Cardiac troponin T mutations: correlation between the type of mutation and the nature of myofilament dysfunction in transgenic mice

Transcription

1 12644 Journal of Physiology (2001), 536.2, pp Cardiac troponin T mutations: correlation between the type of mutation and the nature of myofilament dysfunction in transgenic mice David E. Montgomery, Jil C. Tardiff * and Murali Chandra Department of Physiology and Biophysics and Program in Cardiovascular Sciences, University of Illinois at Chicago, College of Medicine, Chicago, IL and * Department of Medicine, Albert Einstein College of Medicine, Bronx, NY 10461, USA (Resubmitted 25 April 2001; accepted after revision 13 June 2001) 1. The heterogenic nature of familial hypertrophic cardiomyopathy (FHC) in humans suggests a link between the type of mutation and the nature of patho-physiological alterations in cardiac myocytes. Exactly how FHC-associated mutations in cardiac troponin T (ctnt) lead to impaired cardiac function is unclear. 2. We measured steady-state isometric force and ATPase activity in detergent-skinned cardiac fibre bundles from three transgenic (TG) mouse hearts in which 50, 92 and 6 % of the native ctnt was replaced by the wild type (WT) ctnt, R92Q mutant ctnt (R92Q) and the C-terminal deletion mutant of ctnt (ctnt DEL ), respectively. 3. Normalized pca tension relationships of R92Q and ctnt DEL fibres demonstrated a significant increase in sensitivity to Ca 2+ at short (2.0 µm) and long (2.3 µm) sarcomere lengths (SL). At short SL, the pca 50 values, representing the midpoint of the pca tension relationship, were 5.69 ± 0.01, 5.96 ± 0.01 and 5.81 ± 0.01 for WT, R92Q and ctnt DEL fibres, respectively. At long SL, the pca 50 values were 5.81 ± 0.01, 6.08 ± 0.01 and 5.95 ± 0.01 for WT, R92Q and ctnt DEL fibres, respectively. 4. The difference in pca required for half-maximal activation ( pca 50 ) at short and long SL was 0.12 ± 0.01 for the R92Q (92 %) TG fibres, which is significantly less than the previously reported pca 50 value of 0.29 ± 0.02 for R92Q (67%) TG fibres. 5. At short SL, Ca 2+ -activated maximal tension in both R92Q and ctnt DEL fibres decreased significantly (24 and 21 %, respectively; P<0.005), with no corresponding decrease in Ca 2+ - activated maximal ATPase activity. Therefore, at short SL, the tension cost in R92Q and ctnt DEL fibres increased by 35 and 29 %, respectively (P<0.001). 6. The fibre bundles reconstituted with the recombinant mutant ctnt DEL protein developed only 37% of the Ca 2+ -activated maximal force developed by recombinant WT ctnt reconstituted fibre bundles, with no apparent changes in Ca 2+ sensitivity. 7. Our data indicate that an important mutation-linked effect on cardiac function is the result of an inefficient use of ATP at the myofilament level. Furthermore, the extent of the mutationinduced dysfunction depends not only on the nature of the mutation, but also on the concentration of the mutant protein in the sarcomere. Familial hypertrophic cardiomyopathy (FHC) is a disease of the sarcomere (Bonne et al. 1998). Mutations in several sarcomeric proteins are the cause of FHC and play a key role in the evolution of the systemic effects of this disease (Maron et al. 1987; Geisterfer-Lowrance et al. 1990). Two of the most lethal mutations associated with human FHC involve changes in cardiac troponin T (ctnt). A mutation that results in a C-terminal truncation of ctnt (ctnt DEL ) and another in which there is a charge change at position 92 in ctnt (R92Q) both result in a hypercontractile phenotype in transgenic (TG) mice and a high frequency of sudden cardiac death in humans. Although previous studies have indicated that mutations linked to FHC function via a dominant-negative mode, a growing body of evidence supports the idea that a gain of function (that is, hypercontractility) may play a significant role in the complications associated with FHC. Hypercontractility (hypercontractile systolic function) is common in humans with FHC-associated mutations (Maron et al. 1987; Schaub et al. 1997). We have previously shown that ctnt

2 584 D. E. Montgomery, J. C. Tardiff and M. Chandra J. Physiol mutations result in hypercontractility (increased sensitivity to Ca 2+ ) in the absence of hypertrophy in TG mouse hearts (Tardiff et al. 1999; Chandra et al. 2001). However, how a gain of function translates into cardiac dysfunction and ultimately into the sequelae associated with FHC is not well understood. We hypothesize that one of the major determinants of the functional outcome of this mutation is the amount of sarcomeric incorporation of the mutant. One of the most striking features of the study by Tardiff et al. (1999) was that mouse hearts expressing high levels (92 %) of the R92Q mutant ctnt (R92Q) demonstrated markedly increased lipid deposition and mitochondrial pathology, although the sarcomeric structure remained intact. This phenotype strongly suggested that total cellular metabolism (usage of cellular ATP) was altered. How the mutation could lead to altered ATP usage has not been explored. In another TG mouse (Tardiff et al. 1998), expression of only 6 % of ctnt DEL resulted in scattered sarcomeric disarray and scattered myofibrillar lysis, whereas homozygous TG mice expressing 10 % of the ctnt DEL mutant were either stillborn or died within 24 h of birth, emphasizing the severity of this mutation. Watkins et al. (1996) showed that quail skeletal myotubes expressing the mutant human ctnt DEL developed 80 % less force than control myotubes. However, with both mutants (92 % R92Q ctnt and 6 % ctnt DEL ), we have shown that the myofilaments are hypercontractile (Tardiff et al. 1999; Chandra et al. 2001). Other studies of the functional consequences of the R92Q and ctnt DEL mutants have provided conflicting results (Morimoto et al. 1998; Sweeney et al. 1998; Rust et al. 1999; Szczesna et al. 1999). This might be related to the use of heterologous proteins, different expression levels and/or the cell type. Evidence obtained from recent in vitro studies suggests that a ctnt mutant can have multiple effects depending on the concentration of the mutant protein in the sarcomere (Redwood et al. 2000). This is an interesting observation in that it might partly explain how different stimuli induce distinct morphological and functional phenotypes. The main objective of this study was to determine the molecular basis of two ctnt mutations that elicit different responses in TG mouse hearts. We studied two TG models that offer selective advantages for addressing the important issues in our study. First, the R92Q mutation limits relaxation, but hypercontractility might increase energy costs for contraction. This could lead to a chronic mismatch between ATP synthesis and consumption by the overall crossbridge activity. Second, a TG mouse model in which the ctnt DEL is expressed at 6 % of the total ctnt pool allowed us to test the effects of low level expression of ctnt DEL on myofilament function. To determine the effect of a higher concentration of ctnt DEL on myofilament activation, we measured Ca 2+ activation of tension development in mouse cardiac fibre bundles reconstituted with the recombinant mutant ctnt DEL. Furthermore, because these mutations result in increased sensitivity to Ca 2+, it is possible that an important aspect of cardiac regulation (i.e. the Frank-Starling mechanism) is impaired. We tested the effect of both mutations on length-dependent activation. Our findings add a new dimension to the understanding of mutations that cause a gain of function. Here, we show that FHC-linked mutations in ctnt are correlated with changes in energetic aspects of contraction. METHODS Transgenic mice A 2996 bp rat a-myosin heavy chain promoter (Tardiff et al. 1998) was used to drive cardiac-specific expression of three different lines of TG mice that expressed the WT mouse ctnt, the R92Q mutant ctnt (R92Q) and the C-terminal deletion mutant ctnt (ctnt DEL ), as described in Tardiff et al. (1998, 1999). The skipping of exon 15 in human ctnt leads to the deletion of 28 amino acids from the carboxyl terminus, which is replaced by a seven amino acid peptide that is not related to ctnt (Watkins et al. 1995). In all the TG constructs, ctnt was tagged at the N-terminus with an 11 amino acid human c-myc epitope (Tardiff et al. 1998). In previous studies, neither the transgene (WT) expression nor the presence of the myc tag at the N-terminus had any effect on the normal function of the heart (Tardiff et al. 1998) or Ca 2+ -activated tension development in detergent-skinned fibre bundles (Chandra et al. 2001). Therefore, we used fibre bundles from the WT TG mouse hearts as controls in our experiments. Simultaneous measurement of force and ATPase activity All experiments were carried out according to the guidelines laid down by the Animal Care Committee at the University of Illinois (Chicago). Mice were anaesthetized with sodium pentobarbital (50 mg kg _1 body weight), and the hearts were rapidly excised and placed into ice-cold high-relaxing (HR) solution containing 20 mm Mops, ph 7.0, 53 mm KCl, 10 mm EGTA, 6.81 mm MgCl 2, 5.35 mm Na 2 ATP, 12 mm creatine phosphate, 10 i.u. ml _1 creatine kinase (bovine heart, Sigma) and 0.5 mm DTT. The total ionic strength of HR was 150 mm. A cocktail of protease inhibitors, containing 10 µm leupeptin, 1 µm pepstatin and 100 µm phenylmethylsulphonyl fluoride (PMSF), was included in the buffer. Left ventricular papillary muscles were isolated from the heart and dissected into thin fibre bundles approximately µm in width and mm in length. Fibre bundles were detergent skinned overnight in HR solution containing 1 % Triton X-100. The experimental procedures for measuring force and ATPase activity were as described previously (de Tombe & Stienen, 1995; Stienen et al. 1995; Chandra et al. 2001). A computer program (Fabiato & Fabiato, 1979; Godt & Lindley, 1982) was used to calculate the composition of the activating and relaxing solutions. The composition of the relaxation buffer (pca 8.0) was 100 mm Bes, ph 7.0, 21.2 mm potassium propionate, 5.85 mm Na 2 ATP, 7.11 mm MgCl 2, 20 mm EGTA, 200 µm diadenosine pentaphosphate (A 2 P 5 ) and 10 µm oligomycin. The composition of the activation buffer (pca 4.3) was 100 mm Bes, ph 7.0, 1.55 mm potassium propionate, 5.97mM Na 2 ATP, 6.59 mm MgCl 2, 20 mm CaEGTA, 200 µm A 2 P 5 and 10 µm oligomycin. The total ionic strength was 200 mm. A cocktail of inhibitors, containing 10 µm leupeptin, 1µM pepstatin and 10 µm PMSF, was included in all the buffers. To determine the pca tension and pca ATPase activity relationships at short (2.0 µm) and long (2.3 µm) sarcomere lengths (SL), fibre bundles were sequentially bathed in solutions with pca values ranging from 4.3 to 8.0. The ATPase activity of a fibre bundle was measured by a coupled enzyme assay, as described previously (Stienen et al. 1995; de Tombe

3 J. Physiol Cardiac troponin T mutations and myofilament dysfunction 585 & Stienen, 1995). The ATPase measurements were carried out in a buffer that included 0.9 mm NADH, 5 mm NaN 3, 10 mm phosphoenol pyruvate, 4 mg ml _1 pyruvate kinase (500 U mg _1 ) and 0.24 mg ml _1 lactate dehydrogenase (870 U mg _1 ). Myofibrillar ATPase activity in skinned fibre bundles was measured as follows: ATP regeneration from ADP was coupled to the breakdown of phosphoenol pyruvate to pyruvate and ATP, catalysed by pyruvate kinase, which was linked to the synthesis of lactate, catalysed by lactate dehydrogenase. The breakdown of NADH, which is proportional to the amount of ATP consumed, was measured by UV absorbance at 340 nm. The ratio of light intensity at 340 nm (sensitive to NADH concentration) and 410 nm (reference signal) was obtained by means of an analog divider. After each recording, the UV absorbance signal of NADH was calibrated with multiple rapid injections of 0.25 nmol ADP (0.025 µl of 10 mm ADP) into the bathing solution with a motorcontrolled calibration pipette. Preparation of recombinant mouse ctnt The DNA fragments for the WT ctnt and ctnt DEL clones were amplified from the PCR blunt clones by PCR (Tardiff et al. 1998). We used two oligonucleotide primers. Primer 1 (see below) was designed to incorporate codons for amino acids 1 6 (underlined) of the c-myc epitope at the N-terminus of both ctnt clones. This sequence was flanked on the 5fi side by nucleotides of the psbeta expression system (Boehringer Mannheim), including an Nde I restriction enzyme site. Primer 2 (below) was designed to prime 22 nucleotides downstream of the stop codon in both clones. A BamH I site (underlined) was included for subcloning purposes. Primer 1: 5fi GCAGAATTCAGGCATATGATGGAGCAAAAGCTC ATT 3fi Primer 2: 5fi TGCTGGAATTCAGGATCCTGTGAGCCAGGGCA GTG 3fi Amplified DNA fragments were subcloned into the Nde I BamHI site of the psbeta expression vector. Clones that contained the correct inserts were sequenced to confirm the sequence. Expression and purification of proteins Recombinant WT ctnt and ctnt DEL were expressed in BL21(DE3) cells (Novagen). Cells were grown overnight in Luria Broth containing 30 mg ml _1 kanamycin, and ctnt was extracted and purified, as described previously (Chandra et al. 1999b). Cardiac troponin I (ctni) and C (ctnc) were purified as described previously (Guo et al. 1994; Pan & Johnson, 1996). Exchange of endogenous Tn with recombinant WT ctnt and ctnt DEL in detergent-skinned mouse cardiac fibre bundles Exchange of the endogenous troponin complex (Tn) with the recombinant WT ctnt or ctnt DEL was based on the method described in Chandra et al. (1999a). Left ventricular papillary muscle fibre bundles from freshly dissected mouse hearts were detergentskinned overnight in HR solution containing 1 % Triton X-100 and a cocktail of protease inhibitors. WT ctnt ctni or ctnt DEL ctni was dissolved in extraction buffer containing 20 mm Mops, ph 6.5, 250 mm KCl, 5 mm EGTA, 5 mm MgCl 2, 100 µm PMSF and 1.0 mm DTT (Chandra et al. 1999a). The Tn exchange experiment was carried out in extraction buffer (2 ml) containing WT ctnt ctni or ctnt DEL ctni for approximately 70 min at room temperature with constant stirring. After WT ctnt ctni or ctnt DEL ctni treatment, the fibre bundle was washed in 2 ml of extraction buffer (without WT ctnt ctni or ctnt DEL ctni) for 10 min and 2 ml of HR for 10 min with constant stirring. To determine the extent of endogenous Tn removed, Ca 2+ -activated residual force was measured in pca 4.5 solution (20 mm Mops, ph 7.0, 22 mm KCl, 10 mm EGTA, 9.96 mm CaCl 2, 6.48 mm MgCl 2, 5.39 mm Na 2 ATP, 12 mm creatine phosphate, 10 i.u. ml _1 creatine kinase and 0.5 mm DTT). An % decrease (compared to initial maximum isometric force) in Ca 2+ -activated maximum isometric force indicated that most of the endogenous Tn had been removed. Next, the WT ctnt ctni- or ctnt DEL ctni-treated fibre bundle was relaxed in HR solution. The WT ctnt ctni or ctnt DEL ctni-treated fibre bundles were reconstituted with ctnc (4 mg ml _1 in HR, ph 7.0) for min at room temperature with constant stirring. After ctnc reconstitution, Ca 2+ -activated maximal force was measured in pca 4.5 solution. Gel electrophoresis and Western blot analysis Samples were prepared and 30 µg of protein per lane was run on 12.5 % SDS-polyacrylamide gels, as described previously (Chandra et al. 1999b). The protein concentration was determined by using a Bio-Rad DC (detergent compatible) protein assay kit. Proteins were transferred onto nitrocellulose for Western blot analysis using an anti-mouse primary antibody against the c-myc tag, as described previously (Tardiff et al. 1998). Non-SDS alkaline urea-page was performed using a 4 % stacking gel and 8 % separating gels containing 6 M urea, as described previously (Blanchard & Solaro, 1984). Data analysis Data from the normalized pca force and pca ATPase activity measurements were fitted to the Hill equation by using non-linear least-squares regression to obtain the pca 50 (pca required for halfmaximal activation) and the Hill coefficient. All data are presented as means ± S.E.M. All data were normally distributed and statistical differences were analysed by Student s unpaired t test or one-way ANOVA with Student-Newman-Keuls post hoc tests. Significance was set at P<0.05 RESULTS Ca 2+ sensitivity of myofilament activation in detergent-skinned fibre bundles Figure 1 illustrates the effects of ctnt mutations on the length-dependent activation of detergent-skinned fibre bundles from WT, R92Q and ctnt DEL TG mouse hearts. In Fig. 1A and B, the relationship between the steadystate tension and pca is compared at SL of 2.0 and 2.3 µm, respectively. When compared to the WT fibres, R92Q fibres had a nearly 2-fold greater sensitivity to Ca 2+ at short and long SL. The increase in sensitivity to Ca 2+ caused by changing the SL from 2.0 to 2.3 µm in the R92Q fibres was similar to that of WT fibres. The ctnt DEL fibres also demonstrated a significant increase in sensitivity to Ca 2+ at both short and long SL. However, the magnitude of the pca 50 shift produced by the ctnt DEL TG fibres was less than that produced by the R92Q fibres. Figure 2 shows the relationship between the Ca 2+ - activated ATPase activity and steady-state isometric force generation in detergent-skinned fibre bundles from the WT, R92Q and ctnt DEL TG mouse hearts. Ca 2+ - activated ATPase activity increased in proportion to the isometric tension development. Thus, the pca 50 values were similar to those for pca tension relationships (see Fig. 1). These values demonstrated that both R92Q and ctnt DEL fibre bundles were more sensitive to Ca 2+ than were WT bundles. Moreover, the magnitude of the increase in the Ca 2+ sensitivity of ATPase activity was similar to the increase in the Ca 2+ sensitivity of tension.

4 586 D. E. Montgomery, J. C. Tardiff and M. Chandra J. Physiol Figure 1. Normalized pca tension relationships in detergent-skinned muscle fibre bundles from WT, R92Q and ctnt DEL TG mouse hearts The composition of the activation buffer (pca 4.3, ionic strength 200 mm) is given in the Methods. For complete buffer conditions see Stienen et al. (1995) and de Tombe & Stienen (1995). A, pca tension relationship of WT, R92Q and ctnt DEL fibre bundles at SL of 2.0 µm. WT (1), pca 50 = 5.69 ± 0.01, n=4.3 ± 0.2; R92Q (0), pca 50 = 5.96 ± 0.01, n=3.0 ± 0.2; and ctnt DEL (9), pca 50 = 5.81 ± 0.01, n=2.8 ± 0.2. B, pca tension relationship of WT, R92Q and ctnt DEL fibre bundles at SL of 2.3 µm. WT (1), pca 50 = 5.81 ± 0.01, n=3.0 ± 0.1; R92Q (0), pca 50 = 6.08 ± 0.01, n=3.0 ± 0.1; and ctnt DEL (9), pca 50 = 5.95 ± 0.01, n=2.9 ± 0.2. Number of determinations was 10 for the WT, 9 for R92Q and 8 for ctnt DEL. Effects of mutations in ctnt on tension cost in detergent-skinned fibre bundles To determine the economy of tension maintenance, we measured steady-state isometric force and ATPase activity simultaneously in fibre bundles from WT, R92Q and ctnt DEL TG mouse hearts. The R92Q and ctnt DEL mutations had no significant effect on baseline (pca 8.0) isometric force and ATPase activity at both short and long SL (data not shown). At SL of 2.0 µm, there was a significant (P<0.005) % decrease in Ca 2+ -activated maximal tension in the mutant preparations compared to WT (29 ± 1 mn mm _2 for WT, 22 ± 2 mn mm _2 for R92Q and 23 ± 1 mn mm _2 for ctnt DEL ; Fig. 3A). Figure 3B shows that at long SL (2.3 µm), Ca 2+ -activated maximal tension in R92Q and ctnt DEL fibres was not significantly altered when compared to WT fibres (45 ± 2 mn mm _2 for WT, 41 ± 3 mn mm _2 for R92Q and 42 ± 3 mn mm _2 for ctnt DEL ). Interestingly, Ca 2+ -activated maximal ATPase activity in R92Q and ctnt DEL fibres was not significantly different from that in WT fibres (Fig. 4). At SL of 2.0 µm, Ca 2+ - activated maximal ATPase activity was 241 ± 17pmol µl _1 s _1 for the WT, 241 ± 14 pmol µl _1 s _1 for R92Q and 252 ± 14 pmol µl _1 s _1 for ctnt DEL fibres (Fig. 4A). At SL of Figure 2. Normalized pca ATPase activity relationships in detergent-skinned fibre bundles from WT, R92Q and ctnt DEL TG mouse hearts The buffer used is described in Methods. For other details, see Stienen et al. (1995) and de Tombe & Stienen (1995). A, pca ATPase activity relationship at SL of 2.0 µm. WT (1), pca 50 = 5.78 ± 0.01, n=4.8 ± 0.2; R92Q (0), pca 50 = 6.02 ± 0.01, n=3.0 ± 0.2; and ctnt DEL (9), pca 50 = 5.92 ± 0.01, n=3.5 ± 0.2. B, pca ATPase relationship at SL of 2.3 µm. WT (1), pca 50 = 5.88 ± 0.01, n=3.7± 0.1; R92Q (0), pca 50 = 6.13 ± 0.01, n=3.4 ± 0.2; and ctnt DEL (9), pca 50 = 5.99 ± 0.01, n=3.0 ± 0.2. Number of determinations was 10 for the WT, 9 for R92Q and 8 for ctnt DEL.

5 J. Physiol Cardiac troponin T mutations and myofilament dysfunction 587 Figure 3. Ca 2+ -activated maximal tension in detergent-skinned fibre bundles from WT, R92Q and TnT DEL TG mouse hearts A, Ca 2+ -activated maximal tension developed by the fibre bundles at SL of 2.0 µm: WT, 29 ± 1 mn mm _2 ; R92Q, 22 ± 2 mn mm _2 ; and ctnt DEL, 23 ± 1 mn mm _2. B, Ca 2+ -activated maximal tension developed by the fibre bundles at SL of 2.3 µm: WT, 45 ± 2 mn mm _2 ; R92Q, 41 ± 3 mn mm _2 ; and ctnt DEL, 42 ± 3 mn mm _2. Number of determinations was 10 for the WT, 9 for R92Q and 8 for ctnt DEL. * Significantly different from WT (P<0.005). 2.3 µm, Ca 2+ -activated maximal ATPase activity was 277 ± 13 pmol µl _1 s _1 for the WT, 279 ± 22 pmol µl _1 s _1 for R92Q, and 283 ± 13 pmol µl _1 s _1 for ctnt DEL fibres (Fig. 4B). At SL of 2.0 µm, although there was a significant decrease in Ca 2+ -activated maximal tension in the mutant preparations (Fig. 3A), there was no corresponding decrease in Ca 2+ -activated maximal ATPase activity (Fig. 4A). Therefore, our data indicated that the economy of tension maintenance in R92Q and ctnt DEL TG fibres decreased significantly at SL of 2.0 µm. Figure 5A shows that the tension cost, defined as the ratio of the rate of ATP consumption to the steady-state isometric tension at maximal activation, increased significantly (P<0.001), by 35 % in R92Q and 29 % in ctnt DEL fibres. This indicated that both the R92Q and the ctnt DEL fibre bundles consume more ATP for a given amount of tension at short SL than WT bundles. The tension cost at long SL was not significantly different for either mutant compared to the WT control (Fig. 5B). Exchange of endogenous Tn with recombinant WT ctnt and ctnt DEL in detergent-skinned mouse cardiac fibre bundles Expression of more than 6 % ctnt DEL in the heart is lethal in TG mice (Tardiff et al. 1998). To test the effects of a higher concentration of ctnt DEL on cardiac myofilament activation, we reconstituted purified recombinant WT ctnt and the ctnt DEL mutant into detergent-skinned mouse cardiac fibre bundles using the previously described procedure (Chandra et al. 1999a). In this procedure, the Figure 4. Ca 2+ -activated maximum rate of ATP consumption by the fibre bundles from WT, R92Q and ctnt DEL TG mouse hearts A, Ca 2+ -activated maximal ATPase activity in fibre bundles at SL of 2.0 µm: WT, 241 ± 17 pmol µl _1 s _1 ; R92Q, 241 ± 14 pmol µl _1 s _1 ; and ctnt DEL, 252 ± 14 pmol µl _1 s _1. B, Ca 2+ -activated maximal ATPase activity in fibre bundles at SL of 2.3 µm: WT, 277 ± 13 pmol µl _1 s _1 ; R92Q, 279 ± 22 pmol µl _1 s _1 ; and ctnt DEL, 283 ± 13 pmol µl _1 s _1. Number of determinations was 10 for the WT, 9 for R92Q and 8 for ctnt DEL.

6 588 D. E. Montgomery, J. C. Tardiff and M. Chandra J. Physiol Figure 5. Tension cost in detergent-skinned fibre bundles from WT, R92Q and ctnt DEL TG mouse hearts Tension cost is defined as the ratio of the rate of ATP consumption to the steady-state isometric tension at maximal activation. A, tension cost at SL of 2.0 µm: WT, 8.4 ± 0.3 pmol mn _1 mm _1 s _1 ; R92Q, 11.4 ± 0.4 pmol mn _1 mm _1 s _1 ; ctnt DEL, 10.9 ± 0.5 pmol mn _1 mm _1 s _1. B, tension cost at SL of 2.3 µm: WT, 6.2 ± 0.3 pmol mn _1 mm _1 s _1 ; R92Q, 6.7± 0.3 pmol mn _1 mm _1 s _1 ; ctnt DEL, 6.6 ± 0.2 pmol mn _1 mm _1 s _1. Number of determinations was 10 for the WT, 9 for R92Q and 8 for ctnt DEL. * Significantly different from WT (P<0.001). endogenous Tn was replaced by initially treating the fibres with exogenous WT ctnt or ctnt DEL ctni followed by reconstitution with ctnc. We previously reported that the amount by which Ca 2+ -regulated force decreased after the initial treatment with ctnt ctni is a function of the extent of endogenous Tn removed from the fibre bundles (Chandra et al. 1999a). After the initial treatment, the decrease in Ca 2+ -activated force was 87% for the WT ctnt ctni-treated and 90 % for the ctnt DEL ctni-treated fibre bundles (Fig. 7A). This indicated that both WT ctnt and ctnt DEL effectively displaced major proportions of the endogenous Tn from the fibre bundles. The incorporation of WT ctnt and the ctnt DEL mutant into the sarcomere was confirmed by Western blot analysis (Fig. 6A). The efficacy of the removal of endogenous Tn by both mutants was demonstrated by alkaline urea gel electrophoresis in the absence of SDS (Blanchard & Solaro, 1984). Under these conditions, ctnc migrates well ahead of other fibre bundle components and visualization of ctnc is improved. The absence of native ctnc in either the WT ctnt ctni- or the ctnt DEL ctni-treated fibre bundles offers a good means of estimating the amount of endogenous Tn removed. The absence of native TnC in the WT ctnt ctni- and ctnt DEL ctni-treated fibre bundles (Fig. 6B, lanes 1 and 3) clearly demonstrated the removal of Figure 6. Gel analysis of WT ctnt ctni- and ctnt DEL ctni-treated mouse cardiac fibre bundles A, Western blot analysis of WT ctnt ctni- and ctnt DEL ctni-treated fibre bundles. Anti-mouse primary antibody was used to probe for the c-myc tag. Lanes 1 and 2 show the purified c-myc tagged WT ctnt and ctnt DEL. No immunoreactivity was evident in the control untreated preparations (lane 3), whereas the c-myc tag was detectable in the ctnt DEL -reconstituted (lane 4) and WT ctnt preparations (lane 5). B, non-sds alkaline urea-page (8 %) of the WT ctnt ctni-/ctnt DEL ctni-treated and ctncreconstituted fibre bundles. Lane 1, WT ctnt ctni-treated fibres; lane 2, WT ctnt ctni-treated fibres + ctnc-reconstituted fibres; lane 3, ctnt DEL ctni-treated fibres; lane 4, ctnt DEL ctni-treated + ctncreconstituted fibres; lane 5, pure ctnc standard.

7 J. Physiol Cardiac troponin T mutations and myofilament dysfunction 589 endogenous Tn. Moreover, the observation that nearly 90 % of Ca 2+ -regulated force was lost after treatment with either WT ctnt ctni or ctnt DEL ctni (Fig. 7A) clearly demonstrated that a major proportion of the native Tn had been removed. After reconstitution with ctnc, approximately 75 % of the original Ca 2+ -regulated force was recovered in the WT ctnt ctni-treated fibre bundles. By contrast, only 28 % of the original Ca 2+ -regulated force was recovered in ctnt DEL ctni-treated fibre bundles (Fig. 7A). When compared across treatments, the fibre bundles reconstituted with ctnt DEL ctni ctnc developed only 37% of the force developed by the WT ctnt ctni ctnc reconstituted fibre bundles. Figure 7B illustrates the pca force relationships for detergent-skinned fibre bundles reconstituted with WT ctnt and ctnt DEL. In contrast to the case in the ctnt DEL TG mouse model, where only 6 % of the mutant was expressed, the pca 50 values were not different in these exchange experiments (5.51 ± 0.01 for WT ctnt ctni ctnc and 5.49 ± 0.02 for the ctnt DEL ctni ctnc reconstituted fibre bundles). The Hill coefficient values were significantly altered in the case of ctnt DEL reconstituted fibre bundles (2.7± 0.2 for WT ctnt ctni ctnc and 1.4 ± 0.1 for the ctnt DEL ctni ctnc reconstituted fibre bundles). The significant change in the Hill coefficient reported here could be due to the weakening of TnC interaction with either ctni or ctnt. In fact, Mukherjea et al. (1999) have shown that the binding of ctni to ctnt DEL decreases by 6-fold when compared with the binding of ctni to normal ctnt. Such a decrease in the binding of ctni to ctnt DEL might lead to altered Ca 2+ activation by modulating the interaction between ctni and ctnc. DISCUSSION There has been little insight into the mechanism by which FHC-linked mutations that result in hypercontractility lead to contractile dysfunction. Our findings suggest that hypercontractility, a hallmark of FHC-linked ctnt mutations, could eventually lead to a marked decrease in the economy of tension development. In this way, the available pool of ATP would be compromised and muscle contraction may be hampered. Humans with these mutations often present with differing phenotypes, whereas some show no signs or symptoms of the disease. Here, we present experimental evidence to support the interesting possibility that the disparate expression of these mutations could be a funcion of the concentration of the mutant protein in the sarcomere (Redwood et al. 2000). Increased Ca 2+ sensitivity of TG myofilaments: implications for altered length-dependent activation With regard to the R92Q mutation in ctnt (Chandra et al. 2001), we have studied a new TG mouse model in which 92 % of the total ctnt in the heart was replaced by R92Q. Tardiff et al. (1999) showed that histopathological changes were more significant in TG mice in which 92 % of the endogenous ctnt was replaced by R92Q. Thus, their observation suggested a direct link between the amount of mutant protein and the extent of myocardial damage. A surprising feature of the TG mouse used in the present study is that sensitivity to Ca 2+ was not amplified at long SL in 92 % TG fibres. The SL-induced increase in sensitivity to Ca 2+ in the R92Q fibres was similar to that of WT fibres. The difference in pca required for halfmaximal activation at short and long SL ( pca 50 ) was Figure 7. Effect of recombinant WT ctnt and ctnt DEL on Ca 2+ -regulated myofilament activation in detergent-skinned mouse cardiac fibre bundles The composition of the activation buffer (pca 4.5, ionic strength 150 mm) is given in the Methods. A, effect on Ca 2+ -activated maximal isometric force. Ca 2+ -activated maximum force generated by the fibre before the treatment was taken as 100 %. 1, residual force after WT ctnt ctni treatment. 2, maximum restored force in WT ctnt ctni-treated + ctnc-reconstituted fibre. 3, residual force after ctnt DEL ctni treatment. 4, maximum restored force in ctnt DEL ctni-treated + ctnc-reconstituted fibre. B, normalized pca force relationship in: WT ctnt ctni-treated + ctnc-reconstituted fibres (1, pca 50 = 5.51 ± 0.01, n=2.74 ± 0.2) and ctnt DEL ctni treated + ctnc-reconstituted fibres (0, pca 50 = 5.49 ± 0.02, n=1.4 ± 0.1). Number of determinations was 5 for each.

8 590 D. E. Montgomery, J. C. Tardiff and M. Chandra J. Physiol for the R92Q (92 %) TG fibres. In the case of R92Q (67%) TG fibres, pca 50 increased by 0.29 units when the SL was increased from 1.9 to 2.3 µm (Chandra et al. 2001). Thus, whereas the feedback effect of crossbridges on myofilament sensitivity to Ca 2+ was enhanced in fibres from R92Q (67%) TG mouse hearts (Chandra et al. 2001), it appears to be normal in fibres from R92Q (92 %) TG mouse hearts. The preferential localization of the mutant ctnt on the thin filament might be the mechanism by which crossbridge feedback on myofilament sensitivity to Ca 2+ is affected by the amount of mutant protein. If a significant proportion of R92Q in the 67% TG mouse is non-uniformly distributed in the cardiac thin filament, optimal stretching of the fibres may allow more crossbridges to interact with the region of the thin filament that contains more of the mutant ctnt, thus enhancing the Ca 2+ sensitivity of the myofilaments at longer SL in the R92Q (67%) TG fibres. On the other hand, the thin filament is nearly saturated with mutant ctnt in the 92 % TG line, which leads to enhanced Ca 2+ sensitivity at both short and long SL. Fibers from TG mouse hearts, in which 6 % of the total ctnt was replaced by ctnt DEL, also showed an increase in sensitivity to Ca 2+ at both short and long SL. However, the magnitude was smaller than that of fibres from R92Q (92 %) TG mouse hearts (see Figs 1 and 2) or from R92Q (67%) TG mouse hearts (Chandra et al. 2001). Surprisingly, even a relatively small amount of protein had a significant effect on myofilament sensitivity to Ca 2+. Observations made from studies using TG mice, expressing 6 % truncated ctnt (ctnt DEL ), have also substantiated the deleterious effect of truncated ctnt on heart function (Tardiff et al. 1998). In their study, Tardiff et al. (1998) found that heterozygous TG mouse hearts that expressed ~6 % of truncated ctnt showed significant systolic and diastolic dysfunction. A dramatic effect of truncated ctnt on the TG mouse hearts was illustrated by the observation that an increase in the rate of ventricular pressure development (+dp/dt) in response to an increased work load was significantly diminished. Moreover, there was a severe decline in the slope of the relationship between increased volume and relaxation (_dp/dt) in TG mouse hearts that expressed truncated ctnt. However, the authors could not address the issue of how a higher concentration of the truncated mutant ctnt affects cardiac myofilament function, because the homozygous TG mice expressing nearly % of the truncated mutant ctnt died soon after birth (Tardiff et al. 1998). Effect of higher concentrations of truncated TnT: implications for a concentration-dependent effect of mutation on myofilament activation An interesting aspect of the present study is that the incorporation of greater amounts of ctnt DEL into detergent-skinned cardiac fibre bundles led to a substantial decrease in Ca 2+ -activated maximal tension with no apparent changes in sensitivity to Ca 2+ at SL of 2.3 µm. This contrasts with the results obtained in TG fibres expressing 6 % ctnt DEL, which were more sensitive to Ca 2+ (Fig. 1B), but showed no changes in maximal tension (Fig. 3B) or ATPase activity (Fig. 4B) at SL of 2.3 µm. Consistent with our observation, other in vitro studies have shown that actomyosin ATPase activity decreases substantially when ctnt DEL is incorporated into fully reconstituted thin filaments (Mukherjea et al. 1999; Tobacman et al. 1999). Furthermore, quail skeletal myotubes expressing truncated mutant ctnt developed 80 % less force than control myotubes (Watkins et al. 1996). There is a lack of consensus as to whether these observations can be attributed to altered binding of Tn to thin filaments. One study showed that the Tn complex containing the truncated mutant ctnt caused a 20 % weakening of the binding of tropomyosin to actin filaments (Tobacman et al. 1999), whereas another study found no such changes (Mukherjea et al. 1999). Moreover, in vitro motility assays employing truncated mutant ctnt have given conflicting results. For example, Redwood et al. (2000) reported that there is no change in Ca 2+ -activated maximal isometric force, which is contrary to the present observations and those of others (Watkins et al. 1996; Mukherjea et al. 1999; Tobacman et al. 1999). Although the reason for this discrepancy is not clear, we cannot rule out the possibility that differences in the nature of assays might have contributed to the differences in the data. Nevertheless, two investigators have shown that the sliding velocity of the regulated thin filament is increased in preparations that contain truncated mutant ctnt (Homsher et al. 2000; Redwood et al. 2000). They proposed that this increase in sliding velocity was due to an increase in the rate of crossbridge detachment induced by the effect of the truncated mutant ctnt on the thin filaments. Interestingly, a shortened duty cycle, resulting from increased crossbridge cycling, has been proposed to increase tension cost in diseased myocardium (Sweeney et al. 1998). Effect of ctnt mutations on the relationship between tension and ATP hydrolysis: implications for altered muscle economy An interesting aspect of the present study is that there was a significant increase in tension cost in both R92Q and ctnt DEL TG fibres when compared to the WT TG fibres. Whereas the tension cost for R92Q and ctnt DEL TG fibres remained unaffected at long SL, the increased tension cost at shorter SL represents a new finding. The short SL used in the present study closely approximates the lower working range of SL in a beating heart (approximately µm; Rodriguez et al. 1992). A possible mechanism by which a decrease in the SL could affect the relationship between ATPase activity and tension is provided by Kentish & Stienen s (1994) work. They suggested that the disproportionate drop in force, relative to ATPase activity, might be accounted for in

9 J. Physiol Cardiac troponin T mutations and myofilament dysfunction 591 part by an increase in restoring force that arose from the deformation of the extracellular components at SL less than 2.0 µm. In this regard, the presence of mild fibrosis reported in the R92Q and ctnt DEL TG mouse hearts (Tardiff et al. 1998, 1999) may be highly relevant. An alternative explanation is that the increased ATPase activity at short SL is due to alterations in the kinetics of actin myosin interaction. In this case, an increase in the rate of crossbridge dissociation from actin might lead to increased ATPase activity, but a decrease the isometric force (Homsher et al. 2000). Interestingly, Homsher et al. (2000) suggested that the incorporation of I79N mutant ctnt into preparations studied in an in vitro motility assay led to an increase in the unloaded shortening velocity with a concomitant decrease in the isometric force that probably resulted from a decrease in the fraction of the attached crossbridges. However, we did not observe any significant changes in Ca 2+ -activated maximal tension or ATPase activity at long SL in myofilaments containing R92Q and ctnt DEL. Thus, our data suggest that the increased ATPase activity at the short SL was not due to an alteration in crossbridge cycling rates, but might be related to increased restoring forces associated with fibrosis in the TG fibres. Since we did not control for phosphorylation of myofilament proteins, it is impossible to rule out other secondary changes, such as altered phosphorylation of myofilament proteins, as possible explanations of the differences in mechanical results. However, the differences in mechanical results reported here cannot be explained by changes in the phosphorylation of myofilament proteins, for several reasons. First, PKA-induced phosphorylation of myofilaments is known to decrease myofilament Ca 2+ sensitivity (Garvey et al. 1988; de Tombe et al. 1995; Zhang et al. 1995; Kentish et al. 2001). However, the results of the present study demonstrate an increase in sensitivity to Ca 2+ of R92Q and ctnt DEL fibres at both short and long SL. Second, PKC-induced phosphorylation decreases Ca 2+ - activated maximal tension at long SL in detergent-skinned fibre bundles (Montgomery et al. 2001). Our observations show that at long SL, Ca 2+ -activated maximal tension and ATPase activity in both R92Q and ctnt DEL fibres were not significantly different from those of control WT TG fibres. By contrast, Ca 2+ -activated maximal tension at short SL in both R92Q and ctnt DEL fibres is significantly depressed when compared to that of WT TG fibres. Therefore, we conclude that the increase in tension cost that we observed at short SL is unrelated to the state of myofilament phosphorylation in TG fibres. One of the limitations of our study is that we did not measure SL during maximal Ca 2+ activation. Considering that the magnitude of the internal shortening in detergent-skinned muscle fibre preparations might be as much as 5 %, the resting SL of 2.0 and 2.3 µm during full Ca 2+ activation could correspond to an average SL of 1.9 and 2.2 µm, respectively. It should, however, be noted that at SL of 2.0 µm, both R92Q and ctnt DEL TG fibres demonstrated significant increases in tension cost, which remained unaltered in the WT TG fibres. Therefore, we conclude that any inhomogeneity of SL would be too small to account for the change in tension cost in R92Q and ctnt DEL TG fibres. In conclusion, our study suggests that the cellular changes induced by primary contractile dysfunction might increase energetic costs during isovolumic contractions and the ejection phase of the cardiac cycle in severely affected hearts. Chronic mismatch between ATP synthesis and ATP consumption by the overall crossbridge activity could be exacerbated when stress is imposed on the heart. Such an increase in the energy cost of contraction might also serve to link observed changes in lipid content and mitochondrial morphology in TG myocytes (Tardiff et al. 1999) to the primary dysfunction at the sarcomere level. Moreover, our study also suggests that the concentration of the mutant ctnt in the thin filament has a direct bearing on both the nature and extent of cardiac myofilament dysfunction. Thus, the clinical heterogeneity of FHC in humans could be explained, in part, by a mechanism that involves a mutation-dependent effect on myofilament function. BLANCHARD, E. M. & SOLARO, R. J. (1984). Inhibition of the activation and troponin calcium binding of dog cardiac myofibrils by acidic ph. Circulation Research 55, BONNE, G., CARRIER, L., RICHARD, P., HAINQUE, B. & SCHWARTZ, K. (1998). Familial hypertrophic cardiomyopathy: from mutations to functional defects. Circulation Research 83, CHANDRA, M., KIM, J. J. & SOLARO, R. J. (1999a). An improved method for exchanging troponin subunits in detergent-skinned rat cardiac fibre bundles. Biochemical and Biophysical Research Communications 263, CHANDRA, M., MONTGOMERY, D. E., KIM, J. J. & SOLARO, R. J. (1999b). The N-terminal region of troponin T is essential for the maximal activation of rat cardiac myofilaments. Journal of Molecular and Cellular Cardiology 31, CHANDRA, M., RUNDELL, V. L., TARDIFF, J. C., LEINWAND, L. A., DE TOMBE, P. P. & SOLARO, R. J. (2001). Ca 2+ activation of myofilaments from transgenic mouse hearts expressing R92Q mutant cardiac troponin T. American Journal of Physiology Heart and Circulatory Physiology 280, H DE TOMBE, P. P. & STIENEN, G. J. (1995). Protein kinase A does not alter economy of force maintenance in skinned rat cardiac trabeculae. Circulation Research 76, FABIATO, A. & FABIATO, F. (1979). Use of chlorotetracycline fluorescence to demonstrate Ca 2+ -induced release of Ca 2+ from the sarcoplasmic reticulum of skinned cardiac cells. Nature 281, GARVEY, J. L., KRANIAS, E. G. & SOLARO, R. J. (1988). Phosphorylation of C-protein, troponin I and phospholamban in isolated rabbit hearts. Biochemical Journal 249, GEISTERFER-LOWRANCE, A. A., KASS, S., TANIGAWA, G., VOSBERG, H. P., MCKENNA, W., SEIDMAN, C. E. & SEIDMAN, J. G. (1990). A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation. Cell 62,

10 592 D. E. Montgomery, J. C. Tardiff and M. Chandra J. Physiol GODT, R. E. & LINDLEY, B. D. (1982). Influence of temperature upon contractile activation and isometric force production in mechanically skinned muscle fibres of the frog. Journal of General Physiology 80, GUO, X., WATTANAPERMPOOL, J., PALMITER, K. A., MURPHY, A. M. & SOLARO, R. J. (1994). Mutagenesis of cardiac troponin I. Role of the unique NH 2 -terminal peptide in myofilament activation. Journal of Biological Chemistry 269, HOMSHER, E., LEE, D. M., MORRIS, C., PAVLOV, D. & TOBACMAN, L. S. (2000). Regulation of force and unloaded sliding speed in single thin filaments: effects of regulatory proteins and calcium. Journal of Physiology 524, KENTISH, J. C., MCCLOSKEY, D. T., LAYLAND, J., PALMER, S., LEIDEN, J. M., MARTIN, A. F. & SOLARO, R. J. (2001). Phosphorylation of troponin I by protein kinase A accelerates relaxation and crossbridge cycle kinetics in mouse ventricular muscle. Circulation Research 88, KENTISH, J. C. & STIENEN, G. J. (1994). Differential effects of length on maximum force production and myofibrillar ATPase activity in rat skinned cardiac muscle. Journal of Physiology 475, MARON, B. J., BONOW, R. O., CANNON, R. O. III, LEON, M. B. & EPSTEIN, S. E. (1987). Hypertrophic cardiomyopathy. Interrelationships of clinical manifestations, pathophysiology, and therapy (2). New England Journal of Medicine 316, MONTGOMERY, D. E., CHANDRA, M., HUANG, Q., JIN, J.-P. & SOLARO, R. J. (2001). Transgenic incorporation of skeletal TnT into cardiac myofilaments blunts PKC-mediated depression of force. American Journal of Physiology 280, H MORIMOTO, S., YANAGA, F., MINAKAMI, R. & OHTSUKI, I. (1998). Ca 2+ -sensitizing effects of the mutations at Ile-79 and Arg-92 of troponin T in hypertrophic cardiomyopathy. American Journal of Physiology 275, C MUKHERJEA, P., TONG, L., SEIDMAN, J. G., SEIDMAN, C. E. & HITCHCOCK-DEGREGORI, S. E. (1999). Altered regulatory function of two familial hypertrophic cardiomyopathy troponin T mutants. Biochemistry 38, PAN, B. S. & JOHNSON, R. G. JR (1996). Interaction of cardiotonic thiadiazinone derivatives with cardiac troponin C. Journal of Biological Chemistry 271, REDWOOD, C., LOHMANN, K., BING, W., ESPOSITO, G. M., ELLIOTT, K., ABDULRAZZAK, H., KNOTT, A., PURCELL, I., MARSTON, S. & WATKINS, H. (2000). Investigation of a truncated cardiac troponin T that causes familial hypertrophic cardiomyopathy: Ca 2+ regulatory properties of reconstituted thin filaments depend on the ratio of mutant to wild-type protein. Circulation Research 86, RODRIGUEZ, E. K., HUNTER, W. C., ROYCE, M. J., LEPPO, M. K., DOUGLAS, A. S. & WEISMAN, H. F. (1992). A method to reconstruct myocardial sarcomere lengths and orientations at transmural sites in beating canine hearts. American Journal of Physiology 263, H RUST, E. M., ALBAYYA, F. P. & METZGER, J. M. (1999). Identification of a contractile deficit in adult cardiac myocytes expressing hypertrophic cardiomyopathy-associated mutant troponin T proteins. Journal of Clinical Investigation 103, SCHAUB, M. C., HEFTI, M. A., HARDER, B. A. & EPPENBERGER, H. M. (1997). Various hypertrophic stimuli induce distinct phenotypes in cardiomyocytes. Journal of Molecular Medicine 75, STIENEN, G. J. M., ZAREMBA, R. & ELZINGA, G. (1995). ATP utilization for calcium uptake and force production in skinned muscle fibres of Xenopus laevis. Journal of Physiology 482, SWEENEY, H. L., FENG, H. S., YANG, Z. & WATKINS, H. (1998). Functional analyses of troponin T mutations that cause hypertrophic cardiomyopathy: insights into disease pathogenesis and troponin function. Proceedings of the National Academy of Sciences of the USA 95, SZCZESNA, D., ZHANG, R., ZHAO, J., JONES, M. & POTTER, J. D. (1999). The role of the NH 2 - and COOH-terminal domains of the inhibitory region of troponin I in the regulation of skeletal muscle contraction. Journal of Biological Chemistry 274, TARDIFF, J. C., FACTOR, S. M., TOMPKINS, B. D., HEWETT, T. E., PALMER, B. M., MOORE, R. L., SCHWARTZ, S., ROBBINS, J. & LEINWAND, L. A. (1998). A truncated cardiac troponin T molecule in transgenic mice suggests multiple cellular mechanisms for familial hypertrophic cardiomyopathy. Journal of Clinical Investigation 101, TARDIFF, J. C., HEWETT, T. E., PALMER, B. M., OLSSON, C., FACTOR, S. M., MOORE, R. L., ROBBINS, J. & LEINWAND, L. A. (1999). Cardiac troponin T mutations result in allele-specific phenotypes in a mouse model for hypertrophic cardiomyopathy. Journal of Clinical Investigation 104, TOBACMAN, L. S., LIN, D., BUTTERS, C., LANDIS, C., BACK, N., PAVLOV, D. & HOMSHER, E. (1999). Functional consequences of troponin T mutations found in hypertrophic cardiomyopathy. Journal of Biological Chemistry 274, WATKINS, H., MCKENNA, W. J., THIERFELDER, L., SUK, H. J., ANAN, R., O DONOGHUE, A., SPIRITO, P., MATSUMORI, A., MORAVEC, C. S., SEIDMAN, J. G. & SEIDMAN, C. E. (1995). Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy. New England Journal of Medicine 332, WATKINS, H., SEIDMAN, C. E., SEIDMAN, J. G., FENG, H. S. & SWEENEY, H. L. (1996). Expression and functional assessment of a truncated cardiac troponin T that causes hypertrophic cardiomyopathy. Evidence for a dominant negative action. Journal of Clinical Investigation 98, ZHANG, R., ZHAO, J., MANDVENO, A. & POTTER, J. D. (1995). Cardiac troponin I phosphorylation increases the rate of cardiac muscle relaxation. Circulation Research 76, Acknowledgements We would like to thank especially Drs R. John Solaro, Pieter de Tombe and Leslie A. Leinwand for their helpful comments. Thanks also to Linda Alaniz-Avila for assistance with photography. This work was supported by a Grant-In-Aid from the American Heart Association of Metropolitan Chicago x (to M.C.). Corresponding author M. Chandra: Department of VCAPP, 205 Wegner Hall, Washington State University, Pullman, WA , USA. murali@vetmed.wsu.ed