Expression Cloning of noggin, a New Dorsalizing Factor Localized to the Spemann Organizer in Xenopus Embryos

Transcription

1 Cell, Vol. 70, September 4, 1992, Copyright by Cell Press Expression Cloning of noggin, a New Dorsalizing Factor Localized to the Spemann Organizer in Xenopus Embryos William C. Smith and Richard M. Harland Department of Molecular and Cell Biology Division of Biochemistry and Molecular Biology University of California, Berkeley Berkeley, California Summary We have cloned a cdna encoding a novel polypeptide capable of inducing dorsal development in Xenopus embryos. RNA transcripts from this clone rescue normal development when injected into ventralized embryos and result in excessive head development at high doses. Therefore, we have named the cdna noggin. noggin cdna contains a single reading frame encoding a 26 kd protein with a hydrophobic aminoterminal sequence, suggesting that it is secreted. In Northern blot analysis this cdna hybridizes to two mrnas that are expressed both maternally and zygotically. Although noggin transcript is not localized in the oocyte and cleavage stage embryo, zygotic transcripts are initially restricted to the presumptive dorsal mesoderm and reach their highest levels at the gastrula stage in the dorsal lip of the blastopore (Spemann organizer). In the neurula, noggin is transcribed in the notochord and prechordal mesoderm. The activity of exogenous noggin RNA in embryonic axis induction and the localized expression of endogenous noggin transcripts suggest that noggin plays a role in normal dorsal development. Introduction The development of the dorsal-ventral axis in vertebrates is thought to be controlled to a large extent by secreted inducing factors that are produced in a restricted part of the embryo and act at a distance. The initial event in dorsalventral patterning is a microtubule-directed rotation of the egg cortex (reviewed in Gerhart et al., 1989). The cortical rotation, which is completed before the first cleavage, modifies maternally deposited determinants of polarity (proteins or mrnas) on the future dorsal side of the embryo. Irradiation of the vegetal hemisphere of the newly fertilized Xenopus embryo with ultraviolet (UV) light disrupts the microtubule array, and cortical rotation no longer occurs. The resulting embryo develops only ventral structures. A normal bodyaxiscan be restored tosuch UV-irradiated embryos in a number of ways. If UV-irradiated embryos are tipped during the first cell cycle, the force of gravity on the yolky vegetal hemisphere induces a cortical rotation, and such embryos develop normally (Scharf and Gerhart, 1980). If dorsal vegetal blastomeres are transplanted into the irradiated embryo, an axis is restored (Gimlich and Gerhart, 1984). The ability to restore an axis to a ventralized embryo can be exploited to isolate molecules that participate in axis formation during vertebrate development. We observed that injection of poly(a)i RNA from hyperdorsalized gastrula stage embryos into UVtreated embryos could, at least partially, rescue dorsal development (Smith and Harland, 1991). We devised an assay for the expression cloning of molecules with axisinducing activity, and this resulted in the isolation of Xwnt-8 (Smith and Harland, 1991). The formation of a second body axis on the ventral side of normal embryos demonstrates an analogous inductive activity. Secondary axes can be produced both by physical manipulation of embryos and by the injection of any of three mrnas into ventral blastomeres at the early cleavage stages. Members of the wnt family (McMahon and Moon, 1989; Christian et al., 1991; Sokol et al., 1991) induce complete secondary axes; activin induces only a partial axis (Thomsen et al., 1990); and goosecoid induces duplicated axes that are often complete (Cho et al., 1991). The induction of an axis in UV-ventralized embryos, or the formation of a secondary axis in normal embryos, combined with lineage tracing to distinguish between the primary axis and the induced secondary axis, provides a rigorous assay for molecules that induce a new axis; this test has been used to show that wnt molecules, especially writ-7 and Xwnt-8, can induce an axis de novo (Sokol et al., 1991; Smith and Harland, 1991). However, several properties of Xwnf-8 indicate that it is not likely to be the endogenous axis-inducing activity. Not only is it expressed after presumptive dorsal axial tissue has formed, but it is expressed on the ventral side of the embryo (Christian et al., 1991; Smith and Harland, 1991). Furthermore, Xwnr-8 can be selectively depleted from the dorsalizing RNA population, with no effect on the rescuing ability of the RNA (Smith and Harland, 1991). We concluded that Xwnt-8 was not the major axis-rescuing component in the initial dorsalizing RNA population, and we rescreened the library to identify additional dorsalizing activities. Here we report the cloning of a second dorsalizing RNA, which we have named noggin. noggin has an activity very similar to that of Xwnt8, but has no apparent sequence similarity to any previously identified protein. We show that injected noggin mrna can promote formation of a vegetal dorsalizing center (the Nieuwkoop center, which induces dorsal mesoderm, but whose own cells populate the yolky endoderm). The presence of noggin mrna is consistent with it having a role in normal dorsal development as part of the early-acting Nieuwkoop center. Zygotic expression of noggin occurs at the correct time and place for it to participate in the functions of the later acting Spemann organizer, which induces neural tissue and dorsalizes ventral mesoderm. Results Expression Cloning of noggin cdna We previously described a cloning strategy for isolating cdnas with dorsalizing activity in Xenopus embryos. RNA

2 from dorsalized gastrulae (treated with LiCl during blastula stages) was size fractionated and the active fraction used to construct a plasmid cdna library. RNAs were synthesized from pools of plasmids and injected into ventralized embryos produced by UV treatment (Smith and Harland, 1991). Pools of plasmid DNA that directed the synthesis of dorsalizing RNA were sib selected until single active clones were isolated. In the first screen we isolated Xwnf-8, which was surprising since Xwnt-8 is down-regulated by LiCl treatment. We therefore reexamined the initial pools of 10,000 clones to ask whether Xwnt-8 was the only dorsalizing activity present. The 10 pools of 10,000 clones were analyzed by filter hybridization for the presence of Xwnt-8. The result is shown in Figure 1A. Xwnt-8 clones were present in the two active pools (8 and 9), as well as in five others. The retrospective analysis demonstrates that although Xwnr-8 is less abundant in RNA from dorsalized gastrulae, it is still an abundant mrna that is highly represented in the library. In the isolation of Xwnt-8 (Smith and Harland, 1991) pool 9 was selected for subsequent sib selections. The Xwnt-8 hybridization signal was weaker in pool 8 than in pool 9 and not much different from the inactive pools that contained Xwnf-8. To test whether pool 8 contained dorsalizing activities other than Xwnt-8, it was subdivided into 12 pools of 1000 clones. Five of the pools had activity in the rescue assay and three of these did not contain Xwnt-8. The Xwnt-b-negative pool with the strongest dorsal axisrescuing activity, pool 8.12, was further sib selected until a single active clone was isolated (clone A3 from pool A). The activity of the pools (i.e., the degree of dorsal axis rescued) increased as progressively smaller pools of clones were assayed. At the second sib selection of the library (pools of 1000 clones), A3 hybridizing clones could account for the activity of all dorsalizing pools that A. Pool: Activity: _ + _ - Xwnt-6-b Figure 1. Detection of Xwnf-8 and noggin Clones in Sib Selection Pools Five microgram samples of library plasmid DNA from the first (A) and second (6) sib selections (10,000 and 1,006 clones per pool, respectively) were digested with EcoRl and EcoRV, separated on 1% agarose gels, and transferred to nylon membranes. The membranes were hybridized with an Xwnt-8 probe alone (A) or first with Xwnt-8 and then with noggin probes (6). The activities of the various pools in the dorsal axis rescue assay are indicated (plus or minus). did not contain Xwnt-8 (Figure 16). One pool of 1000 clones (8.2) hybridized with the A3 probe but did not have activity in the assay (Figure 16). The reason for this is unknown, although it is possible that this particular A3 hybridizing clone was not functional. In addition, at this stage in the sib selection the active pools only conferred partial rescue of dorsal development, and pools with dorsalizing RNAs could have been missed. Finally, preliminary results indicate that at least one additional dorsalizing activity may be present in our library. RNA transcribed from Ncol linearized library plasmid DNA (rather than Notl linearized) retained axis-rescuing activity. Ncol cleaves within the 5 untranslated region of A3 and within the coding region of Xwnt-8 and yields truncated, nonfunctional transcripts. The completeness of Ncol cleavage of A3 and Xwnt-8 plasmids in the pool was confirmed by blotting (data not shown). noggin cdna Encodes a Novel Polypeptide The 1834 nt sequence of the A3 clone is shown in Figure 2A. The sequence contains a single long open reading frame encoding a 222 aa polypeptide with a predicted molecular size of 26 kd. At the amino terminus, a hydrophobic stretch of amino acids suggests that the polypeptide enters the secretory pathway (Figure 26). There is a single potential site for N-linked glycosylation (see the asterisk in Figure 2A). Extensive untranslated regions are located both 5 and 3 of the reading frame (594 and 573 bp, respectively). The 3 untranslated region is particularly rich in repeated da and dt nucleotides, and contains, in addition to a polyadenylation signal sequence located 24 bp upstream of the start of the poly(a) tail, a second potential polyadenylation sequence 147 bp further upstream (both are underlined in Figure 2A). In vitro translation of RNA synthesized from the A3 clone resulted in a protein product with the approximate molecular weight predicted by the open reading frame (data not shown). Comparison of the amino acid sequence of the predicted polypeptide to the National Center for Biotechnology Information BLAST network (nonredundant data base) did not identify any similar sequence. Clone A3 thus appears to encode a new type of protein that may be secreted and that has dorsal-inducing activity in Xenopus. noggin mrna Can Rescue a Complete Dorsal-Ventral Axis The new sequence, and its putative protein product, were named noggin based upon the phenotype resulting from mrna injection into ventralized embryos (see below). Injection of noggin RNA into a single blastomere of a 4-cell stage UV-ventralized embryo can restore the complete spectrum of dorsal structures. The degree of axis rescue was dependent upon the amount of RNA injected: the embryos that received low doses had only posterior dorsal structures, while embryos that received higher doses had excess dorsal-anterior tissue. RNA transcripts from two noggin plasmids were tested. The first (A3) contained the full cdna. The had a deletion removing the first 513 nt of the 5 untranslated region up to the EcoRl site (see Figure 2A). The results of injection of RNA

3 l noggin Rescues 831 Dorsal Development A -359:CGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCC~AGTTTCTTCTAGGA~AGATCGAGTCTCTGGTTA a GATCGAGCTGAAAGTGAAGAATATTTAAGAGAG NC0 I -239:ffiGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCACC~GGACTGT~GT~GffiTGAGCGCATT~AGACAGACAG~GCTCTGCTG~CTTCCACTTGACTGCGATGAGA~~G -119:GAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCA L2AAim TCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGAGC EC0 RI 41:ProLeuValA~pLe"I1eGluHlsProAspProIleTy~A~pP~~Ly~Gl"Ly~A~pL~"A~"Gl"Th~Le"Le~A~gTh~L~~~e~V~lGly~~~PheA~pP~~A~"Ph~~~~Al~T~~ 121:CCACTGGTGGACCTTATTGAGCACCCQ$.XCQC ATCTATGATCCCRAGGAGRAGGATCTTRACGAGACCTTGCCTTTATGGCCACC Ban HI 81:IleLeuProGl"GluArgLeuGlyValGlyValGluAspLeuGlyGluLeuAspLeuLeuLeuArgGlnLysProSerGlyAlaMetProAlaGluIleLysGlyLeuGluPheTyrGluGlyLeu 241:ATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTT~GGAGTTGGATCTCCTTCTTAGGCAG~GCCCTCGGGGGC~TGCCAGCGGA~TC~GGGACT~AGTTTTACGAGGGGCTT < :ArgTyrValLysValGlySerCysTyrSerLysArgSerCysSerValProGluGlyMetValCysLysAlaAlaLysSerMetH~sLeuThrIleLeuArgTrpArgCy~Gl"ArgArg 481:CGCTATGTGRAAGTAGGGAGCTGCTACAGT~GAGGTCTTGTTCTGTGCCAGAGGGCATGGTTTGC~AGCTGCC~GTCTATGCATTTGACCATCTT~GGT~AGATGTC~CGCAGG 201:"alGlnGlnLysCysAlaTrpIleThrIleGlnTyrP~~"~~~~~S~~Gl"Cy~Ly~Cy~Se~Cy~ 601:GTTCAGCAGAAGTGTGCGTGGATAACCATTCATTCAGTACCCTGTCATTTCCGAGTGC-TGCTCATGCTGAGACTCTTGGACT~TGC~GACAGTAGCTTCAT~TTC~ATG 721:TTATATGCACTGTAATATGTAGArZATGTATATGTGTGTATATATGGCATTGGTCTA~TTACTATT~~GGTCAGTATTATTCTTTT~TAACCAGTGTCTACTGTATTTCCAACACT.Hl"d III 841:ATTATCCTGGTTGTGTTTTATTTTAATAATATTATTATTATTATTTTTTTTTTGCCT~TGTATCTCTATTTATATCCA~ GAGCACTTCGCTTGGCGAAGCATTTTTTTTTAAAGAAA 961:-AAACAAATTTAATAGTTTAATAATATATAG~GCATTTTTTTCCTTTAATGG.~~TGTGCCTTTTTTTGATGGACCTC--~TG~~CCAGAGCAAGATAT~TTT 100 Amino Acid Number 200 Figure 2. Nucleotide Sequence of noggin cdna and Hydropathy Plot of Predicted noggin Polypeptide (A) Nucleotide sequence of noggin cdna. The complete nucleotide sequence and the predicted amino acid sequence encoded by noggin cdna are shown. A potential N-linked glycosylation site (asparagine at aminoacid number 81) is indicated by an asterisk. Potential polyadenylation sequences (AATAAA) are underlined. The 3 end of exonuclease clone 5.5, which was used as a template for RNAase protection assay, is underlined. (B) Hydropathy plot of predicted noggin polypeptide. The hydropathy of predicted noggin polypeptide was plotted by the method of Kyte and Doolittle (1982). transcripts of these two plasmids, as well as Xwnt-8 RNA, are summarized in Figure 3, where embryos were scored according to the dorsoanterior index (DAI) scale of Kao and Elinson (1988). In this scale a completely ventralized embryo is scored as 0, a normal embryo is scored as 5, and the most severely dorsoanteriorized embryos, those having radial dorsoanterior structures, are scored as 10. RNA synthesized from pnogginay(noggina5 mrna) repeatedly gave a higher DAI than the equivalent amount of mrna synthesized from the complete cdna. The phenotypes resulting from noggin mrna injection wereverysimilar, and perhaps identical, to those resulting from Xwnt-8 mrna injection. The dose dependency of axis rescue by noggina5 mrna was very similar to that of Xwnt-8 mrna (Figure 3). UV-treated embryos were also injected with a higher dose (1000 pg) of the noggin mrnas. Injection of this dose of noggin mrna into one blastomere at the 4-cell stage resulted in embryos with very severe hyperdorsalization (DAI > 7). However, these embryos were not included in the data presented in Figure 3 because most died at the late gastrula/early neurula stage. Apparently excessively strong gastrulation movements resulted in the thinning and rupture of the blastocoel roof. We have also observed this effect with high doses of injected Xwnt-8 mrna. Representative UV-treated embryos injected with increasing doses of either noggina5 or Xwnf-8 mrnas in one blastomere at the 4-cell stage are shown in Figure 4. The rescue of dorsal development by both nogginaband Xwnt-8 mrnas followed a consistent pattern in which increasing amounts of the mrnas lead to progressively more anterior structures being rescued. For example, embryos that received 1 pg of the RNAs had primarily the posterior and trunk dorsal structures rescued and for the most part lacked head structures. Higher doses (10 or 100 pg) of both of the RNAs resulted in embryos with more anterior development, and many had either nearly normal or hyperdorsalized phenotypes (Figure 4).

4 r I I I I 0 I IO 100 Pg RNA Figure 3. Dorsal Axis Rescue of Ventraked Embryos by noggin and Xwnt-8 RNAs Xenopus embryos were ventralized by exposure to UV light approximately 0.5 hr after fertilization. The embryos were then injected into one blastomere at the 4-cell stage with noggin RNA transcribed either from the full cdna (A3) or from a plasmid containing a truncation in the 5 untranslated region (noggina5 ). Other embryos were injected with Xwnt-8 RNA. The RNAs were injected at 1 to 100 pg in 10 nl of water. Control embryos were injected with water only. Embryos were grown until untreated embryosof the same age reached approximately stage 41. The degree of dorsoanterior development was scored according to the scale of Kao and Elinson (1988). The mean DAIS for 12 to 34 embryos at each RNA dose are plotted. Bars indicate the standard errors of the mean. noggin-injected Blastomeres Act as a Nieuwkoop Center noggin, Xwnt-8, and writ-7 mrnas all have the ability to restore dorsal axial development when injected into ventralized embryos (Smith and Harfand, 1991; Sokol et al., 1991; this study). We have shown previously that when Xwnf-8 mrna is injected into one vegetal blastomere of UV-treated embryos at the 32cell stage, dorsal structures are rescued (Smith and Harland, 1991). The descendants of the injected vegetal cells do not fate map to the rescued dorsal tissues, but rather to the endoderm. This result is consistent with earlier blastomere transplantation experiments in which the strongest source of the axis-inducing activity was found to be localized in dorsal vegetal cells (Gimlich and Gerhart, 1984; Gimlich, 1986; Kageura, 1990). Xwnt-8 mrnacould also rescue dorsal development when injected into marginal zone cells (in which case they did contribute progeny to rescued dorsal tissues), but not when injected into animal pole cells. The effect of varying the site of noggin mrna injection was investigated in a similar manner, and the results were similar to those observed for Xwnt-8. UV-treated embryos at the 32-cell stage were injected with either 0.5 ng of p-galactosidase mrna alone or 0.5 ng of f3-galactosidase mixed with 25 pg of noggina5 mrna, as described previously (Smith and Harland, 1991). Injection of noggin mrna into blastomeres of the vegetal pole (tier 4 blastomeres) gave the most strongly dorsoanteriorized embryos (Figure 5). Representative embryos, stained with X-gal to indicate the fates of the injected cells, are shown in Figure 6. In both of the vegetally injected embryos the nuclear X-gal staining was found almost exclusively in the endoderm (the mrna encodes a 6-galactosidase that translocates to the nucleus, allowing distinction from the diffuse background stain). One of the embryos shown was strongly hyperdorsalized (DAI = -7) as a result of the noggin mrna injection and has a severely truncated tail and enlarged head structures. Embryos were also rescued by noggin mrna injections into the marginal zone (blastomeres from tiers 2 and 3) (Figure 5). In these embryos 6-galactosidase staining was observed primarily in the axial and head mesoderm (Figure 6). As was observed previously with Xwnt-8, injection of noggin mrna into the animal pole (tier 1 blastomeres) had very little effect on axis formation (Figures 5 and 6). Likewise, 6-galactosidase mrna alone was without effect (Figure 5). noggin mrna Is Expressed Both Maternally and Zygotically In Northern blot analysis of RNA from Xenopus embryos, two noggin mrna species of approximate sizes 1.8 and 1.4 kb were observed (Figure 7). Figure 7A shows the results of probing blots containing approximately 2 ug of poly(a) RNA from the indicated stages with both noggin and c-src probes (c-src serves as a control for RNA loading; Hemmati-Brivanlou et al., 1991). A relatively low level of noggin mrna was detected in oocytes. By stage 11 the level of noggin mrna was significantly higher, reflecting zygotic transcription (as opposed to the maternally deposited transcripts seen in oocytes). noggin mrna remained at the elevated level up to the latest stage examined (stage 45). Based on previous results we expect the level of primary dorsalizing RNA in our library to be elevated in LiCI-treated embryos relative to normal or UV-treated embryos (Smith and Harland, 1991). Figure 78 shows the relative amount of noggin mrna in total RNA samples from stage 8 through 10 embryos that were either untreated, UV treated 30 min after fertilization, or treated with LiCl at the 32-cell stage. Lithium ion treatment resulted in a large increase in the amount of noggin mrna expressed, relative to untreated embryos. UV treatment had the opposite effect. noggin mrna expression was essentially undetectable in total RNA samples from these embryos. Thus, the abundance of noggin mrna in manipulated embryos parallels the rescuing activity. A simple model would predict that cytoplasm rotation results in localization of dorsalizing RNA on the prospective dorsal side of the embryo. We therefore analyzed the distribution of noggin mrna in oocytes and cleavage stage embryos. Since the amount of maternally deposited noggin RNA is too low for in situ hybridization to detect above background, we used an RNAase protection assay. Oocytes were dissected into animal and vegetal halves. No enrichment of noggin mrna was seen in either hemisphere relative to total oocyte RNA (Figure 8). Four-cell stage embryos were dissected into dorsal and ventral

5 noggin Rescues Dorsal Development 833 Control UV/no injection Xwnt-8 nogginas Figure 4. Ve ntralized Embryos Injected with noggin and Xwnr-8 RNAs Figure shows i representative ventralized embryos injected with noggina or Xwnf-8 R NAs. Xenopus embryos ventralized by UV irradiation before the first cleah rage were injected into one blastomere at the 4-cell stage with 1, 10, or 1 00 pg of either noggina5 or Xwnr-8 RNAs in a volume of IO nl. All embryr JS shown are the same age as the control embryos (approximately stage 41) which were not UV treated or injected. Also shown are noninjected I JV-treated embryos.

6 Cell F LacZ + noggin Figure 5. Dorsal Rescue of 32-Cell Embryos with noggin RNA Ventralized 32-cell stage embryos were coinjected with 25 pg of noggin and 0.5 ng of 6-galactosidase RNAs into a single blastomere in either the animal (tier l), marginal (tiers 2 and 3) or vegetal (tier 4) regions. Embryos were grown to about stage 25 and scored for dorsal axis rescue. halves, as well as animal and vegetal halves. noggin transcripts were found to be distributed evenly between dorsal and ventral hemispheres as well as animal and vegetal hemispheres (Figure 8). The same result (not shown) was Figure 6. Lineage Tracing of noggin-injected obtained with embryos that were tilted 90 immediately following fertilization and then marked with a vital dye on their uppermost side to indicate the future dorsal side (Peng, 1991). Older (32-cell stage) blastula embryos were also dissected into dorsal-ventral and animal-vegetal halves. No enrichment of noggin mrna in any of the hemispheres was seen relative to the total embryo (data not shown). In addition, UV treatment did not alter the abundance of maternally deposited noggin RNA, indicating no preferential degradation in ventral tissues (Figure 8). Samples with known amounts of in vitro synthesized noggin mrna were included in the RNAase protection assay (Figure 8). From these and other data we estimate that there is approximately0.1 pg of noggin mrna per blastula stage embryo and 1 pg per gastrula stage embryo. In Situ Hybridization; Zygotic Expression of noggin in the Spemann Organizer The localization of noggin transcripts in developing embryos was examined in greater detail using whole-mount in situ hybridization (Harland, 1991). Whole fixed embryos were hybridized with digoxigenin-containing RNA probes. Hybridized RNA probe was then visualized with an alkaline phosphatase-conjugated anti-digoxigenin antibody. The specificity of hybridization seen with antisense noggin probes was tested both by hybridizing embryos with sense Blastomeres Ventralized embryos (32~cell stage) were coinjected with 25 pg of noggin and 0.5 ng of 5-galactosidase RNAs. The embryos were then stained with X-gal at about stage 25. Diffuse background staining can be seen in the endoderm. Specific staining from injected f3-galactosidase RNA can be seen as darker and more discrete points of staining. Arrows indicate cement glands. Arrowheads indicate staining of lineage tracer.

7 noggin Rescues 835 Dorsal Development al 5 Stage A noggin c-src noggin c-src Control LiCl uv Figure 7. Expression of noggin RNA in Development (A) A Northern blot of poly(a) RNA from embryos of the indicated stages hybridized with both noggin and c-src probes. The amount of c-src hybridization controls for RNA loading differences between samples. (B) A Northern blot of total RNA from late blastula and early gastrula (stage E-10) embryos hybridized with noggin and C-WC probes to assess the effects of UV (ventralization) and LiCl (dorsalization) treatment on noggin RNA expression. noggin probes and by using two nonoverlapping antisense probes (data not shown). Owing to both the low level of expression and background staining, noggin mrna could not be detected unequivocally before the late blastula stage. The increased level of noggin mrna that was detected by Northern blot following activation of zygotic transcription (Figure 7) was apparent in in situ hybridization at stage 9 as a patch of staining cells on the dorsal side of the embryo. Viewed from the vegetal pole (Figure 9A), this patch of cells was restricted to a sector of about 60. A side view of the same embryo (Figure 96) shows that the staining cells were located within the marginal zone (i.e., between the animal and vegetal poles and within the presumptive dorsal mesoderm-forming region). As with other newly activated genes, transcripts are largely restricted to the nucleus at this stage (Smith and Harland, 1991; Frank and Harland, 1991). A side view of an early gastrula stage embryo (approximately stage 10.5) shows specific hybridization primarily noggin+ - EFla+ Figure 8. Distribution of Maternal noggin RNA in Oocytes and 4-Cell Stage Xenopus Embryos RNAase protection assay for noggin and EFlc in total RNA samples from dissected oocytes and 4-cell stage embryos. Also included in the assay is in vitro synthesized noggin RNA at the amounts indicated. c K in the involuting mesoderm at the dorsal lip (Figure 9C). A vegetal view of the same embryo (blastopore lip indicated with an arrowhead) shows that noggin mrna is most abundant on the dorsal side, but expression extends at a lower level to the ventral side of the embryo. For reasons that we do not understand, this method of in situ hybridization does not detect transcripts in the most yolky endodermal region of embryos (Frank and Harland, 1992; M. E. Bolce and R. M. H., unpublished data); therefore, we cannot rule out expression in more vegetal regions than those seen in the figure. Treatments that are known to affect the size of the dorsal lip (LiCI treatment, UV irradiation) had a profound effect on the pattern of noggin in situ hybridization. Figures 9D, 9E, and 9F show vegetal pole views of three stage 10.5 embryos either untreated, LiCl treated at stage 6, or UV treated at stage 1, respectively. In LiCItreated embryos the staining is intense throughout the marginal zone. UV treatment reduced the hybridization signal to undetectable levels. This result is consistent with amounts of noggin mrna seen by Northern blot analysis (see Figure 76). The UV-treated embryo also is a negative control for specificity of hybridization. Asgastrulation proceeds, noggin mrnastaining follows the involuting dorsal mesoderm and is highest in the presumptive notochord. By the late neurula stage (approximately 18) noggin mrna-expressing cells are clearest in the most dorsal mesoderm, primarily in the notochord, but also extend more anteriorly into the prechordal mesoderm (Figures 9G and 9H). The anterior tip of the notochord is indicated by an arrow. During tailbud stages, expression of noggin in the dorsal mesoderm declines, though expression in the notochord persists in the growing tailbud. Expression of noggin initiates at several new sites, which become progressively clearer as the tadpole matures. A discontinuous line of stained cells runs the length of the roof plate of the neural tube (Figures 9J and 91). Staining is also apparent in the head mesoderm, primarily in the mandibular and gill arches. We suspect that this expression corresponds to skeletogenic neural crest cells, since the same sites also express twist (Hopwood et al., 1989; R. M. H., unpublished data); furthermore, subsetsof these cells express homeobox genes that mark different anterior-posterior levels of the head neural crest; for example, En-2 in the mandibular arch is seen by antibody staining (Hemmati-Brivanlou et al., 1991) and in situ hybridization (R. M. H., unpublished data). Cells with stellate morphology stained for noggin mrna in the tail fin. These stellate cells are also likely to be derived from the neural crest. None of these patterns were seen with the sense probe or with a number of other probes (e.g., Xwnt-8). Discussion noggin, a Novel Polypeptide with Dorsalizing Activity in Xenopus Embryos Dorsal structures can be rescued in ventralized embryos by injection of mrna from dorsalized embryos. Using this assay we have isolated cdnas that, when transcribed into mrna and injected into the embryo, can rescue adorsally complete anterior-posterior axis. Previously, we isolated

8 Figure 9. noggin In Situ Hybridization Whole embryos were hybridized with antisense noggin RNA probes. Hybridization was visualized by an alkaline phosphatase Arrowheads in (C) and (D) indicate dorsal lip of the blastopore. (A) Stage 9, vegetal pole view. Staining restricted to wedge on dorsal side of embryo. (6) Stage 9, side view. Staining exclusively in dorsal marginal zone. (C) Stage 10.5, side view. Hybridizing cells found in dorsal lip of the blastopore. chromogenic reaction.

9 noggin Rescues Dorsal Development 837 Xwnt-8 (Smith and Harland, 1991); here we have described a novel gene that is equally effective in dorsal rescue. Members of the wnt family and noggin are the only two types of molecules known that have the ability to rescue complete dorsal development in ventralized embryos. Preliminary results indicate that at least one additional dorsalizing activity may be present in our library. However, the identities of any additional dorsalizing activities remain to be determined. Our preliminary experiments eliminated only the contributions from noggin and Xwnt-8 to the dorsalizing RNA transcribed from the library and did not exclude possible activities from other members of the wnt family or from noggin-related clones (if they exist). Although the results from the screening of our library clearly indicate that axis-rescuing activity is not restricted to only one type of molecule, the time and location of noggin expression suggest that it participates in the normal process of axis formation at blastula and gastrula stages. In addition, as would be expected for a molecule that is involved in cell-cell signaling, the noggin sequence prediets a secreted polypeptide. In contrast to Xwnt-8, noggin mrna is present both maternally and zygotically, and is present in tissues that are known to be sources of dorsalinducing factors. Although maternal noggin transcripts do not appear to be localized within the cleaving embryo, zygotic transcription is localized to the dorsal mesoderm. Zygotic transcripts are detected in the dorsal marginal zone; this tissue involutes as part of the dorsal lip of the blastopore and becomes the notochord and head mesoderm (prechordal plate). Thus, noggin is expressed in the Spemann organizer and its descendant cells. A spatially separate and later phase of noggin expression initiates after the pattern of the tadpole is established; in the swimming tadpole, noggin transcripts are found in the roof plate of the neural tube and in a variety of probable neural crest derivatives. (reviewed by Gerhart et al., 1989; Smith and Harland, 1991). Thus, noggin mrna is most effective at rescue when injected into vegetal blastomeres of the cleaving embryo, and lineage tracing confirms that injected vegetal blastomeres populate the endoderm of the rescued embryo. Because the injection can be shown to confer an early-acting rescue, these experiments do not address the possibility that noggin protein may also act later at the gastrula and neurula stages. The location of zygotic noggin expression suggests that it participates in activities of the Spemann organizer, namely, neural induction and dorsalization of ventral mesoderm. The development of the organizer is dependent upon zygotic transcription initiating after the midblastula transition. A number of other genes have recently been characterized that are specifically turned on in the organizer following the start of zygotic transcription, ineluding goosecoid (Blumberg et al., 1991; Cho et al., 1991), Xlim-7 (Taira et al., 1992), and XFK/-/l (Dirksen and Jamrich, 1992; Ruiz i Altaba and Jessel, 1992). In contrast to these genes, which all encode nuclear transcription factors, noggin encodes a secreted protein and could potentially mediate the inductive activitiesof the Spemann organizer. The later localization in the notochord suggests that noggin could be involved in induction of the floor plate of the neural tube (Yamada et al., 1991). In the tadpole, expression in the neural roof plate and neural crest suggests yet other trophic or differentiating activities. Production of recombinant noggin protein will allow us to address the question of whether responsiveness to noggin persists to the gastrula (or later) stages, and if so, how these older tissues respond to noggin treatment. Is noggin an Endogenous Inducer of Dorsal Development? noggin mrna is present throughout dorsal development and is expressed in tissues that have been identified by The Role of Zygotic noggin Transcripts dissection assourcesof inducing activity (i.e., dorsal vege- Because noggin was isolated from dorsalized gastrula tal cells in the blastula, dorsal lip in the gastrula, and noto- RNA (from LiCI-treated embryos), and because these em- chord in the neurula). We have demonstrated that exogebryos contain increased amounts of noggin transcript rela- nous noggin mrna has dorsalizing activity when injected tive to controls, it is not surprising that gastrula transcripts into cleavage stage embryos. Injected noggin mrna can are dorsally localized. However, injection assays into blas- substitute for the formation of the Nieuwkoop center in a tula embryos revealed dorsalizing activity of exogenous ventralized embryo, but it is not clear if endogenousnoggin noggin via the Nieuwkoop center, the early-acting source transcript performs the same role in normal development. of dorsal signals that resides in the vegetal hemisphere The amount of maternal noggin mrna is significantly (D) Stage 10.5, vegetal pole view. Staining is restricted primarily to the dorsal side of the embryo. Faint staining can also be seen extending around the lateral and ventral sides of the embryo. (E) Stage 10.5, LiCI-treated, vegetal pole view. Strong noggin hybridization encircles the embryo as a result of dorsalizing treatment (LiCI). (F) Stage 10.5, W-treated, vegetal pole view. Only background staining was detected in the ventralized embryo. The sharp circle is the outline of the blastocoel. (G) Stage 18, dorsal view. Detectable staining along dorsal midline in notochord and prechordal plate. The anterior end of the embryo is to the left. Arrow indicates the anterior limit of the notochord. (H) Stage 18, side view. Note the anterior extent of noggin expression (to the left). Staining cells extend beyond the anterior limit of the notochord into the presumptive head mesoderm. (I) stage 40, dorsal view. A line running along dorsal midline is stained as well as the mandibular and gill arches in the head, These appear as bilateral patches of stain anterior lo the eye (mandibular arch) and fingers of stain behind the eye. Staining in the lens and in the pharynx (between the eyes) is not specific. (J) Stage 40, side view. Broken line of staining dorsal cells extending along the anterior-posterior axis corresponds to the roof plate of neural tube. Staining can still be detected in the posterior tip of the notochord. The speckled appearance of the tailfin is due to stained stellate cells.

10 Cell 838 lower than the quantity needed for axis rescue of ventralized embryos by injection. However, translational or posttranslational control might normally enhance the activity of noggin protein on the dorsal side, so large amounts of transcript may need to be injected into ventralized embryos to overcome reduced activity. To test whether noggin is required for normal development, its expression or activity must be eliminated experimentally. We have demonstrated a correlation between ventralization of the embryo and elimination of zygotic noggin expression, but the amount of maternal mrna is unaffected in ventralized embryos, and noggin mrna is present in the ventral half of the cleaving embryo. Whether protein expression or activity is affected in ventral cells is not yet known. In principle, maternal noggin mrna can be eliminated by oligonucleotide-mediated RNAase H digestion and the effects on development monitored (Kloc et al., 1989). Our recent cloning of the mouse homolog of noggin (A. Huang, W. C. S., and R. M. H., unpublished data) will also facilitate genetic studies. Dorsal Mesodermal Patterning in Xenopus To date, mesoderm induction assays and axis-rescuing assays have identified different molecules. The mesoderm inducers include activin and fibroblast growth factor (FGF). Injection of FGF RNA has little effect on normal embryos (Kimelman and Maas, 1992) and activin mrna injection produces only partial axes (Thomsen et al., 1990; Sokol et al., 1991). Although a concentration gradient of mesoderm inducer could in principle account for dorsal-ventral differences (Green and Smith, 1990), the discovery of distinct axis-rescuing (dorsalizing) molecules suggests a different mechanism for patterning the mesoderm. While molecules like Xwnt-8 have no inherent mesoderm-inducing activity (Christian et al., 1992) they sensitize cells to mesoderm inducers; thus, the combination of a ventral mesoderm inducer, FGF, with cells expressing Xwnf-8 results synergistically in differentiation of dorsal mesoderm (Christian et al., 1992). In preliminary experiments, we observed that animal caps exposed to noggin formed very little, or no, mesoderm on their own. However, when combined with a low level of activin, the animal caps differentiated a large amount of dorsal mesoderm (A. Knecht and W. C. S., unpublished data). Therefore, wnt mrnas and noggin appear to have similar properties as dorsalizing factors that sensitize cells to mesoderm inducers. A requirement for the dorsalizing class of molecules in the embryo is also suggested by the observation that ventral animal cap tissue exposed to high concentrations of activin cannot form notochord or anterior neural tissues (Sokol and Melton, 1991; Bolce et al., 1992); in contrast, dorsally derived cells can respond to activin to form these structures. In the embryo the pattern of the mesoderm could be generated by a uniform distribution of mesoderm inducers in the marginal zone that is acted on by a local source of dorsalizing factor such as a wnt or noggin (reviewed by Kimelman et al., 1992). Experimental Procedures Production of Xenopus Embryos Xenopus embryos were prepared as described previously (Condie and Harland, 1967). Embryos were staged according to the table of Nieuwkoop and Faber (1967). Ventralized embryos were produced by UV irradiation with a Stratalinker (Stratagene), and dorsalized embryos were produced by treatment with LiCl (Smith and Harland, 1991). Isolation and Sequencing of noggin cdna The construction of the size-selected plasmid cdna library from stage 11 LiCI-treated embryos has been described previously (Smith and Harland, 1991). In vitro RNA synthesis, injection assay for dorsal axis rescue, and sib selections were also done as described previously (Smith and Harland, 1991). A slightly different protocol was used in plating bacteria for preparation of template plasmid DNAs from the sib-selected pools. As before, agarose plate cultures were used to prepare plasmid DNAs from pools of 100,000 to 1,000 clones per pool. This was done in order to ensure that particular clones did not become greatly overrepresented, as would be more likely in liquid cultures. However, for pools of 100 clones agarose plates with 100 colonies were first grown overnight. Replica plates with ten impressions from the original plates were then made, grown overnight, and used to prepare template DNA. Pools of ten were produced first by picking and growing small liquid cultures of the 100 individual colonies from the original plate of the active pool of 100 clones. These cultures were then pooled into ten pools of ten clones, while reserving some of each single clone for later expansion and assay. To test for the presence of Xwnf-8 or noggin sequences in library pools, 5 Kg of DNA from each pool was digested with EcoRl and EcoRV, which released the cdna inserts from the plasmid vector. Blots made from the samples after electrophoresis on a 1% agarose gel were hybridized with Xwnt-8 and noggin probes. The nucleotide sequence of both strands of the isolated noggin cdna clone was determined by the dideoxy termination method (Sanger et al., 1977) using modifiedt7 DNApolymerase(US Biochemical Company). Deletions were prepared in sequencing templates by both restriction enzyme and exonuclease Ill digestion (Henikoff, 1967). RNA Isolation and Analysis Total RNA was isolated from embryos and oocytes by a small-scale protocol described previously (Condie and Harland, 1967). Oocytes and blastula stage embryos were fixed in 96% ethanol plus 2% acetic acid prior to dissection. The dissected tissues were then rinsed twice in 100% ethanol before homogenization. Samples containing either the total RNA equivalent of 2.5 embryos or approximately 2 ug of poly(a) RNA were analyzed by Northern blotting as described previously (Smith and Harland, 1991; Condie and Harland, 1967). Random primed DNA probes were prepared from a 1323 bp fragment of noggin cdna from the EcoRl site at nucleotide -63 to an EcoRV site that lies in the vector immediately 3 to the end of the cdna. Other probes used in the present study (Xenopus c-sfc and EFla) have been described previously (Hemmati-Brivanlou et al., 1991; Krieg et al., 1969). RNAase protection assays were done using a protocol detailed previously (Melton et al., 1964) with minor modifications (C. Kintner, Salk Institute, La Jolla, CA). A noggin cdna exonuclease Ill deletion clone (clone 5.5, see Figure 2A) having a deletion from the S end to nucleofide 363 was used as a template for synthesizing RNA probes. The template DNA was linearized by EcoRl restriction enzyme digestion, and a 463 base antisense RNA incorporating =P was synthesized with T7 RNA polymerase. A 367 base antisense EFia RNA probe was used as a control for amount of RNA per sample (Krieg et al., 1969). Probes were gel purified prior to use. In Situ Hybridization The procedure described by Frank and Harland (1991) and detailed in Harland (1991) was used with minor modifications. After fixation and storage, the embryos were checked to ensure that the blastocoel and archenteron were punctured. Care was taken to puncture the residual

11 noggin Rescues Dorsal Development 839 blastocoel of neurulae and tadpoles as well as the archenteron. Embryos were rewashed at room temperature in 100% ethanol for 2 hr to remove residual lipid. After hybridization, staining was allowed to develop overnight and the embryos were then fixed in Bouin s, which stabilizes the stain better than MEMFA. Newly stained embryos have a high background of pink stain but most of this washes out, leaving the specific stain. Following overnight fixation, the embryos were washed well with 70% ethanol, 70% ethanol buffered with phosphatebuffered saline, and methanol. Embryos were cleared in Murray s mix and photographed with Kodak Ektar 25 film, using a Zeiss axioplan microscope (2.5 x or 5 x objective with 3 x 128 telescope to assist with focusing). Lineage Tracing Lineage tracing with mrna that encodes nuclear-localized &galactosidase has been described previously (Smith and Harland, 1991). Ventralized embryos were coinjected at the 32-cell stage with 0.5 ng of j3-galactosidase and 25 pg of noggina5 mrnas. Embryos were fixed and stained with X-gal at approximately stage 22. Acknowledgments We thank J. Gerhart, M. Dunaway, K. Anderson, and members of our lab fortheir critical reading of our manuscript. This work was supported by grants from the National Institutes of Health to R. M. H. and by a postdoctoral fellowship from the American Cancer Society to W. C. S. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 USC Section 1734 solely to indicate this fact. Received May 16, 1992; revised June 25, 1992 Blumberg, B., Wright, C. V. E., De Robertis, E. M., and Cho, K. W. Y. (1991). Organizer-specific homeobox genes in Xenopus laevis embryos. Nature 253, Bolce, M. E., Hemmati-Brivanlou, A., Kushner, P. D.. and Harland, R. M. (1992). Ventral ectoderm of Xenopusforms neural tissue, including hindbrain, in response to activin. Development Christian, J. L., McMahon, J. A., McMahon, A. P., and Moon, R. T. (1991). Xwnt-8, a Xenopus Writ-iAnt- related gene responsive to mesoderm inducing growth factors, may play a role in ventral mesodermal patterning during embryogenesis. Development 777, Christian, J. L., Olson, D. J.. and Moon, R. T. (1992). Xwnt-8 modifies the character of mesoderm induced by bfgf in isolated Xenopus ectoderm. EMBO J. 77, Cho, K. W. Y., Blumberg. B., Steinbeisser, H., and De Robertis, E. M. (1991). Molecular nature of Spemann s organizer: the role of the Xenopus homeobox gene goosecoid. Cell 67, 111 l-l 120. Condie, B. G., and Harland, R. M. (1987). Posterior expression of a homeobox gene in early Xenopus embryos. Development 707, Dirksen, M. L., and Jamrich, M. (1992). A novel, activininducible, blastopore lip-specific gene of Xenopus laevis contains a fork head DNA-binding domain. Genes Dev. 6, Frank, D., and Harland, R. M. (1991). Transient expression of XMyoD in non-somitic mesoderm of Xenopus gastrulae. Development 773, Frank, D., and Harland, R. M. (1992). Localized expression of axenopus POU gene depends on cell-autonomous transcriptional activation and induction-dependent inactivation. Development 7 75, Gerhart, J. C., Danilchik, M., Doniach, T., Roberts, S., Browning, B., and Stewart, R. (1989). Cortical rotation of the Xenopus egg: consequences for the anteroposterior pattern of embryonic dorsal development. Development (Suppl.) 707, Gimlich, R. L. (1986). Acquisition of developmental autonomy in the equatorial region of the XenopuS embryo. Dev. Biol. 775, Gimlich, R. L., and Gerhart, J. C. (1984). Early cellular interactions promote embryonic axis formation in Xenopus laevis. Dev. Biol. 704, Green, J. B. A., and Smith, J. C. (1990). Graded changes in dose of axenopus activin A homologue elicit stepwise transitions in embryonic cell fate. Nature 347, Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Meth. Cell Biol. 36, Hemmati-Brivanlou, A., de la Terre, J. R., Holt, C., and Harland, R. M. (1991). Cephalic expression and molecular characterization of Xenopus En-2. Development 7 77, Henikoff, S. (1987). Unidirectional digestion with exonuclease Ill in sequence analysis. Meth. Enzymol. 755, Hopwood, N. D., Pluck,A., andgurdon, J. B. (1989).AXenopus mrna related to Drosophila twist is expressed in response to induction in the mesoderm and the neural crest. Cell 59, Kageura, H. (1990). Spatial distribution of the capacity to initiate a secondary embryo in the 32-cell embryo of Xenopus laevis. Dev. Biol. 742, Kao, K. R., and Elinson, R. P. (1988). The entire mesodermal mantle behaves as Spemann s organizer in dorsoanterior enhanced Xenopus laevis embryos. Dev. Biol. 727, Kimelman, D., and Maas, A. (1992). Induction of dorsal and ventral mesoderm by ectopically expressed Xenopus basic fibroblast growth factor. Development 774, Kimelman, D., Christian, J., and Moon, R. T. (1992). Synergistic principles of development: overlapping patterning systems in Xenopus mesoderm induction. Development, in press. Kloc, M., Miller, M., Carrasco, A. E., Eastman, E., and Etkin, L. (1989). The maternal store of the xlgv7 mrna in full-grown oocytes is not required for normal development in Xenopus. Development 707, Krieg. P. A., Varnum, S. M., Wormington, W. M., and Melton, D. A. (1989). The mrna encoding elongation factor l-alpha (EF-1 alpha) is a major transcript at the midblastula transition in Xenopus. Dev. Biol. 733, Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 757, McMahon, A. P., and Moon, R. T. (1989). Ectopic expression of the proto-oncogene in&l in Xenopus embryos leads to duplication of the embryonic axis. Cell 58, Melton, D.A., Kreig, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K., and Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucl. Acids Res. 72, Nieuwkoop, P. D., and Faber, J. (1967). Normal Table of Xenopus laevis (Daudin) (Amsterdam: North Holland). Peng, H. B. (1991). Appendix A: solutions and protocols. Meth. Cell Biol. 36, 661. Ruiz i Altaba, A., and Jessel, T. (1992). Pintallavis, a gene expressed in the organizer region and midline cells of frog embryos: involvement in the development of the neural axis. Development, in press. Sanger, F., Nicklen, S., and Coulson, A. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, Scharf, S. R., and Gerhart, J. C. (1980). Determination of the dorsalventral axis in eggs of Xenopus laevis: complete rescue of uv-impaired eggs by oblique orientation before first cleavage. Dev. Biol. 79, Smith, W. C., and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of avegetal dorsalizing center. Cell 67, Sokol, S., and Melton, D. A. (1991). Pre-existent pattern in Xenopus animal pole cells revealed by induction with activin. Nature 357, Sokol, S., Christian, J. L., Moon, R. T., and Melton, D. A. (1991).