Genome-wide analysis of TNF-alpha response in pigs challenged with porcine circovirus 2b
|
|
- Douglas Baker
- 6 years ago
- Views:
Transcription
1 University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Papers and Publications in Animal Science Animal Science Department Genome-wide analysis of TNF-alpha response in pigs challenged with porcine circovirus 2b C. A. Kreikemeier University of Nebraska-Lincoln T. B. University of Nebraska-Lincoln K. L. Lucot University of Nebraska-Lincoln Thomas E. Burkey University of Nebraska-Lincoln, tburkey2@unl.edu Daniel C. Ciobanu University of Nebraska-Lincoln, dciobanu2@unl.edu Follow this and additional works at: Part of the Genetics and Genomics Commons, and the Meat Science Commons Kreikemeier, C. A.; T. B.; Lucot, K. L.; Burkey, Thomas E.; and Ciobanu, Daniel C., "Genome-wide analysis of TNF-alpha response in pigs challenged with porcine circovirus 2b" (2015). Faculty Papers and Publications in Animal Science This Article is brought to you for free and open access by the Animal Science Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Papers and Publications in Animal Science by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln.
2 Published in Animal Genetics 46:2 (April 2015), pp doi: /age Copyright 2015 Stichting International Foundation for Animal Genetics; published by John Wiley & Sons. Used by permission. Accepted for publication 14 November digitalcommons.unl.edu Genome-wide analysis of TNF-alpha response in pigs challenged with porcine circovirus 2b C. A. Kreikemeier, T. B. Engle, K. L. Lucot, S. D. Kachman, T. E. Burkey and D. C. Ciobanu Animal Science Department, University of Nebraska Lincoln, Lincoln, NE 68583, USA. Corresponding author D. C. Ciobanu, Animal Science Department, University of Nebraska Lincoln, Lincoln, NE , USA; Abstract Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine with a role in activating adaptive immunity to viral infections. By inhibiting the capacity of plasmacytoid dendritic cells to produce interferon-α and TNF-α, porcine circovirus 2 (PCV2) limits the maturation of myeloid dendritic cells and impairs their ability to recognize viral and bacterial antigens. Previously, we reported QTL for viremia and immune response in PCV2- infected pigs. In this study, we analyzed phenotypic and genetic relationships between TNFα protein levels, a potential indicator of predisposition to PCV2 co-infection, and PCV2 susceptibility. Following experimental challenge with PCV2b, TNF-α reached the peak at 21 days post-infection (dpi), at which time a difference was observed between pigs that expressed extreme variation in viremia and growth (P < 0.10). A genome-wide association study (n = 297) revealed that genotypes of SNPs explained 73.9% of the variation in TNF-α at 21 dpi. Major SNPs were identified on SSC8, SSC10 and SSC14. Haplotypes based on SNPs from a SSC8 (9 Mb) 1-Mb window were associated with variation in TNF-α (P < 0.02), IgG (P = 0.05) and IgM (P < 0.13) levels at 21 dpi. Potential overlap of regulatory mechanisms was supported by the correlations between genomic prediction values of TNF-α and PCV2 antibodies (21 dpi, r > 0.22), viremia (14 21 dpi, P > 0.29) and viral load (r = 0.31, P < ). Characterization of the QTL regions uncovered genes that could influence variation in TNF-α levels as well as T- and B-cell development, which can affect disease susceptibility. Keywords: immunity, porcine circovirus 2, swine, tumor necrosis factor alpha Porcine circovirus 2 (PCV2) is the primary cause of a group of associated diseases (PCVAD) that includes postweaning multisystemic wasting syndrome (PMWS), characterized by severe weight loss, jaundice, dyspnea, diarrhea, lymphadenopathy and interstitial pneumonia (Carman et al. 2008). In natural outbreaks, 99% of the PMWS cases are the result of PCV2 co-infection with other pathogens such as porcine reproductive and respiratory syndrome virus (PRRSV), Mycoplasma hyopneumoniae, influenza or parvovirus. PCV2 infection of cells involved in the innate defense impairs the recognition of viral and bacterial antigens and favors secondary infections (Vincent et al. 2005, 2007). Specifically, PCV2 reduces the capacity of plasmacytoid dendritic cells to induce interferon-α and tumor necrosis factor alpha (TNF-α), limiting the maturation of associated myeloid dendritic cells. TNF-α is an innate pro-inflammatory cytokine with a role in activating adaptive immunity to viral challenges (Trevejo et al. 2001). Variation in TNF-α following PCV2 infection could affect the ability of innate host defense to trigger the adaptive response, clear the pathogen and respond to secondary infections. We showed recently that highdensity SNP genotypes influence variation in viremia (40 61%) and immune response (10 60%) in a population of crossbred pigs (n = 384) experimentally infected with PCV2b (McKnite et al. 2014). One of the major QTL regions that influenced viremia was mapped on SSC7 from 29 to 34 Mb, overlapping the SLAII complex of genes and also close to the location of the TNF gene (27.6 Mb). Taking into account the potential role of TNF-α, directly or indirectly, in the activation of immune response following PCV2 infection, in this study we explored the genetic factors that modulate protein expression of TNF-α and estimate phenotypic and genetic relationships with PCV2 viremia and specific immune response. We hypothesized that TNF-α could represent a potential indicator of predisposition to co-infection in PCV2-infected pigs. 205
3 206 Kreikemeier et al. in Animal Genetics 46 (2015) Experimental infection with a PCV2b strain was initiated at 43 days of age. The pigs were infected intranasally and intramuscularly with a titer of TCID50/ ml as described in McKnite et al. (2014); average daily gain (ADG), PCV2-specific antibodies (IgM and IgG) and viremia were measured at 0, 7, 14, 21 and 28 days postinfection (dpi). PCV2-specific antibodies were measured using ELISA (Ingenasa) and viremia was measured by real-time quantitative PCR (McKnite et al. 2014). Viral load was calculated as the area under the curve based on viremia profiled over time. High-density genotypes were obtained using the Porcine 60K SNP BeadArray (Illumina). The genome-wide association study (GWAS) included SNPs and was performed using a Bayes B model (Kizilkaya et al. 2010) with litter, pen and batch as class variables and passive IgG and age at infection as covariates. The protein serum level of TNF-α was quantified initially in pigs expressing high viral load and low ADG (n = 6) and low viral load and high ADG (n = 6) using ELISA (R&D Systems). A slight increase in TNF-α level was observed over time, reaching the peak at 21 dpi, where a difference was shown between the two groups (P < 0.1) (Fig. 1). At this time point, the rest of the resource population was profiled for TNF-α (n = 297). The increase in TNF-α level during viremic states may be characteristic of PCV2; previous studies showed a slight, non-significant increase in TNF-α level in swine influenza virus infections and inhibition of TNF-α expression to evade immune response in PRRSV infections (Murtaugh et al. 2002; Khatri et al. 2010). Chronic overexpression or inhibition of TNF-α has been shown to be involved in the pathogenesis of several diseases (Clancy et al. 2004; Mc- Cullough et al. 2009). Pairwise correlations between TNF-α at 21 dpi, viremia and antibody profile across time points were based on residuals obtained from a model that included batch as a fixed effect, litter and pen as random, and age at infection and level of passive IgG as covariates. TNF-α level was positively correlated with viral load (r = 0.25) and with viremia during the last 3 weeks of the challenge (r = ) (P < , Table 1). The relationship between TNFα (21 dpi) and PCV2-specific antibodies was detected following their surge, starting at 14 dpi for IgM (r = ) and at 21 dpi for IgG (r = 0.17) (P < 0.005). Small negative estimates were obtained between TNF-α and overall ADG (r = 0.15) and also with weekly ADG, with the largest estimate observed during the last week of challenge (r = 0.17) (P < 0.01). Table 1. Phenotypic and genomic correlations between TNF-α levels at 21 days post-infection (dpi) and indicator traits of PCVAD susceptibility following an experimental infection with PCV2b. Correlations with TNF-α (log 10) Traits Phenotypic Genomic Viral load 0.248** 0.319** Viremia 7 dpi Viremia 14 dpi 0.273** 0.315** Viremia 21 dpi 0.15* 0.276** Viremia 28 dpi 0.231** IgM 7 dpi IgM 14 dpi 0.199** IgM 21 dpi 0.284** 0.302** IgM 28 dpi 0.338** 0.433** IgG 7 dpi 0.19** 0.260** IgG 14 dpi 0.254** 0.198** IgG 21 dpi 0.19** 0.226** IgG 28 dpi 0.11* 0.225** ADG 0 to 28 days 0.157* 0.137* ADG week ADG week ADG week * ADG week * Significance of the correlation estimates: * P < 0.05 ; ** P < Figure 1. Means and standard errors of TNF-α levels in pigs expressing high viral load and low ADG (HL) and low viral load and high ADG (LH) following an experimental infection with PCV2b.
4 TNF-alpha response in pigs with porcine circovirus 2b 207 Figure 2. Genome-wide association study between 56,33 SNPs and TNF-α at 21 days post-infection (dpi) following an experimental infection with PCV2b. Each dot represents the proportion of genetic variance explained by an individual SNP. The x-axis represents the position of each SNP in the swine genome based on build 10.2 of the reference swine genome. The y-axis represents the contribution of each SNP to the genetic variance. Alternate colors represent autosomes, from SSC1 to 18, and chromosome X followed by a set of SNPs without a precise location. Combined genotypes of the SNPs explained 73.9% of the phenotypic variation in TNF-α. Although the proportion of the variation explained by SNPs is substantial, none of the mapped regions explained the majority of the effect. Regions characterized by clusters of SNPs associated with major effects were mapped on build 10.2 of the reference swine genome on SSC8 (9 Mb), SSC10 (73 Mb) and SSC14 (120 and 127 Mb) (Fig. 2). Functional characterization of the genes located in these regions uncovered potential candidates that modulate variation in TNF-α levels. Two transcription factors, KLF6 (SSC10, 73 Mb) and NKX3 (SSC8, 8.7 Mb), are involved in immune system development, with KLF6 specifically involved in B-cell development and differentiation ( Absence of a major association at the TNF locus (SSC7, 27 Mb) indicated a trans-modulation mechanism that influenced its variation in response to PCV2 infection. A 1-Mb window located at the proximal end of SSC8 (9 Mb) explained the largest additive genetic variation of TNF-α (1.27%), having a model frequency of 40%, although the variation explained by this window was not significantly greater than the average (P < 0.33) (Table S1). SNP ASGA (SSC8, 9.4 Mb), located in this window, was associated with the largest genetic variance. Genotype AA was associated with highest level of TNF-α (1.44 pg/ml) compared to AG (1.37 pg/ ml, P < 0.18) and GG genotypes (1.28 pg/ml, P < 0.05). Potential overlap of the genetic control or pathways that influence the variation of multiple traits in response to infection were evidenced by correlations between genomic prediction values of TNF-α and IgM (r > 0.30) and IgG (r > 0.22) from 21 dpi, viremia from 14 to 21 dpi (P > 0.27) and viral load (r = 0.32) (P < ) (Table 1). The 1-Mb window located on SSC8 (9 Mb) ranked in the top 2% in the GWAS with IgG at 21 dpi and with IgM at 21 and 28 dpi (McKnite et al. 2014). Haplotypes of the top four SNPs in the respective window on SSC8, including ASGA , MARC , MARC and MARC , were associated with variation in IgG (P = 0.05) and IgM (P < 0.15) at 21 dpi. Haplotype 4, the only haplotype that carries the G allele from ASGA and the A allele from MARC , was associated with the lowest substitution effect for IgG (P < 0.10), IgM (P < 0.25) and TNF-α (P < 0.02) at 21 dpi (Table S2). Haplotype 2, which varies from haplotype 4 across all four sites and from haplotypes 1 (MARC ) and 3 (MARC ) at a single site, was associated with the highest substitution effect and was significantly different from the average for both PCV2 antibodies at 21 dpi (P < 0.05). No significant relationships were detected between haplotypes and measures of viremia. One of the SNPs (ASGA , SSC9, 0.70 Mb) that captured the negative relationship between viral load and ADG, reported by McKnite et al. (2014), was also associated with variation in TNF-α (P < 0.05). The AA genotype was associated with lower levels of TNF-α (P < 0.05), lower viral load (P < 0.01) and higher ADG (P < 0.10) compared to the GG genotype. These results suggest that individuals with a genetic profile that expressed high viral load during challenge experienced reduced growth, high IgM and IgG response (McKnite et al. 2014) and high levels of TNF-α. Based on previous reports (Murtaugh et al. 2002), a lower or lack of TNF-α surge is not desired due to the ability of the certain pathogens (e.g., PRRSV) to trigger an effective immune response. Future functional characterization of genomic regions that influence variation in TNF-α could lead to better understanding of T- and B-cell development, immune response and the ability of the host to reduce viral replication and susceptibility to PCV2-associated diseases including secondary infections.
5 208 Kreikemeier et al. in Animal Genetics 46 (2015) Acknowledgments This work was supported by a Strategic Investment Program Grant from University of Nebraska-Lincoln and by Merial s Veterinary Summer Scholar Research Program. References Carman S., Cai H.Y., Delay J. et al. (2008) The emergence of a new strain of porcine circovirus-2 in Ontario and Quebec swine and its association with severe porcine circovirus associated disease Canadian Journal of Veterinary Research (Revue Canadienne de Recherche Veterinaire), 72, Clancy R.M., Backer C.B., Yin X., Chang M.W., Cohen S.R., Lee L.A. & Buyon J.P. (2004) Genetic association of cutaneous neonatal lupus with HLA class II and tumor necrosis factor alpha: implications for pathogenesis. Arthritis and Rheumatism, 50, Khatri M., Dwivedi V., Krakowka S., Manickam C., Ali A., Wang L., Qin Z., Renukaradhya G.J. & Lee C.W. (2010) Swine influenza H1N1 virus induces acute inflammatory immune responses in pig lungs: a potential animal model for human H1N1 influenza virus. Journal of Virology, 84, Kizilkaya K., Fernando R. L. & Garrick D. J. (2010) Genomic prediction of simulated multibreed and purebred performance using observed fifty thousand single nucleotide polymorphism genotypes. Journal of Animal Science, 88, McCullough K.C., Ruggli N. & Summerfield A. (2009) Dendritic cells at the front-line of pathogen attack. Veterinary Immunology and Immunopathology, 128, McKnite A.M., Bundy J.W., Moural T.M. et al. (2014) Genomic analysis of the differential response to experimental infection with porcine circovirus 2b. Animal Genetics, 45, Murtaugh M.P., Xiao Z. & Zuckermann F. (2002) Immunological responses of swine to porcine reproductive and respiratory syndrome virus infection. Viral Immunology, 15, Trevejo J.M., Marino M.W., Philpott N., Josien R., Richards E.C., Elkon K.B. & Falck-Pedersen E. (2001) TNF-alpha-dependent maturation of local dendritic cells is critical for activating the adaptive immune response to virus infection. Proceedings of the National Academy of Sciences of the United States of America, 98, Vincent I.E., Carrasco C.P., Guzylack-Piriou L., Herrmann B., Mcneilly F., Allan G.M., Summerfield A. & Mccullough K.C. (2005) Subsetdependent modulation of dendritic cell activity by circovirus type 2. Immunology, 115, Vincent I.E., Balmelli C., Meehan B., Allan G., Summerfield A. & Mccullough K.C. (2007) Silencing of natural interferon producing cell activation by porcine circovirus type 2 DNA. Immunology, 120, I Supporting information Additional supporting information follows. Table S1. GWAS between 1 Mb genome windows and TNFα at 21 dpi following an experimental infection with PCV2b. (75 pages) Table S2. Haplotype substitution effects for TNF-α (21 dpi), PCV2-specific antibodies and viremia based on SNPs ASGA , MARC , MARC and MARC located on SSC8 (9 10 Mb). (1 page)
6 Table S1. GWAS between 1 Mb genome windows and TNF-α at 21 dpi following an experimental infection with PCV2b. Window start end #SNPs %Var Cum%Var p>0 p>average map_pos0 map_posn chr_mb var(ghat) corr regr _0 21_0 21_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
7 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
8 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
9 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
10 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
11 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
12 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
13 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
14 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
15 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
16 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Genome Analysis In Domestic Animals By H. Geldermann
Genome Analysis In Domestic Animals By H. Geldermann If you are searched for the ebook by H. Geldermann Genome Analysis in Domestic Animals in pdf form, then you've come to faithful website. We furnish
More informationNK cells are part of the innate immune response. Early response to injury and infection
NK cells are part of the innate immune response Early response to injury and infection Functions: Natural Killer (NK) Cells. Cytolysis: killing infected or damaged cells 2. Cytokine production: IFNγ, GM-CSF,
More informationSummer Work Biology. 1. If the sperm of a horse has 32 chromosomes, how many chromosomes will its body cells have? a. 16 c. 2 b. 64 d.
Summer Work Biology Week One: A. Write the correct answer(s). 1. If the sperm of a horse has 32 chromosomes, how many chromosomes will its body cells have? a. 16 c. 2 b. 64 d. 62 2. Which of the following
More informationPedigree and genomic evaluation of pigs using a terminal cross model
66 th EAAP Annual Meeting Warsaw, Poland Pedigree and genomic evaluation of pigs using a terminal cross model Tusell, L., Gilbert, H., Riquet, J., Mercat, M.J., Legarra, A., Larzul, C. Project funded by:
More informationWhat is the structure of DNA?
NAME Biology Final Review Sem. II Genetics 1. Define: a. allele b. phenotype c. genotype d. recessive e. dominant f. heterozygous g. homozygous h. autosomes i. sex chromosomes j. Punnett square k. pedigree
More informationBangor School Department Grade 7 Science
Bangor School Department Grade 7 Science Teacher: School: NOTE: This record of assessments must be submitted to the Assistant Superintendent s Office by end of the school year. Date: 4 = Exceeds 3 = Meets
More informationBIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
More informationAssociation Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5
Association Testing with Quantitative Traits: Common and Rare Variants Timothy Thornton and Katie Kerr Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 1 / 41 Introduction to Quantitative
More informationApproved Courses for General Science students with Major/Minors in Biological Sciences
Approved Courses for General Science students with Major/Minors in Biological Sciences List C: Physiology, cell and developmental biology BIOIN 301 Bioinformatics. * (fi 6) (first term, 3-0-0). Introduction
More informationClassical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
More informationGenotype Imputation. Biostatistics 666
Genotype Imputation Biostatistics 666 Previously Hidden Markov Models for Relative Pairs Linkage analysis using affected sibling pairs Estimation of pairwise relationships Identity-by-Descent Relatives
More informationCRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping
Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing
More informationRégression en grande dimension et épistasie par blocs pour les études d association
Régression en grande dimension et épistasie par blocs pour les études d association V. Stanislas, C. Dalmasso, C. Ambroise Laboratoire de Mathématiques et Modélisation d Évry "Statistique et Génome" 1
More informationAP Biology Essential Knowledge Cards BIG IDEA 1
AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific
More information(Genome-wide) association analysis
(Genome-wide) association analysis 1 Key concepts Mapping QTL by association relies on linkage disequilibrium in the population; LD can be caused by close linkage between a QTL and marker (= good) or by
More informationMichigan State University Diagnostic Center for Population and Animal Health, Lansing MI USA. QIAGEN Leipzig GmbH, Leipzig, Germany
Detection of Bovine Viral Diarrhea (BVD) Virus in Ear Skin Tissue Samples: Evaluation of a Combination of QIAGEN MagAttract 96 cador Pathogen Extraction and virotype BVDV RT-PCR-based Amplification. Roger
More informationGENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.
!! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms
More informationLooking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationProportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power
Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationQuantitative characters - exercises
Quantitative characters - exercises 1. a) Calculate the genetic covariance between half sibs, expressed in the ij notation (Cockerham's notation), when up to loci are considered. b) Calculate the genetic
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationChapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
More information25 : Graphical induced structured input/output models
10-708: Probabilistic Graphical Models 10-708, Spring 2016 25 : Graphical induced structured input/output models Lecturer: Eric P. Xing Scribes: Raied Aljadaany, Shi Zong, Chenchen Zhu Disclaimer: A large
More informationMap of AP-Aligned Bio-Rad Kits with Learning Objectives
Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation
More informationM e a n. F l u o r e s c e n c e I n t e n s i t y P r o t e i n ( p g / m L )
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0. 0. 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 P r o t e i n ( p g / m L ) 0. 0. 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 P r o t e i n ( p g / m L ) Figure. Representative
More informationLecture 2: Genetic Association Testing with Quantitative Traits. Summer Institute in Statistical Genetics 2017
Lecture 2: Genetic Association Testing with Quantitative Traits Instructors: Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2017 1 / 29 Introduction to Quantitative Trait Mapping
More informationBig Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes.
Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Enduring understanding 3.A: Heritable information provides for continuity of life. Essential
More informationUnit 2 Benchmark Review. Disease Review:
Match the term with the definition: Unit 2 Benchmark Review Disease Review: 1. Caused by tiny organisms called pathogens B 2. This is responsible for distinguishing between the different kinds of pathogens
More informationActivation of STING with Synthetic Cyclic Dinucleotides and Synergy with Checkpoint Inhibition
Activation of STING with Synthetic Cyclic Dinucleotides and Synergy with Checkpoint Inhibition Sarah McWhirter, PhD Director, STING Program Aduro Biotech ICI Boston 2017 Presentation 1 Disclosures Sarah
More informationIntroduction - Life Science
CALIFORNIA STANDARDS TEST G R A D E Released Test Questions Science 10 Introduction - Life Science The following released test questions are taken from the Life Science Standards Test. This test is one
More informationLeptospira: The disease and its diagnosis.
Leptospira: The disease and its diagnosis. Julie Collins-Emerson Lepto forum 06 March 2017 http://r6kbio.wikia.com/wiki/leptospira_interrogans Are bacteria Leptospira Most mammals can be infected A number
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationCalifornia Subject Examinations for Teachers
California Subject Examinations for Teachers TEST GUIDE SCIENCE SUBTEST II: LIFE SCIENCES Subtest Description This document contains the Life Sciences subject matter requirements arranged according to
More informationBig Idea 1: The process of evolution drives the diversity and unity of life.
Big Idea 1: The process of evolution drives the diversity and unity of life. understanding 1.A: Change in the genetic makeup of a population over time is evolution. 1.A.1: Natural selection is a major
More informationAP Curriculum Framework with Learning Objectives
Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over
More informationBiology 8 Learning Outcomes
Biology 8 Learning Outcomes CELLS (Bio 8-1) I can connect the names, diagrams, and functions of organelles in a cell I know the major differences between plant and animal cells I can explain cell theory
More informationINTRODUCTION TO ANIMAL BREEDING. Lecture Nr 2. Genetics of quantitative (multifactorial) traits What is known about such traits How they are modeled
INTRODUCTION TO ANIMAL BREEDING Lecture Nr 2 Genetics of quantitative (multifactorial) traits What is known about such traits How they are modeled Etienne Verrier INA Paris-Grignon, Animal Sciences Department
More informationCHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
More informationChetek-Weyerhaeuser Middle School
Chetek-Weyerhaeuser Middle School Science 7 Units and s Science 7A Unit 1 Nature of Science Scientific Explanations (12 days) s 1. I can make an informed decision using a scientific decision-making model
More informationUNIT 8 BIOLOGY: Meiosis and Heredity Page 148
UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 CP: CHAPTER 6, Sections 1-6; CHAPTER 7, Sections 1-4; HN: CHAPTER 11, Section 1-5 Standard B-4: The student will demonstrate an understanding of the molecular
More informationHeterogeneous shedding of influenza by human subjects and. its implications for epidemiology and control
1 2 3 4 5 6 7 8 9 10 11 Heterogeneous shedding of influenza by human subjects and its implications for epidemiology and control Laetitia Canini 1*, Mark EJ Woolhouse 1, Taronna R. Maines 2, Fabrice Carrat
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationValley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)
Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education
More informationProbability of Detecting Disease-Associated SNPs in Case-Control Genome-Wide Association Studies
Probability of Detecting Disease-Associated SNPs in Case-Control Genome-Wide Association Studies Ruth Pfeiffer, Ph.D. Mitchell Gail Biostatistics Branch Division of Cancer Epidemiology&Genetics National
More informationMultivariate analysis of genetic data: an introduction
Multivariate analysis of genetic data: an introduction Thibaut Jombart MRC Centre for Outbreak Analysis and Modelling Imperial College London XXIV Simposio Internacional De Estadística Bogotá, 25th July
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More information(Write your name on every page. One point will be deducted for every page without your name!)
POPULATION GENETICS AND MICROEVOLUTIONARY THEORY FINAL EXAMINATION (Write your name on every page. One point will be deducted for every page without your name!) 1. Briefly define (5 points each): a) Average
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationAP Biology Curriculum Framework
AP Biology Curriculum Framework This chart correlates the College Board s Advanced Placement Biology Curriculum Framework to the corresponding chapters and Key Concept numbers in Campbell BIOLOGY IN FOCUS,
More informationQTL Model Search. Brian S. Yandell, UW-Madison January 2017
QTL Model Search Brian S. Yandell, UW-Madison January 2017 evolution of QTL models original ideas focused on rare & costly markers models & methods refined as technology advanced single marker regression
More informationCST and FINAL EXAM REVIEW
Name Date Period CST and FINAL EXAM REVIEW Directions: Both your final exam and the CST (STAR) test are based on the California Standards. There are five major categories and they include: Investigation
More informationSemester Outline of ALS Animals Standards
Semester Outline of ALS Animals Standards ALS: Animals Standards to be covered during Fall Semester (Level of Importance to Course Content: *low, **medium, ***high) Standard 1 Taxonomy and Classification
More informationp(d g A,g B )p(g B ), g B
Supplementary Note Marginal effects for two-locus models Here we derive the marginal effect size of the three models given in Figure 1 of the main text. For each model we assume the two loci (A and B)
More informationEvolution of phenotypic traits
Quantitative genetics Evolution of phenotypic traits Very few phenotypic traits are controlled by one locus, as in our previous discussion of genetics and evolution Quantitative genetics considers characters
More informationTeacher: Cheely/ Harbuck Course: Biology Period(s): All Day Week of: 1/12/15 EOCEP Lesson Plan/5E s
EOCEP Lesson Plan/5E s Day of the Week Monday Curriculum 2005 SDE Support Doc Standard:: B-4: The student will demonstrate an understanding of the molecular basis of heredity. Indicator: B-4.5 Goals (Objectives
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationRoadmap. Sexual Selection. Evolution of Multi-Gene Families Gene Duplication Divergence Concerted Evolution Survey of Gene Families
1 Roadmap Sexual Selection Evolution of Multi-Gene Families Gene Duplication Divergence Concerted Evolution Survey of Gene Families 2 One minute responses Q: How do aphids start producing males in the
More informationEnduring understanding 1.A: Change in the genetic makeup of a population over time is evolution.
The AP Biology course is designed to enable you to develop advanced inquiry and reasoning skills, such as designing a plan for collecting data, analyzing data, applying mathematical routines, and connecting
More informationTEST SUMMARY AND FRAMEWORK TEST SUMMARY
Washington Educator Skills Tests Endorsements (WEST E) TEST SUMMARY AND FRAMEWORK TEST SUMMARY BIOLOGY Copyright 2014 by the Washington Professional Educator Standards Board 1 Washington Educator Skills
More informationFormative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)
Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific
More informationChapter 6 Linkage Disequilibrium & Gene Mapping (Recombination)
12/5/14 Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination) Linkage Disequilibrium Genealogical Interpretation of LD Association Mapping 1 Linkage and Recombination v linkage equilibrium ²
More informationEssential knowledge 1.A.2: Natural selection
Appendix C AP Biology Concepts at a Glance Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring understanding 1.A: Change in the genetic makeup of a population over time
More information1 of 13 8/11/2014 10:32 AM Units: Teacher: APBiology, CORE Course: APBiology Year: 2012-13 Chemistry of Life Chapters 1-4 Big Idea 1, 2 & 4 Change in the genetic population over time is feedback mechanisms
More informationA A A A B B1
LEARNING OBJECTIVES FOR EACH BIG IDEA WITH ASSOCIATED SCIENCE PRACTICES AND ESSENTIAL KNOWLEDGE Learning Objectives will be the target for AP Biology exam questions Learning Objectives Sci Prac Es Knowl
More informationEvolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
More informationLinear Regression (1/1/17)
STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression
More informationG E INTERACTION USING JMP: AN OVERVIEW
G E INTERACTION USING JMP: AN OVERVIEW Sukanta Dash I.A.S.R.I., Library Avenue, New Delhi-110012 sukanta@iasri.res.in 1. Introduction Genotype Environment interaction (G E) is a common phenomenon in agricultural
More informationPDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE
19 January, 2018 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE Document Filetype: PDF 222.61 KB 0 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE How to Tell the Difference Between Prokaryotes and Eukaryotes.
More informationCase-Control Association Testing. Case-Control Association Testing
Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies
More informationMOLECULAR BIOLOGY BIOL 021 SEMESTER 2 (2015) COURSE OUTLINE
COURSE OUTLINE 1 COURSE GENERAL INFORMATION 1 Course Title & Course Code Molecular Biology: 2 Credit (Contact hour) 3 (2+1+0) 3 Title(s) of program(s) within which the subject is taught. Preparatory Program
More informationLength / bp 100 1000 10000 Vaccinia Virus Varicella-Zoster Virus Diameter / nm 100 10 Influenza Virus Rubella Virus Flavoviruses Hepatitis A Virus / Poliovirus 10 100 1000 10000 MW / kda Background
More informationPrinciples of QTL Mapping. M.Imtiaz
Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL
More informationCalculation of IBD probabilities
Calculation of IBD probabilities David Evans and Stacey Cherny University of Oxford Wellcome Trust Centre for Human Genetics This Session IBD vs IBS Why is IBD important? Calculating IBD probabilities
More informationIntroduction to the SNP/ND concept - Phylogeny on WGS data
Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny
More informationA mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding
Professur Pflanzenzüchtung Professur Pflanzenzüchtung A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding Jens Léon 4. November 2014, Oulu Workshop
More informationQuantitative Biology Lecture 3
23 nd Sep 2015 Quantitative Biology Lecture 3 Gurinder Singh Mickey Atwal Center for Quantitative Biology Summary Covariance, Correlation Confounding variables (Batch Effects) Information Theory Covariance
More informationBiology New Jersey 1. NATURE OF LIFE 2. THE CHEMISTRY OF LIFE. Tutorial Outline
Tutorial Outline New Jersey Tutorials are designed specifically for the New Jersey Core Curriculum Content Standards to prepare students for the PARCC assessments, the New Jersey Biology Competency Test
More informationName Class Date. KEY CONCEPT Gametes have half the number of chromosomes that body cells have.
Section 1: Chromosomes and Meiosis KEY CONCEPT Gametes have half the number of chromosomes that body cells have. VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous
More informationCopyright 2014 Edmentum - All rights reserved.
Copyright 2014 Edmentum - All rights reserved. AP Biology Unity and Diversity Blizzard Bag 2014-20151. The sawfish, also known as the carpenter shark, lives in estuaries off the coast of Australia. A scientist
More informationBS 50 Genetics and Genomics Week of Oct 3 Additional Practice Problems for Section. A/a ; B/B ; d/d X A/a ; b/b ; D/d
BS 50 Genetics and Genomics Week of Oct 3 Additional Practice Problems for Section 1. In the following cross, all genes are on separate chromosomes. A is dominant to a, B is dominant to b and D is dominant
More informationLecture 6: Introduction to Quantitative genetics. Bruce Walsh lecture notes Liege May 2011 course version 25 May 2011
Lecture 6: Introduction to Quantitative genetics Bruce Walsh lecture notes Liege May 2011 course version 25 May 2011 Quantitative Genetics The analysis of traits whose variation is determined by both a
More informationVariety of Living Organisms
Variety of Living Organisms Mark Scheme 1 Level IGCSE(9-1) Subject Biology Exam Board Edexcel IGCSE Module Double Award (Paper 1B) Topic The Nature and Variety of Living Organisms Sub-Topic Variety of
More informationMODEL-FREE LINKAGE AND ASSOCIATION MAPPING OF COMPLEX TRAITS USING QUANTITATIVE ENDOPHENOTYPES
MODEL-FREE LINKAGE AND ASSOCIATION MAPPING OF COMPLEX TRAITS USING QUANTITATIVE ENDOPHENOTYPES Saurabh Ghosh Human Genetics Unit Indian Statistical Institute, Kolkata Most common diseases are caused by
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationSide-by-Side Comparison of the Texas Educational Knowledge and Skills (TEKS) and Louisiana Grade Level Expectations (GLEs) SCIENCE: Biology
Side-by-Side Comparison of the Texas Educational Knowledge and Skills (TEKS) and Louisiana Grade Level Expectations (GLEs) SCIENCE: Biology TEKS Comments Louisiana GLE (Bio.1) Scientific Processes. The
More informationLatent Variable models for GWAs
Latent Variable models for GWAs Oliver Stegle Machine Learning and Computational Biology Research Group Max-Planck-Institutes Tübingen, Germany September 2011 O. Stegle Latent variable models for GWAs
More informationThe E-M Algorithm in Genetics. Biostatistics 666 Lecture 8
The E-M Algorithm in Genetics Biostatistics 666 Lecture 8 Maximum Likelihood Estimation of Allele Frequencies Find parameter estimates which make observed data most likely General approach, as long as
More informationCalculation of IBD probabilities
Calculation of IBD probabilities David Evans University of Bristol This Session Identity by Descent (IBD) vs Identity by state (IBS) Why is IBD important? Calculating IBD probabilities Lander-Green Algorithm
More informationIs KIT locus polymorphism rs related to white belt phenotype in Krškopolje pig?
Is KIT locus polymorphism rs328592739 related to white belt phenotype in Krškopolje pig? Jernej Ogorevc, Minja Zorc, Martin Škrlep, Riccardo Bozzi, Matthias Petig, Luca Fontanesi, Marjeta Čandek-Potokar,
More informationTheoretical and computational aspects of association tests: application in case-control genome-wide association studies.
Theoretical and computational aspects of association tests: application in case-control genome-wide association studies Mathieu Emily November 18, 2014 Caen mathieu.emily@agrocampus-ouest.fr - Agrocampus
More informationOn coding genotypes for genetic markers with multiple alleles in genetic association study of quantitative traits
Wang BMC Genetics 011, 1:8 http://www.biomedcentral.com/171-156/1/8 METHODOLOGY ARTICLE Open Access On coding genotypes for genetic markers with multiple alleles in genetic association study of quantitative
More informationACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics
ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying
More informationLecture WS Evolutionary Genetics Part I 1
Quantitative genetics Quantitative genetics is the study of the inheritance of quantitative/continuous phenotypic traits, like human height and body size, grain colour in winter wheat or beak depth in
More informationExam 1 PBG430/
1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationCS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS
CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Hung Huang and Dr. Chengkai Li at UT Arlington Mingon Kang, Ph.D. Computer Science, Kennesaw State University Problems
More informationBIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES.
Enduring Understanding 4.C Independent Study Assignment Assignment Instructions Both components of this assignment (Part I and Part II) should be completed on the pages provided. Each numbered component
More informationCharacterization of graphene immuneimpacts through omics approaches and genotoxic analysis. FLAG-ERA JTC 2015 Project Budapest 13/04/2016
Characterization of graphene immuneimpacts through omics approaches and genotoxic analysis FLAG-ERA JTC 2015 Project Budapest 13/04/2016 13/04/2016 1 Consortium Partners University of Sassari (Partner
More informationCampbell Biology AP Edition 11 th Edition, 2018
A Correlation and Narrative Summary of Campbell Biology AP Edition 11 th Edition, 2018 To the AP Biology Curriculum Framework AP is a trademark registered and/or owned by the College Board, which was not
More information