circadian system, it is thus possible that the effects of the mutations in CRB on the circadian system are a result of changes in the levels of spectroscopically active phytochrome. Inhibition of hypocotyl growth is frequently used to demonstrate defects in light receptors, including phytochrome. We therefore examined whether hypocotyl growth is affected in the crb plants. Figure 6c shows that, as expected, there is a substantial increase in hypocotyl length of the phytochrome B mutants (phyb) in white and red light, but not in the dark. However, crb-1 hypocotyl length is not significantly different from wild type under any of the light conditions used, suggesting that phytochrome levels are normal in crb plants.

6 556 Miriam Hassidim et al. Figure 4. Chloroplasts in wild-type and crb-1 plants. Wild-type and crb-1 plants were grown over long days on 1% sucrose for 3 weeks. Chloroplasts were visualized by electron microscopy. Scale bars: a and b, nm; c and d, 1000 nm; e and f, 200 nm. Mutations in other nuclear genes encoding chloroplast proteins also affect circadian oscillations of CCA1 In order to determine whether the effect of crb-1 and crb-2 on the circadian system was specific to CRB, or might be a more general result of damage to the chloroplast, we examined the effect of mutations in several nuclear genes known to encode chloroplast proteins that are involved in retrograde signaling. One of the mutants we examined was in STN7, a Ser:Thr kinase that has been shown to phosphorylate the major light harvesting complex, LHCII (Bellafiore et al., 2005). The phosphorylation of LHCII controls its partitioning between PSI and PSII and is regulated by the redox state of the plastoquinone pool. STN7 has also been shown to be involved in retrograde signaling in Arabidopsis (Bonardi et al., 2005). The expression of STN7 itself is under circadian control with a peak of transcript accumulation around dawn (Figure 7a). Figure 7b shows that mutating STN7 affects the circadian pattern of CCA1 expression in continuous light, with a greater amplitude of CCA1 expression in stn7 than in wild type and a delay in returning to trough levels. However, the effect of the mutation in STN7 on the expression of CCA1 is not as pronounced as in the crb-1 mutant (Figure 5a,b). Figure 5. Circadian gene expression in wild-type and crb-1 plants. Wild-type and crb-1 plants were transferred to constant light after entrainment over long days. (a) The levels of CCA1 mrna were determined by Northern analysis (shown above the graph) and plotted on a graph relative to the maximum levels of expression. Aliquots of 1.5 lg of each RNA sample were also run on an agarose gel to check for quality and verify quantitation (shown below the graph). The accumulation of (b) CCA1, (c) LHY, (d) LHCB, and (e) ATGRP7 mrna was determined by quantitative real-time PCR compared with a tubulin (TUB) control. The yellow and grey-hatched bars represent subjective light and dark periods respectively.

7 Circadian regulation and the chloroplast 557 Figure 7c shows that flowering is also earlier in stn7 compared with wild type. Another nuclear-encoded chloroplast protein, GUN5, was originally isolated in a screen to find regulators of plastid signaling to the nucleus. GUN5 encodes the H-subunit of Mg-chelatase (Mochizuki et al., 2001). Mg-chelatase catalyses the first reaction in the chlorophyll branch of tetrapyrrole biosynthesis by inserting Mg 2+ into the protoporphyrin ring to generate Mg-protoporphyrinIX. Mutations in GUN5 have been used to demonstrate that Mg-protoporphyrin is involved in retrograde signaling from the plastid (Mochizuki et al., 2001). Figure 7d shows that, under the conditions we used, there appears to be no significant difference in CCA1 oscillations in the GUN5 mutant, suggesting that the circadian system may not be affected in GUN5 as it is in CRB and STN7 mutants. We also examined the effect on CCA1 rhythmicity of a mutation in the GUN1 gene. Although the molecular identity of GUN1 has not yet been reported, it has been suggested that GUN1 has a role in both the Mg-protoporphyrin pathway and a plastid protein synthesis signaling pathway (Gray et al., 2003; Richly et al., 2003). In gun1 plants the amplitude of CCA1 transcript accumulation is significantly increased (Figure 7e). Thus, at least one of the retrograde signaling pathways mediated by GUN1 appears to be involved in regulating the circadian system. Discussion CHLOROPLAST RNA BINDING Figure 6. Regulation of diurnal CCA1 gene expression, flowering time, and inhibition of hypocotyl growth in wild-type and crb-1 plants. (a) Wild-type and crb-1 plants were grown in long-day conditions. The levels of CCA1 mrna were determined by Northern analysis (shown above the graph) and plotted on a graph relative to the maximum levels of expression. Aliquots of 1.5 lg from each RNA sample were also run on an agarose gel to check for quality and verify quantitation (shown below the graph). The black bars and yellow bars represent dark and light photoperiods. (b) Flowering time in wild-type and crb-1 plants. Seeds of wild-type and crb-1 plants were sown onto soil. Plants were grown in long (14-h light:10-h dark) photoperiods. The numbers of rosette leaves at bolting were counted. The average flowering time for each line is shown together with the standard error. **Significant difference in comparison with wild type (unpaired Student s t-test, P < 0.01). Sample sizes are given within bars. (c) Hypocotyl growth in wild-type, crb-1, and phyb. Seedlings were grown in the dark or in red or white light. After 8 days, hypocotyl length was measured for each seedling and the average was plotted on a graph along with the standard error. In a screen for genes encoding RNA-binding proteins that have a role in regulating the circadian system, we identified a gene we called CRB. CRB has an approximately 84% amino acid similarity to the Chlamydomonas reinhardtii protein, RAP38 (Yamaguchi et al., 2003). In Chlamydomonas, RAP38 has been found to co-purify with the 70S chloroplast ribosome (Yamaguchi et al., 2003), and is probably part of a complex that includes the homologous protein, RAP41. In spinach the RAP41 ortholog, CSP41a, is an RNA-binding protein that functions as an endoribonuclease mediating the degradation of several chloroplast-encoded transcripts (Bollenbach et al., 2003; Yang and Stern, 1997; Yang et al., 1996). Although a function has not yet been demonstrated for either CRB or its spinach ortholog, CSP41b, two independent proteomic studies have suggested that CRB protein is located in the chloroplast (Kleffmann et al., 2004; Ytterberg et al., 2006). Thus, it is possible that CRB has a role in transcript regulation in the chloroplast. The role of CRB in the chloroplast CRB T-DNA insertion mutants show marked defects in several aspects of chloroplast structure and function. In crb plants, chlorophyll accumulation is impaired and chloroplast structure is altered (Figures 3c and 4). The maximum quantum yield of PSII (F v /F m ) is significantly reduced in both crb-1 and crb-2 plants (Figure 3e). The lower F v /F m ratios, the shift in the peak position of photosystems in 77-K emission spectra, and the extensive stacking of thylakoid membranes all suggest a higher light-harvesting antenna to reaction

8 558 Miriam Hassidim et al. Figure 7. Circadian rhythms and flowering time in wild-type, stn7, gun5, and gun1 plants. (a) Wild-type plants were transferred to constant light after entrainment over long days. The levels of STN7 RNA were determined by quantitative real-time PCR and were plotted on a graph relative to the maximum levels of expression. (b) Wild-type and stn7 plants were transferred to constant light after entrainment over long days. The levels of CCA1 mrna were determined by Northern analysis (shown above the graph) and plotted on a graph relative to the maximum levels of expression. Aliquots of 1.5 lg of each RNA sample were also run on an agarose gel to check for quality and to verify quantitation (shown below the graph). (c) Flowering time in wild-type and stn7 plants was measured as described in Figure 6b. The average flowering time for each line is shown together with the standard error. **Significant difference in comparison with wild type (unpaired Student s t-test, P < 0.01). Sample sizes are given within bars. (d and e) Wild-type, gun5, and gun1 plants were transferred to constant light after entrainment over long days. The levels of CCA1 mrna were determined by quantitative real-time PCR and compared with a tubulin (TUB) control. The yellow and grey-hatched bars represent subjective light and dark periods respectively. center ratio in the crb plants. Consistent with the observed effects of mutations in CRB on the chloroplasts and photosynthesis, crb plants are significantly smaller and paler than wild-type plants (Figure 3a,b). The effect of CRB mutations on the circadian system We have shown here that, in addition to regulating chloroplast function, mutations in CRB affect the circadian system. Under constant light conditions, the amplitude of expression of CCA1 and LHY is increased in the crb-1 and crb-2 plants (Figures 5a c and S1a,b). Furthermore, the timing of the increases and decreases in CCA1 and LHY mrna accumulation is altered. However, period length appears to be unchanged in the mutant plants. Not surprisingly, given the changes in oscillator gene expression, the regulation of the two output genes examined, LHCB and ATGRP7, is also affected in crb plants. Interestingly, levels of LHCB are higher in the crb-1 plants compared with wild-type plants, whereas levels of ATGRP7 are partially repressed. These observations are consistent with previous findings that high levels of CCA1 cause a damping of ATGRP7 expression and an increase in LHCB expression (Wang and Tobin, 1998).

9 Circadian regulation and the chloroplast 559 One of the most important physiological processes under the control of the circadian oscillator, the regulation of flowering time via the photoperiodic pathway (Salome and McClung, 2004), is also slightly but significantly altered in CRB mutant plants (Figure 6b). However, we did not find significant differences in the circadian rhythms of expression of the main photoperiodic flowering induction gene CONSTANS (CO; Suarez-Lopez et al., 2001) that could explain the earlier flower time phenotype observed (Figure S2). Our failure to detect significant changes in CO may result from the fact that crb plants only show a small difference in flowering time (approximately 2.5 leaves earlier than wild type over long days). Alternatively, flowering in the crb plants might be affected by one of the nonphotoperiodic pathways that regulate reproductive development (Putterill et al., 2004). Interactions between the chloroplast and the circadian system The mechanisms by which the state of the chloroplast in the CRB mutants can affect the circadian system are unclear. One possible explanation might be that levels of the phytochrome chromophore, PB, which is synthesized in the chloroplast, may be altered. As phytochrome is a major light receptor for the circadian system in plants, a lack of phytochrome can modulate circadian rhythms (Somers et al., 1998). Furthermore, it has been shown that mutations in the nuclear-encoded chloroplast genes, GUN2/HY1 and GUN3/ HY2, which regulate PB biosynthesis, not only disrupt the coordination of nuclear and chloroplast gene expression (Susek et al., 1993), but can also affect circadian rhythms in red light (Millar et al., 1995). However, we found that our mutations in CRB do not affect hypocotyl elongation in either white or red light (Figure 6c). By contrast, HY mutations show increased hypocotyl elongation in white and red light. Thus, our results suggest that the levels of spectroscopically active phytochrome in crb plants are probably not significantly different from wild type. Therefore, it seems likely that the state of the chloroplasts in crb plants is affecting the circadian system via pathways that do not involve altered PB biosynthesis. Previous work by many other groups has shown that there are a number of other ways by which the functional state of the chloroplast may influence nuclear gene expression. These include signals generated by changes in intermediates of the chlorophyll biosynthesis (Strand et al., 2003), plastid proteins (reviewed in Nott et al., 2006), sugar status (reviewed in Rolland et al., 2002), and ROS (Vandenabeele et al., 2004), and changes in the redox state of the components of the photosynthetic transport system (Pfannschmidt et al., 2001). Our results show that the mutations in the CRB gene have pleiotropic effects on the chloroplast, including lowering qp, changing the quantum yield of PSII, and in altering the accumulation of chlorophyll and its precursor, protochlorophyllide. Thus, although the circadian oscillator is clearly affected in crb plants, determining the pathway(s) by which CRB affects the circadian oscillator will require further work. In order to start to define the pathway(s) by which the chloroplast may affect the circadian oscillator, we examined the result of mutations in several nuclear genes encoding chloroplast proteins known to be involved in retrograde signaling. As our results show, both stn7 and gun1 plants, like crb plants, have altered circadian rhythms. The retrograde signaling pathways regulated by STN7 and GUN1 include the redox, Mg-protoporphyrin pathway and plastid protein synthesis-dependent pathways, suggesting that these might be involved in chloroplast regulation of the circadian system. The finding that the circadian system is sensitive to the state of the chloroplast is consistent with the important role of the circadian oscillator in controlling the expression of chloroplast genes. Microarrays have shown that a number of nuclear-encoded chloroplast genes are under the control of the circadian oscillator (Edwards et al., 2006; Harmer et al., 2000; Schaffer et al., 2001). As optimizing the conditions for photosynthesis is of major importance for plants, it is to the plant s advantage to make sure that the oscillator is entrained so that it activates the expression of nuclearencoded chloroplast genes at the most appropriate time of day. Our results show that the state of the chloroplast affects the circadian system, and suggest that this may be a further means by which the plant ensures the correct temporal expression of genes that encode proteins that are directed to the chloroplast. Conclusion In conclusion, we have shown that mutations in genes that regulate chloroplast functions result in altered circadian rhythms. Our results are consistent with the idea that the chloroplasts and the circadian system interact to ensure the fine-tuning and close regulation of nuclear-encoded chloroplast genes. In the future it will be interesting to examine how mutations in other nuclear-encoded chloroplast genes with different functions affect the circadian oscillator, and thus to determine not only how specific the effects of mutations in CRB, GUN1, and STN7 are in regulating the circadian system, but also the mechanism(s) by which chloroplasts can affect the circadian system. Experimental procedures Plant materials and growth Arabidopsis thaliana (L.) ecotype Columbia (Col-0) was used for all experiments. We obtained T-DNA insertion lines in the Columbia

10 560 Miriam Hassidim et al. background for CRB (At1g09340; SALK_ and SALK_021748) and STN7 (At1 g68830; SALK_072531) from the SALK institute (Alonso et al., 2003). gun5 and gun1-1 seeds were provided by Prof. J. Chory, Salk Institute, San Diego, CA. All seeds were imbibed and cold-treated at 4 C for 4 days before germination. Plants were either grown in Petri dishes on Murashige and Skoog medium from Duchefa Biochemie ( supplemented with 1% sucrose (w/v) or grown on soil. Plants for constant light experiments were grown under 14-h light (125 le m )2 s )1 ):10-h dark cycles for 18 days before being transferred to constant light (125 le m )2 s )1 )at23 C. Plants for experiments in light:dark photoperiods were grown under 14-h light (125 le m )2 s )1 ):10-h dark cycles. Philips fluorescent lights (TLD18 W/29 and TLD18 W/33CW) provided lighting for plant growth. Hypocotyl measurements were made on 7-day-old seedlings grown in constant light conditions (white light, 125 le m )2 s )1, or red light, 5 le m )2 s )1, and in the dark). At least 10 seedlings were measured for each sample. Flowering time measurements Arabidopsis plants were grown on soil in mm pots. The time of flowering was determined as the day when the plant had a bolt of 10 mm, and the number of rosette leaves was counted. RNA analysis RNA extraction and Northern analysis were carried out as previously described (Green and Tobin, 1999). The results were confirmed by repeating the experiments at least once and with verification by quantitative real-time PCR (Rotagene ( science.com), performed according to the manufacturer s instructions using tubulin as a control). The primers used to make RNA probes for the Northern analyses were as follows: CCA1 forward, GTTGCAGCTGCTAGTGCTTG; CCA1 reverse, TGTAATACGACTCA- CTATAGGGAAGATCGAGCCTTTGATGC; CRB probe 1 forward, GAGGATGCAGTTGATCCGAAG; CRB probe 1 reverse, TGTAATAC GACTCACTATAGGGCAGAGTTTGGAACCGGGATT; CRB probe 2 forward, ATTTCTTTGCATCGGTGGAG; CRB probe 2 reverse, TGTAATACGACTCACTATAGGGTTCTTGCTCAGAATCATGTCG. The primers for quantitative real-time PCR were as follows: CCA1 forward, TCCAGATAAGAAGTCACGCTCA; CCA1 reverse, TCT- AGCGCTTGACCCATAGC; CRB forward, CGGTTCCAAACTCTGGG- ATA; CRB reverse, TCGTTACCAAGCACGTTGAG; STN7 forward, GCACGAGGCTCCACTAGTTT; STN7 reverse, CATTGGCCTCATCT- TCCTTC; TUB forward, GGTTGAGCCTTACAACGCTACTCT; TUB reverse, GTGGTTCAAATCACCAAAGCTGGG; ATGRP7 forward, TGGTGGTGGAGGATGGTAAT; ATGRP7 reverse, CAAAATAGAGA- ACACACAAAACCAAG; LHCB forward, AACCTTCAACGGCTCCCA- TCAA; LHCB reverse, AGAGGCAGTTTGGTTCAAGGCT; LHY forward, GCTAAGGCAAGAAAGCCATA; LHY reverse, TGCCAAGC- TCTTCCATAAAG; CO forward, ATATGGCTCCTCAGGGACTCACTA; CO reverse, ACTCCGGCACAACACCAGTTT. Electron microscopy A slightly modified method of Asakura et al. (2004) was used. Briefly, leaves were cut in 5% glutaraldehyde in 0.1 M cacodylate buffer, ph 5.5, vacuum-treated for 15 min and fixed overnight at 4 C. After three washes in 0.1 M cacodylate buffer the tissue was post-fixed with 2% osmium tetroxide in the presence of 1.5% potassium ferricyanide for 2 h. The fixed samples were dehydrated in ethanol and embedded in Epon resin. Ultra-thin sections cut by an LKB Bromma 8800 ultrotome were stained with uranyl acetate and lead citrate. Micrographs were taken with Tecnai 12 electron microscope (Phillips, equipped with a Megaview II CCD camera and an ANALYSIS 3.0 (Soft Imaging System, Chlorophyll extraction and quantification Plants were weighed and mg of the mature leaves were ground with a mortar and pestle in 80% (v/v) acetone and sand. After a brief centrifugation the chlorophyll was re-extracted from the pellet. Absorbances of the combined supernatants at 645 and 663 nm were measured and the chlorophyll content was calculated using the following formulas: lg chlorophyll a ml )1 = 12.7 A A 645 ; lg chlorophyll b ml )1 = 22.9 A A 663. Measurements were made on six plants for each of the wild-type and mutant lines. The experiment was repeated three times with essentially similar results. Fluorescence measurements Fluorescence induction kinetics at room temperature (25 C) were measured using a pulse amplitude modulation fluorimeter PAM101 (Walz, qp (photochemical quenching) was calculated according to the method of Maxwell and Johnson (Maxwell and Johnson, 2000). Fluorescence emission spectra at 77 K were measured using a Fluomax-3 spectrofluorometer (Jobin Ivon, Longjumaeu, France). The excitation wavelength was set at 430 nm. Measurements were performed on homogenized plant material or on acetone-extracted tissue. Acknowledgements This work was supported by ISF grants ( and ) and an Enrico Berman Fund grant ( ). We would like to thank Prof. J. Chory and Dr A. Nott for their generous gift of the gun mutant seeds, Prof. Y. Ohad for allowing us the use of his equipment for making the fluorescence measurements, Prof. N. Reinhold for her insight and comments on the project and Maria Belitcky for her excellent technical assistance. Supplementary material The following supplementary material is available for this article online: Figure S1. Circadian gene expression in wild-type and crb-2 plants. Wild-type and crb-2 plants were transferred to constant light after entrainment over long days. The accumulation of (a) CCA1, (b) LHY, and (c) Lhcb mrna was determined by quantitative real-time PCR compared with a tubulin (TUB) control. The yellow and grey-hatched bars represent subjective light and dark periods respectively. Figure S2. CO transcript accumulation in wild-type and crb-1 plants. Wild-type and crb-1 plants were transferred to constant light after entrainment over long days. The accumulation of CO mrna was determined by quantitative real-time PCR compared with a tubulin (TUB) control. The yellow and grey-hatched bars represent subjective light and dark periods respectively. This material is available as part of the online article from

11 Circadian regulation and the chloroplast 561 References Alabadi, D., Oyama, T., Yanovsky, M.J., Harmon, F.G., Mas, P. and Kay, S.A. (2001) Reciprocal regulation between TOC1 and LHY/ CCA1 within the Arabidopsis circadian clock. Science, 293, Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genomewide insertional mutagenesis of Arabidopsis thaliana. Science, 301, Asakura, Y., Hirohashi, T., Kikuchi, S., Belcher, S., Osborne, E., Yano, S., Terashima, I., Barkan, A. and Nakai, M. (2004) Maize mutants lacking chloroplast FtsY exhibit pleiotropic defects in the biogenesis of thylakoid membranes. Plant Cell, 16, Barak, S., Tobin, E.M., Andronis, C., Sugano, S. and Green, R.M. (2000) All in good time: the Arabidopsis circadian clock. Trends Plant Sci. 5, Bellafiore, S., Barneche, F., Peltier, G. and Rochaix, J.D. (2005) State transitions and light adaptation require chloroplast thylakoid protein kinase STN7. Nature, 433, Biehl, A., Richly, E., Noutsos, C., Salamini, F. and Leister, D. (2005) Analysis of 101 nuclear transcriptomes reveals 23 distinct regulons and their relationship to metabolism, chromosomal gene distribution and co-ordination of nuclear and plastid gene expression. Gene, 344, Bollenbach, T.J., Tatman, D.A. and Stern, D.B. (2003) CSP41a, a multifunctional RNA-binding protein, initiates mrna turnover in tobacco chloroplasts. Plant J. 36, Bonardi, V., Pesaresi, P., Becker, T., Schleiff, E., Wagner, R., Pfannschmidt, T., Jahns, P. and Leister, D. (2005) Photosystem II core phosphorylation and photosynthetic acclimation require two different protein kinases. Nature, 437, Dodd, A.N., Salathia, N., Hall, A., Kevei, E., Toth, R., Nagy, F., Hibberd, J.M., Millar, A.J. and Webb, A.A. (2005) Plant circadian clocks increase photosynthesis, growth, survival, and competitive advantage. Science, 309, Dyall, S.D., Brown, M.T. and Johnson, P.J. (2004) Ancient invasions: from endosymbionts to organelles. Science, 304, Edwards, K.D., Lynn, J.R., Gyula, P., Nagy, F. and Millar, A.J. (2005) Natural allelic variation in the temperature-compensation mechanisms of the Arabidopsis thaliana circadian clock. Genetics, 170, Edwards, K.D., Anderson, P.E., Hall, A., Salathia, N.S., Locke, J.C., Lynn, J.R., Straume, M., Smith, J.Q. and Millar, A.J. (2006) FLOWERING LOCUS C mediates natural variation in the hightemperature response of the Arabidopsis circadian clock. Plant Cell, 18, Gould, P.D., Locke, J.C., Larue, C. et al. (2006) The molecular basis of temperature compensation in the Arabidopsis circadian clock. Plant Cell, 18, Gray, J.C., Sullivan, J.A., Wang, J.H., Jerome, C.A. and MacLean, D. (2003) Coordination of plastid and nuclear gene expression. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358, ; discussion Green, R.M. and Tobin, E.M. (1999) Loss of the circadian clock-associated protein 1 in Arabidopsis results in altered clockregulated gene expression. Proc. Natl Acad. Sci. U S A 96, Green, R.M., Tingay, S., Wang, Z.Y. and Tobin, E.M. (2002) Circadian rhythms confer a higher level of fitness to Arabidopsis plants. Plant Physiol. 129, Harmer, S.L., Hogenesch, J.B., Straume, M., Chang, H.S., Han, B., Zhu, T., Wang, X., Kreps, J.A. and Kay, S.A. (2000) Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science, 290, Heintzen, C., Nater, M., Apel, K. and Staiger, D. (1997) AtGRP7, a nuclear RNA-binding protein as a component of a circadianregulated negative feedback loop in Arabidopsis thaliana. Proc. Natl Acad. Sci. U S A 94, Karpinski, S., Reynolds, H., Karpinska, B., Wingsle, G., Creissen, G. and Mullineaux, P. (1999) Systemic signaling and acclimation in response to excess excitation energy in Arabidopsis. Science, 284, Kleffmann, T., Russenberger, D., von Zychlinski, A., Christopher, W., Sjolander, K., Gruissem, W. and Baginsky, S. (2004) The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. Curr. Biol. 14, Koussevitzky, S., Nott, A., Mockler, T.C., Hong, F., Sachetto- Martins, G., Surpin, M., Lim, J., Mittler, R. and Chory, J. (2007) Signals from chloroplasts converge to regulate nuclear gene expression. Science, 316, Leister, D. (2005) Genomics-based dissection of the cross-talk of chloroplasts with the nucleus and mitochondria in Arabidopsis. Gene, 354, Locke, J.C., Millar, A.J. and Turner, M.S. (2005) Modelling genetic networks with noisy and varied experimental data: the circadian clock in Arabidopsis thaliana. J. Theor. Biol. 234, Makino, S., Matsushika, A., Kojima, M., Yamashino, T. and Mizuno, T. (2002) The APRR1/TOC1 quintet implicated in circadian rhythms of Arabidopsis thaliana: I. Characterization with APRR1- overexpressing plants. Plant Cell Physiol. 43, Martin, W., Rujan, T., Richly, E., Hansen, A., Cornelsen, S., Lins, T., Leister, D., Stoebe, B., Hasegawa, M. and Penny, D. (2002) Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc. Natl Acad. Sci. U S A 99, Maxwell, K. and Johnson, G.N. (2000) Chlorophyll fluorescence a practical guide. J. Exp. Bot. 51, Michael, T.P. and McClung, C.R. (2003) Enhancer trapping reveals widespread circadian clock transcriptional control in Arabidopsis. Plant Physiol. 132, Millar, A.J., Straume, M., Chory, J., Chua, N.H. and Kay, S.A. (1995) The regulation of circadian period by phototransduction pathways in Arabidopsis. Science, 267, Mochizuki, N., Brusslan, J.A., Larkin, R., Nagatani, A. and Chory, J. (2001) Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc. Natl Acad. Sci. U S A 98, Nott, A., Jung, H.S., Koussevitzky, S. and Chory, J. (2006) Plastidto-nucleus retrograde signaling. Annu. Rev. Plant Biol. 57, Pfannschmidt, T., Schutze, K., Brost, M. and Oelmuller, R. (2001) A novel mechanism of nuclear photosynthesis gene regulation by redox signals from the chloroplast during photosystem stoichiometry adjustment. J. Biol. Chem. 276, Putterill, J., Laurie, R. and Macknight, R. (2004) It s time to flower: the genetic control of flowering time. Bioessays, 26, Richly, E. and Leister, D. (2004) An improved prediction of chloroplast proteins reveals diversities and commonalities in the chloroplast proteomes of Arabidopsis and rice. Gene, 329, Richly, E., Dietzmann, A., Biehl, A., Kurth, J., Laloi, C., Apel, K., Salamini, F. and Leister, D. (2003) Covariations in the nuclear chloroplast transcriptome reveal a regulatory master-switch. EMBO Rep. 4, Rolland, F., Moore, B. and Sheen, J. (2002) Sugar sensing and signalling in plants. Plant Cell, 14, S185 S205.

12 562 Miriam Hassidim et al. Salome, P.A. and McClung, C.R. (2004) The Arabidopsis thaliana clock. J. Biol. Rhythms 19, Salome, P.A. and McClung, C.R. (2005) PSEUDO-RESPONSE REGULATOR 7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian clock. Plant Cell, 17, Schaffer, R., Ramsay, N., Samach, A., Corden, S., Putterill, J., Carre, I.A. and Coupland, G. (1998) The late elongated hypocotyl mutation of Arabidopsis disrupts circadian rhythms and the photoperiodic control of flowering. Cell, 93, Schaffer, R., Landgraf, J., Accerbi, M., Simon, V., Larson, M. and Wisman, E. (2001) Microarray analysis of diurnal and circadian-regulated genes in Arabidopsis. Plant Cell, 13, Somers, D.E., Devlin, P.F. and Kay, S.A. (1998) Phytochromes and cryptochromes in the entrainment of the Arabidopsis circadian clock. Science, 282, Strand, A., Asami, T., Alonso, J., Ecker, J.R. and Chory, J. (2003) Chloroplast to nucleus communication triggered by accumulation of Mg-protoporphyrinIX. Nature, 421, Strayer, C., Oyama, T., Schultz, T.F., Raman, R., Somers, D.E., Mas, P., Panda, S., Kreps, J.A. and Kay, S.A. (2000) Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science, 289, Suarez-Lopez, P., Wheatley, K., Robson, F., Onouchi, H., Valverde, F. and Coupland, G. (2001) CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature, 410, Susek, R.E., Ausubel, F.M. and Chory, J. (1993) Signal transduction mutants of Arabidopsis uncouple nuclear CAB and RBCS gene expression from chloroplast development. Cell, 74, Vandenabeele, S., Vanderauwera, S., Vuylsteke, M., Rombauts, S., Langebartels, C., Seidlitz, H., Zabeau, M., van Montagu, M., Inze, D. and Van Breusegem, F. (2004) Catalase deficiency drastically affects gene expression induced by high light in Arabidopsis thaliana. Plant J. 31, Wang, Z.Y. and Tobin, E.M. (1998) Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell, 93, Yamaguchi, K., Beligni, M.V., Prieto, S., Haynes, P.A., McDonald, W.H., Yates, J.R. 3rd and Mayfield, S.P. (2003) Proteomic characterization of the Chlamydomonas reinhardtii chloroplast ribosome. Identification of proteins unique to the 70 S ribosome. J. Biol. Chem. 278, Yang, J. and Stern, D.B. (1997) The spinach chloroplast endoribonuclease CSP41 cleaves the 3 -untranslated region of petd mrna primarily within its terminal stem-loop structure. J. Biol. Chem. 272, Yang, J., Schuster, G. and Stern, D.B. (1996) CSP41, a sequencespecific chloroplast mrna binding protein, is an endoribonuclease. Plant Cell, 8, Ytterberg, A.J., Peltier, J.B. and van Wijk, K.J. (2006) Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes. Plant Physiol. 140, Note added in proof GUN1 has recently been reported to be a chloroplast-localized pentatricopeptide-repeat protein (Koussevitzky et al., 2007).