Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics
|
|
- Antonia Cunningham
- 5 years ago
- Views:
Transcription
1 Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics
2 I believe it is helpful to number your slides for easy reference. It's been a while since I took linear algebra and this came at me a little fast. A lot of the math presented today went over my head (I have not taken linear algebra) More background on how you go about implementing equations like this doing that would be helpful. Would appreciate a more detailed look at actually implementing neural nets with some pseudocode. It was a bit unclear at the end where exactly you get the W's from. Why are logistic functions (or Rectifier-Linear) preferred for Neural networks? Does any non-linear function work? Could you point me to the paper that reports the structures of transcription factor binding the chromatin? doi: /j.tibs
3 Linear algebra review Vector (dimension 3): scalar * vector multiplication: a 2 4 x 1 x 2 x = 2 3 ax 1 4ax 5 2 ax 3 vector * vector multiplication (dot product): x T y = x 1 x 2 x y 1 y = x 1 y 1 + x 2 y 2 + x 3 y 3 3 y 3
4 Linear algebra review Matrix (3x2): matrix * vector multiplication: Ax = apple a1,1 a 1,2 a 2,1 a 2,2 apple x1 x 2 = apple a1,1 x 1 + a 1,2 x 2 a 2,1 x 1 + a 2,2 x 2 4
5 Neural networks f 3,1 (x 2 ) = sign(w 3,1 x 2 ) x 3 x 2 f 2,1 (x 1 )=W 2,1 x 1 x 1 f 1,1 (x 0 )=W 1,1 x 0 f 1,2 (x 0 )=W 1,2 x 0 x A C C G T
6 This lecture MEME optimization ChIP-seq peak calling Motivating problem: accounting for GC and mappability bias in peak calling Method: Convex functions More ChIP-seq peak calling considerations Other functional genomics assays 6
7 Chromatin immunoprecipitation followed by sequencing (ChIP-seq) Sequence and map to reference genome 7
8 Problem: Given a ChIP-seq experiment for factor X, where does X bind?
9 Problem: Given a ChIP-seq experiment for factor X, where does X bind? Short answer: Stack up the reads in the genome; choose the tall stacks. Issues to consider: Sequencing fragment lengths Sequencing read lengths Experimental biases Mappability GC bias How to pick a threshold and assign statistical confidence? 9
10 This lecture MEME optimization ChIP-seq peak calling Motivating problem: accounting for GC and mappability bias in peak calling Method: Convex functions More ChIP-seq peak calling considerations Other functional genomics assays 10
11 ChIP-seq read counts are biased by GC content and mappability 11
12 MOSAiCS enrichment model Bound? Mappability GC content Tag counts 12
13 How can we model the background distribution of ChIP-seq reads?
14 Every predictive model is composed of a mean model and an error model E[counts j Not bound] = exp( 0 + M MAP j + GC GC j ) Pr(counts j Not bound) =? Bound? Mappability GC content Tag counts 14
15 The Poisson distribution models sequencing read counts k P (k )=e k! Mean: λ Variance: λ 15
16 The negative binomial distribution models sequencing read counts more flexibly than Poisson P (k r, p) = k + r 1 (1 p) r p k k Mean: Variance: pr 1 p pr (1 p) 2 16
17 The negative binomial distribution models the mean and variance separately Principle: Make the weakest assumptions you can afford to in your modeling choices 17
18 MOSAiCs background model Number of counts at 50-bp bin j N j NegBin(a, a/µ j ) µ j =exp( 0 + M M j + GC GC j ) Mappability at bin j GC content at bin j 18
19 How do we know if the MOSAiCS model is even optimizable?
20 This lecture MEME optimization ChIP-seq peak calling Motivating problem: accounting for GC and mappability bias in peak calling Method: Convex functions More ChIP-seq peak calling considerations Other functional genomics assays
21 Answer: The negative log likelihood is convex The class of convex functions (defined on the next slide) roughly corresponds to the set of efficiently optimizable functions. When presented with an objective function, the first step is usually to check if it is convex. 21
22 Convex functions A function f(x) is convex if it satisfies the property: f( x +(1 )y) apple f(x)+(1 )f(y) for all x, y, 0 apple apple 1. Convex functions have no local minima. 22
23 Concave functions A function f(x) is concave if -f(x) is convex. Convex functions are usually efficiently minimizable. Concave functions are usually efficiently maximizable. (A function can be neither convex nor concave.) 23
24 Examples on one variable 24 Stanford EE364a
25 Examples on one variable Convex: Non-convex: 25 Duke stat376
26 Second derivative criterion for convexity If f(x) is on one variable, f(x) is convex if and only if d 2 f dx Stanford EE364a
27 Is exp(x) convex? Proof by picture: Proof from second derivative: d exp(x) =expx dx d 2 exp(x) x 2 =expx 0 d 27 Proof from definition: exp( x +(1 )x 0 )=exp( x)exp((1 )x 0 ) exp(x)+(1 )exp(x 0 ) (Arithmetic Mean / Geometric Mean inequality)
28 Is sin(x) convex? Disproof by picture: Counterexample by second derivative: d sin(x) dx = cos(x) d 2 sin(x) dx 2 = sin(x) sin( ) = 1 < 0 Counterexample from definition: sin( )/2 + sin(0)/2 =0/2+0/2 < sin(0/2+ /2) = sin( /2) = 1 28
29 29 Is x 2 convex?
30 30 Is x 3 convex?
31 31 (ax b) 2
32 Convexity of functions on multiple variables y = f(x 1,x 2,x 3,...) Convexity criterion: f( x +(1 )y) apple f(x)+(1 )f(y) for all x, y, 0 apple apple 1. 32
33 Examples of multi-variable convex functions x 2 R n a ne function (convex and concave): a T x + b a 2 R n,b2 R Euclidian norm (convex): s X i x 2 i 33
34 Examples of multi-variable convex functions Convex if P is positive semi-definite. 34 Stanford EE364a
35 Examples of multi-variable convex functions Convex if P is positive semi-definite. 35 Stanford EE364a
36 Second derivative criterion for convexity on multiple variables Derivative of a function on multiple variables: Second derivative: r 2 f(x) = f(x) is convex if and only if: x 1 x v T r 2 f(x)v 0 for v 2 R n 36 i.e. if r 2 f(x)vis positive semi-definite. Stanford EE364a
37 Second derivative criterion for convexity on multiple variables Derivative of a function on multiple variables: Second derivative: r 2 f(x) = f(x) is convex if and only if: x 1 x v T r 2 f(x)v 0 for v 2 R n 37 i.e. if r 2 f(x)vis positive semi-definite. Stanford EE364a
38 Second derivative criterion for convexity on multiple variables Derivative of a function on multiple variables: Second derivative: r 2 f(x) = f(x) is convex if and only if: x 1 x v T r 2 f(x)v 0 for v 2 R n 38 i.e. if r 2 f(x)vis positive semi-definite. Stanford EE364a
39 Second derivative criterion for convexity on multiple variables Derivative of a function on multiple variables: Second derivative: r 2 f(x) = f(x) is convex if and only if: x 1 x v T r 2 f(x)v 0 for v 2 R n 39 i.e. if r 2 f(x)vis positive semi-definite. Stanford EE364a
40 A non-convex function f(x 1,x 2 )=x 1 x 2 = x 1 x 2 apple apple x1 x 2 Not positive semi-definite 40
41 Practical ways to establish convexity of a function Verify the definition. Verify that the second derivative is always positive semidefinite. Show that the function can be obtained from simple convex functions by operations that maintain convexity.
42 Some operations that maintain convexity 42 Stanford EE364a
43 Regularization L2 regularization: f 0 (x) =f(x)+kxk 2 43
44 Is this convex? (Ax b) 2 + x 2 44
45 What if your function is not convex? Is there a monotonic transform that makes it convex? Example: Y i x i log Y x i = X log x i i i Neither convex nor concave Concave Next best thing: split the function into convex parts. Example: f(x 1,x 2 )=x 1 x 2 45 Convex in either x1 or x2 but not both at once. Optimize each in turn. Example: EM.
46 What if your function is not convex? Is there a monotonic transform that makes it convex? Example: Y i x i log Y x i = X log x i i i Neither convex nor concave Concave Next best thing: split the function into convex parts. Example: f(x 1,x 2 )=x 1 x 2 46 Convex in either x1 or x2 but not both at once. Optimize each in turn. Example: EM.
47 Optimizing convex objectives There are general convex optimization software packages. Even when these are too slow, convex functions usually admit fast optimization specific to your problem. More on convex optimization next class. 47
48 The MOSAiCS objective is concave in β =[ 0 M GC] T F j =[1MY j GC j ] T X µ(f j, )=exp( T F j )=exp( 0 + M M j + GC GC j ) Y X X log P (N ) = log Y P (N j )= Y X = j X Nj + a +1 a log + a log 1 + N j log a N j log µ(f j, ) N j j µ(f j, ) X log(1 1/ exp(x)) X N j log µ(f j, )=N j T F j (a ne in )
49 This lecture MEME optimization ChIP-seq peak calling Motivating problem: accounting for GC and mappability bias in peak calling Method: Convex functions More ChIP-seq peak calling considerations Other functional genomics assays 49
50 The ChIP-seq protocol enriches for a particular fragment size Chromatin DNA fragments ChIP, sonication size selection sequence 50 fragment length
51 Translate reads to the inferred center of the sequencing fragment correlation between strands 51 strand shift
52 The phantom peak results from mappability islands unmappable mappable ChIP-seq measure of quality: relative strand correlation (RSC) 52 read length
53 ChIP-seq controls Input: IgG: Skip IP Use irrelevant antibody 53 Reasons for controls: - sonocation bias - CNVs - sequence composition bias
54 Problem: Different background models result in wildly different false discovery-rate estimates 54
55 Idea: Control reproducibility of peaks between biological replicates 55 Irreproducible discovery rate (IDR): Expected fraction of peaks that are not reproducible between biological replicates.
56 56 IDR can handle varying quality levels
57 This lecture MEME optimization ChIP-seq peak calling Motivating problem: accounting for GC and mappability bias in peak calling Method: Convex functions More ChIP-seq peak calling considerations Other functional genomics assays 57
58 ChIP-exo has better spatial resolution than ChIP-seq 58
59 DamID measures TF binding through a fusion protein Dam+TF fusion protein Measure methylation at GATCs DamID vs. ChIP-seq: DamID can be easier ChIP requires (specific) antibody DamID requires fusion protein DamID can t query post-transcriptional modification (histone mods) ChIP has better spacial resolution ChIP is limited by cross-linking bias DamID is limited by GATC content and Dam reactivity ChIP has better temporal resolution: Dam acts over ~24 hours 59
60 DNase-seq and ATAC-seq measure DNA accessibility 60
61 High-depth DNase-seq (DNase-DGF) measures TF binding 61
62 Paired-end DNase and ATAC-seq measure nucleosome architecture 62
63 Administrivia Homework 1 will be up later today. Due Thursday Next week: Broad (non peak-y ) functional genomics assays; Chromatin architecture. Please write 1-minute responses.
Genome 541! Unit 4, lecture 2! Transcription factor binding using functional genomics
Genome 541 Unit 4, lecture 2 Transcription factor binding using functional genomics Slides vs chalk talk: I m not sure why you chose a chalk talk over ppt. I prefer the latter no issues with readability
More informationGenome 541! Unit 4, lecture 3! Genomics assays
Genome 541! Unit 4, lecture 3! Genomics assays Much easier to follow with slides. Good pace.! Having the slides was really helpful clearer to read and easier to follow the trajectory of the lecture.!!
More informationGenome 541 Introduction to Computational Molecular Biology. Max Libbrecht
Genome 541 Introduction to Computational Molecular Biology Max Libbrecht Genome 541 units Max Libbrecht: Gene regulation and epigenomics Postdoc, Bill Noble s lab Yi Yin: Bayesian statistics Postdoc, Jay
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationChIP seq peak calling. Statistical integration between ChIP seq and RNA seq
Institute for Computational Biomedicine ChIP seq peak calling Statistical integration between ChIP seq and RNA seq Olivier Elemento, PhD ChIP-seq to map where transcription factors bind DNA Transcription
More informationChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier
ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier Data visualization, quality control, normalization & peak calling Peak annotation Presentation () Practical session
More informationMeasuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
More informationChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier
ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier Visualization, quality, normalization & peak-calling Presentation (Carl Herrmann) Practical session Peak annotation
More informationStatistical analysis of genomic binding sites using high-throughput ChIP-seq data
Statistical analysis of genomic binding sites using high-throughput ChIP-seq data Ibrahim Ali H Nafisah Department of Statistics University of Leeds Submitted in accordance with the requirments for the
More informationMODEL-BASED APPROACHES FOR THE DETECTION OF BIOLOGICALLY ACTIVE GENOMIC REGIONS FROM NEXT GENERATION SEQUENCING DATA. Naim Rashid
MODEL-BASED APPROACHES FOR THE DETECTION OF BIOLOGICALLY ACTIVE GENOMIC REGIONS FROM NEXT GENERATION SEQUENCING DATA Naim Rashid A dissertation submitted to the faculty of the University of North Carolina
More informationChapter 3 Class Notes Word Distributions and Occurrences
Chapter 3 Class Notes Word Distributions and Occurrences 3.1. The Biological Problem: restriction endonucleases provide[s] the means for precisely and reproducibly cutting the DNA into fragments of manageable
More informationJMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue
Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion
More informationLinear Algebra: Homework 3
Linear Algebra: Homework 3 Alvin Lin August 206 - December 206 Section.2 Exercise 48 Find all values of the scalar k for which the two vectors are orthogonal. [ ] [ ] 2 k + u v 3 k u v 0 2(k + ) + 3(k
More informationStatistics for Differential Expression in Sequencing Studies. Naomi Altman
Statistics for Differential Expression in Sequencing Studies Naomi Altman naomi@stat.psu.edu Outline Preliminaries what you need to do before the DE analysis Stat Background what you need to know to understand
More informationPlease do not start working until instructed to do so. You have 50 minutes. You must show your work to receive full credit. Calculators are OK.
Loyola University Chicago Math 131, Section 009, Fall 2008 Midterm 2 Name (print): Signature: Please do not start working until instructed to do so. You have 50 minutes. You must show your work to receive
More informationMAS223 Statistical Inference and Modelling Exercises
MAS223 Statistical Inference and Modelling Exercises The exercises are grouped into sections, corresponding to chapters of the lecture notes Within each section exercises are divided into warm-up questions,
More informationINTEGRATING EPIGENETIC PRIORS FOR IMPROVING COMPUTATIONAL IDENTIFICATION OF TRANSCRIPTION FACTOR BINDING SITES AFFAN SHOUKAT
INTEGRATING EPIGENETIC PRIORS FOR IMPROVING COMPUTATIONAL IDENTIFICATION OF TRANSCRIPTION FACTOR BINDING SITES AFFAN SHOUKAT A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT
More informationComplete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
More informationfor the Analysis of ChIP-Seq Data
Supplementary Materials: A Statistical Framework for the Analysis of ChIP-Seq Data Pei Fen Kuan Departments of Statistics and of Biostatistics and Medical Informatics Dongjun Chung Departments of Statistics
More informationGeneralized Linear Models (1/29/13)
STA613/CBB540: Statistical methods in computational biology Generalized Linear Models (1/29/13) Lecturer: Barbara Engelhardt Scribe: Yangxiaolu Cao When processing discrete data, two commonly used probability
More informationhsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference
CS 229 Project Report (TR# MSB2010) Submitted 12/10/2010 hsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference Muhammad Shoaib Sehgal Computer Science
More informationCalculus 221 worksheet
Calculus 221 worksheet Graphing A function has a global maximum at some a in its domain if f(x) f(a) for all other x in the domain of f. Global maxima are sometimes also called absolute maxima. A function
More informationWeek 5: Logistic Regression & Neural Networks
Week 5: Logistic Regression & Neural Networks Instructor: Sergey Levine 1 Summary: Logistic Regression In the previous lecture, we covered logistic regression. To recap, logistic regression models and
More informationTECHNICAL REPORT NO. 1151
DEPARTMENT OF STATISTICS University of Wisconsin 1300 University Avenue Madison, WI 53706 TECHNICAL REPORT NO. 1151 January 12, 2009 A Hierarchical Semi-Markov Model for Detecting Enrichment with Application
More informationMAT01B1: Maximum and Minimum Values
MAT01B1: Maximum and Minimum Values Dr Craig 14 August 2018 My details: acraig@uj.ac.za Consulting hours: Monday 14h40 15h25 Thursday 11h20 12h55 Friday 11h20 12h55 Office C-Ring 508 https://andrewcraigmaths.wordpress.com/
More informationLecture 1: Introduction and probability review
Stat 200: Introduction to Statistical Inference Autumn 2018/19 Lecture 1: Introduction and probability review Lecturer: Art B. Owen September 25 Disclaimer: These notes have not been subjected to the usual
More informationMixture models for analysing transcriptome and ChIP-chip data
Mixture models for analysing transcriptome and ChIP-chip data Marie-Laure Martin-Magniette French National Institute for agricultural research (INRA) Unit of Applied Mathematics and Informatics at AgroParisTech,
More informationNeural Networks in Structured Prediction. November 17, 2015
Neural Networks in Structured Prediction November 17, 2015 HWs and Paper Last homework is going to be posted soon Neural net NER tagging model This is a new structured model Paper - Thursday after Thanksgiving
More informationThis practice exam is intended to help you prepare for the final exam for MTH 142 Calculus II.
MTH 142 Practice Exam Chapters 9-11 Calculus II With Analytic Geometry Fall 2011 - University of Rhode Island This practice exam is intended to help you prepare for the final exam for MTH 142 Calculus
More informationHigh-Throughput Sequencing Course
High-Throughput Sequencing Course DESeq Model for RNA-Seq Biostatistics and Bioinformatics Summer 2017 Outline Review: Standard linear regression model (e.g., to model gene expression as function of an
More informationPackage ChIPtest. July 20, 2016
Type Package Package ChIPtest July 20, 2016 Title Nonparametric Methods for Identifying Differential Enrichment Regions with ChIP-Seq Data Version 1.0 Date 2017-07-07 Author Vicky Qian Wu ; Kyoung-Jae
More informationLinear Independence. MATH 322, Linear Algebra I. J. Robert Buchanan. Spring Department of Mathematics
Linear Independence MATH 322, Linear Algebra I J. Robert Buchanan Department of Mathematics Spring 2015 Introduction Given a set of vectors {v 1, v 2,..., v r } and another vector v span{v 1, v 2,...,
More informationLinear Regression (1/1/17)
STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression
More informationAnnouncements Monday, November 13
Announcements Monday, November 13 The third midterm is on this Friday, November 17. The exam covers 3.1, 3.2, 5.1, 5.2, 5.3, and 5.5. About half the problems will be conceptual, and the other half computational.
More informationORF 245 Fundamentals of Statistics Chapter 9 Hypothesis Testing
ORF 245 Fundamentals of Statistics Chapter 9 Hypothesis Testing Robert Vanderbei Fall 2014 Slides last edited on November 24, 2014 http://www.princeton.edu/ rvdb Coin Tossing Example Consider two coins.
More informationAutomatic Differentiation and Neural Networks
Statistical Machine Learning Notes 7 Automatic Differentiation and Neural Networks Instructor: Justin Domke 1 Introduction The name neural network is sometimes used to refer to many things (e.g. Hopfield
More informationTechnologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA
Technologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA Expression analysis for RNA-seq data Ewa Szczurek Instytut Informatyki Uniwersytet Warszawski 1/35 The problem
More informationDiscovering molecular pathways from protein interaction and ge
Discovering molecular pathways from protein interaction and gene expression data 9-4-2008 Aim To have a mechanism for inferring pathways from gene expression and protein interaction data. Motivation Why
More informationMIDTERM 2. Section: Signature:
MIDTERM 2 Math 3A 11/17/2010 Name: Section: Signature: Read all of the following information before starting the exam: Check your exam to make sure all pages are present. When you use a major theorem (like
More informationDEXSeq paper discussion
DEXSeq paper discussion L Collado-Torres December 10th, 2012 1 / 23 1 Background 2 DEXSeq paper 3 Results 2 / 23 Gene Expression 1 Background 1 Source: http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/applexpression.shtml
More informationGeert Geeven. April 14, 2010
iction of Gene Regulatory Interactions NDNS+ Workshop April 14, 2010 Today s talk - Outline Outline Biological Background Construction of Predictors The main aim of my project is to better understand the
More informationLecture 2: Convex Sets and Functions
Lecture 2: Convex Sets and Functions Hyang-Won Lee Dept. of Internet & Multimedia Eng. Konkuk University Lecture 2 Network Optimization, Fall 2015 1 / 22 Optimization Problems Optimization problems are
More informationMachine Learning. Neural Networks. (slides from Domingos, Pardo, others)
Machine Learning Neural Networks (slides from Domingos, Pardo, others) For this week, Reading Chapter 4: Neural Networks (Mitchell, 1997) See Canvas For subsequent weeks: Scaling Learning Algorithms toward
More informationFinal Exam Solutions June 10, 2004
Math 0400: Analysis in R n II Spring 004 Section 55 P. Achar Final Exam Solutions June 10, 004 Total points: 00 There are three blank pages for scratch work at the end of the exam. Time it: hours 1. True
More informationAssociation studies and regression
Association studies and regression CM226: Machine Learning for Bioinformatics. Fall 2016 Sriram Sankararaman Acknowledgments: Fei Sha, Ameet Talwalkar Association studies and regression 1 / 104 Administration
More informationFoundation of Intelligent Systems, Part I. Regression
Foundation of Intelligent Systems, Part I Regression mcuturi@i.kyoto-u.ac.jp FIS-2013 1 Before starting Please take this survey before the end of this week. Here are a few books which you can check beyond
More information8.7 Taylor s Inequality Math 2300 Section 005 Calculus II. f(x) = ln(1 + x) f(0) = 0
8.7 Taylor s Inequality Math 00 Section 005 Calculus II Name: ANSWER KEY Taylor s Inequality: If f (n+) is continuous and f (n+) < M between the center a and some point x, then f(x) T n (x) M x a n+ (n
More informationSimultaneous Equations Solve for x and y (What are the values of x and y): Summation What is the value of the following given x = j + 1. x i.
1 Algebra Simultaneous Equations Solve for x and y (What are the values of x and y): x + 2y = 6 x - y = 3 Summation What is the value of the following given x = j + 1. Summation Calculate the following:
More informationStatistical Methods for SVM
Statistical Methods for SVM Support Vector Machines Here we approach the two-class classification problem in a direct way: We try and find a plane that separates the classes in feature space. If we cannot,
More informationGenomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
More informationComputational Genomics. Systems biology. Putting it together: Data integration using graphical models
02-710 Computational Genomics Systems biology Putting it together: Data integration using graphical models High throughput data So far in this class we discussed several different types of high throughput
More informationAnnouncements Monday, September 18
Announcements Monday, September 18 WeBWorK 1.4, 1.5 are due on Wednesday at 11:59pm. The first midterm is on this Friday, September 22. Midterms happen during recitation. The exam covers through 1.5. About
More informationNon-Convex Optimization. CS6787 Lecture 7 Fall 2017
Non-Convex Optimization CS6787 Lecture 7 Fall 2017 First some words about grading I sent out a bunch of grades on the course management system Everyone should have all their grades in Not including paper
More informationComparative analysis of RNA- Seq data with DESeq2
Comparative analysis of RNA- Seq data with DESeq2 Simon Anders EMBL Heidelberg Two applications of RNA- Seq Discovery Eind new transcripts Eind transcript boundaries Eind splice junctions Comparison Given
More informationIDR: Irreproducible discovery rate
IDR: Irreproducible discovery rate Sündüz Keleş Department of Statistics Department of Biostatistics and Medical Informatics University of Wisconsin, Madison April 18, 2017 Stat 877 (Spring 17) 04/11-04/18
More informationSTAT 414: Introduction to Probability Theory
STAT 414: Introduction to Probability Theory Spring 2016; Homework Assignments Latest updated on April 29, 2016 HW1 (Due on Jan. 21) Chapter 1 Problems 1, 8, 9, 10, 11, 18, 19, 26, 28, 30 Theoretical Exercises
More informationSolutions to homework assignment #7 Math 119B UC Davis, Spring for 1 r 4. Furthermore, the derivative of the logistic map is. L r(x) = r(1 2x).
Solutions to homework assignment #7 Math 9B UC Davis, Spring 0. A fixed point x of an interval map T is called superstable if T (x ) = 0. Find the value of 0 < r 4 for which the logistic map L r has a
More informationMAT 419 Lecture Notes Transcribed by Eowyn Cenek 6/1/2012
(Homework 1: Chapter 1: Exercises 1-7, 9, 11, 19, due Monday June 11th See also the course website for lectures, assignments, etc) Note: today s lecture is primarily about definitions Lots of definitions
More informationMore on infinite series Antiderivatives and area
More on infinite series Antiderivatives and area September 28, 2017 The eighth breakfast was on Monday: There are still slots available for the October 4 breakfast (Wednesday, 8AM), and there s a pop-in
More informationTest for Increasing and Decreasing Theorem 5 Let f(x) be continuous on [a, b] and differentiable on (a, b).
Definition of Increasing and Decreasing A function f(x) is increasing on an interval if for any two numbers x 1 and x in the interval with x 1 < x, then f(x 1 ) < f(x ). As x gets larger, y = f(x) gets
More informationProblem 3. Give an example of a sequence of continuous functions on a compact domain converging pointwise but not uniformly to a continuous function
Problem 3. Give an example of a sequence of continuous functions on a compact domain converging pointwise but not uniformly to a continuous function Solution. If we does not need the pointwise limit of
More informationAnnouncements Monday, November 13
Announcements Monday, November 13 The third midterm is on this Friday, November 17 The exam covers 31, 32, 51, 52, 53, and 55 About half the problems will be conceptual, and the other half computational
More informationChromosomes and Inheritance
Chromosomes and Inheritance Overview Number of instructional days: 14 (1 day = 50 minutes) Content to be learned Describe the structure of DNA as a way to demonstrate an understanding of the molecular
More informationHomework 2. Spring 2019 (Due Thursday February 7)
ECE 302: Probabilistic Methods in Electrical and Computer Engineering Spring 2019 Instructor: Prof. A. R. Reibman Homework 2 Spring 2019 (Due Thursday February 7) Homework is due on Thursday February 7
More informationStatistical Data Analysis Stat 3: p-values, parameter estimation
Statistical Data Analysis Stat 3: p-values, parameter estimation London Postgraduate Lectures on Particle Physics; University of London MSci course PH4515 Glen Cowan Physics Department Royal Holloway,
More informationReview of Coordinate Systems
Vector in 2 R and 3 R Review of Coordinate Systems Used to describe the position of a point in space Common coordinate systems are: Cartesian Polar Cartesian Coordinate System Also called rectangular coordinate
More informationLecture 5: Processes and Timescales: Rates for the fundamental processes 5.1
Lecture 5: Processes and Timescales: Rates for the fundamental processes 5.1 Reading Assignment for Lectures 5-6: Phillips, Kondev, Theriot (PKT), Chapter 3 Life is not static. Organisms as a whole are
More informationDifferential expression analysis for sequencing count data. Simon Anders
Differential expression analysis for sequencing count data Simon Anders RNA-Seq Count data in HTS RNA-Seq Tag-Seq Gene 13CDNA73 A2BP1 A2M A4GALT AAAS AACS AADACL1 [...] ChIP-Seq Bar-Seq... GliNS1 4 19
More informationMidterm Review CS 6375: Machine Learning. Vibhav Gogate The University of Texas at Dallas
Midterm Review CS 6375: Machine Learning Vibhav Gogate The University of Texas at Dallas Machine Learning Supervised Learning Unsupervised Learning Reinforcement Learning Parametric Y Continuous Non-parametric
More informationGoing Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014
Going Beyond SNPs with Next Genera5on Sequencing Technology 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Next Genera5on Sequencing Technology (NGS) NGS technology Discover more
More informationg A n(a, g) n(a, ḡ) = n(a) n(a, g) n(a) B n(b, g) n(a, ḡ) = n(b) n(b, g) n(b) g A,B A, B 2 RNA-seq (D) RNA mrna [3] RNA 2. 2 NGS 2 A, B NGS n(
,a) RNA-seq RNA-seq Cuffdiff, edger, DESeq Sese Jun,a) Abstract: Frequently used biological experiment technique for observing comprehensive gene expression has been changed from microarray using cdna
More informationFALL 2018 MATH 4211/6211 Optimization Homework 1
FALL 2018 MATH 4211/6211 Optimization Homework 1 This homework assignment is open to textbook, reference books, slides, and online resources, excluding any direct solution to the problem (such as solution
More informationStatistical tests for differential expression in count data (1)
Statistical tests for differential expression in count data (1) NBIC Advanced RNA-seq course 25-26 August 2011 Academic Medical Center, Amsterdam The analysis of a microarray experiment Pre-process image
More informationM155 Exam 2 Concept Review
M155 Exam 2 Concept Review Mark Blumstein DERIVATIVES Product Rule Used to take the derivative of a product of two functions u and v. u v + uv Quotient Rule Used to take a derivative of the quotient of
More informationMultivariate point process models
Faculty of Science Multivariate point process models Niels Richard Hansen Department of Mathematical Sciences January 8, 200 Slide /20 Ideas and outline General aim: To build and implement a flexible (non-parametric),
More informationSubgradient Method. Guest Lecturer: Fatma Kilinc-Karzan. Instructors: Pradeep Ravikumar, Aarti Singh Convex Optimization /36-725
Subgradient Method Guest Lecturer: Fatma Kilinc-Karzan Instructors: Pradeep Ravikumar, Aarti Singh Convex Optimization 10-725/36-725 Adapted from slides from Ryan Tibshirani Consider the problem Recall:
More informationMachine Learning. Neural Networks. (slides from Domingos, Pardo, others)
Machine Learning Neural Networks (slides from Domingos, Pardo, others) Human Brain Neurons Input-Output Transformation Input Spikes Output Spike Spike (= a brief pulse) (Excitatory Post-Synaptic Potential)
More information4.9 APPROXIMATING DEFINITE INTEGRALS
4.9 Approximating Definite Integrals Contemporary Calculus 4.9 APPROXIMATING DEFINITE INTEGRALS The Fundamental Theorem of Calculus tells how to calculate the exact value of a definite integral IF the
More informationCalculus I Announcements
Slide 1 Calculus I Announcements Read sections 3.9-3.10 Do all the homework for section 3.9 and problems 1,3,5,7 from section 3.10. The exam is in Thursday, October 22nd. The exam will cover sections 3.2-3.10,
More informationControlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
More informationMatrix-based pattern discovery algorithms
Regulatory Sequence Analysis Matrix-based pattern discovery algorithms Jacques.van.Helden@ulb.ac.be Université Libre de Bruxelles, Belgique Laboratoire de Bioinformatique des Génomes et des Réseaux (BiGRe)
More information5/8/2012: Practice final A
Math 1A: introduction to functions and calculus Oliver Knill, Spring 2012 Problem 1) TF questions (20 points) No justifications are needed. 5/8/2012: Practice final A 1) T F The quantum exponential function
More informationMAT137 - Term 2, Week 4
MAT137 - Term 2, Week 4 Reminders: Your Problem Set 6 is due tomorrow at 3pm. Test 3 is next Friday, February 3, at 4pm. See the course website for details. Today we will: Talk more about substitution.
More information10/05/2016. Computational Methods for Data Analysis. Massimo Poesio SUPPORT VECTOR MACHINES. Support Vector Machines Linear classifiers
Computational Methods for Data Analysis Massimo Poesio SUPPORT VECTOR MACHINES Support Vector Machines Linear classifiers 1 Linear Classifiers denotes +1 denotes -1 w x + b>0 f(x,w,b) = sign(w x + b) How
More informationEECS 70 Discrete Mathematics and Probability Theory Fall 2015 Walrand/Rao Final
EECS 70 Discrete Mathematics and Probability Theory Fall 2015 Walrand/Rao Final PRINT Your Name:, (last) SIGN Your Name: (first) PRINT Your Student ID: CIRCLE your exam room: 220 Hearst 230 Hearst 237
More informationReview of Optimization Methods
Review of Optimization Methods Prof. Manuela Pedio 20550 Quantitative Methods for Finance August 2018 Outline of the Course Lectures 1 and 2 (3 hours, in class): Linear and non-linear functions on Limits,
More informationSupport for UCL Mathematics offer holders with the Sixth Term Examination Paper
1 Support for UCL Mathematics offer holders with the Sixth Term Examination Paper The Sixth Term Examination Paper (STEP) examination tests advanced mathematical thinking and problem solving. The examination
More informationStatic Problem Set 2 Solutions
Static Problem Set Solutions Jonathan Kreamer July, 0 Question (i) Let g, h be two concave functions. Is f = g + h a concave function? Prove it. Yes. Proof: Consider any two points x, x and α [0, ]. Let
More informationIntroduction to the Mathematical and Statistical Foundations of Econometrics Herman J. Bierens Pennsylvania State University
Introduction to the Mathematical and Statistical Foundations of Econometrics 1 Herman J. Bierens Pennsylvania State University November 13, 2003 Revised: March 15, 2004 2 Contents Preface Chapter 1: Probability
More informationDEGseq: an R package for identifying differentially expressed genes from RNA-seq data
DEGseq: an R package for identifying differentially expressed genes from RNA-seq data Likun Wang Zhixing Feng i Wang iaowo Wang * and uegong Zhang * MOE Key Laboratory of Bioinformatics and Bioinformatics
More informationOptimization. Charles J. Geyer School of Statistics University of Minnesota. Stat 8054 Lecture Notes
Optimization Charles J. Geyer School of Statistics University of Minnesota Stat 8054 Lecture Notes 1 One-Dimensional Optimization Look at a graph. Grid search. 2 One-Dimensional Zero Finding Zero finding
More informationClustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
More informationThe Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling
More informationUniversity of California, Berkeley
University of California, Berkeley U.C. Berkeley Division of Biostatistics Working Paper Series Year 2004 Paper 147 Multiple Testing Methods For ChIP-Chip High Density Oligonucleotide Array Data Sunduz
More informationPolynomial Regression and Regularization
Polynomial Regression and Regularization Administrivia o If you still haven t enrolled in Moodle yet Enrollment key on Piazza If joined course recently, email me to get added to Piazza o Homework 1 posted
More informationNeural Networks for Machine Learning. Lecture 2a An overview of the main types of neural network architecture
Neural Networks for Machine Learning Lecture 2a An overview of the main types of neural network architecture Geoffrey Hinton with Nitish Srivastava Kevin Swersky Feed-forward neural networks These are
More informationMS&E 226: Small Data. Lecture 11: Maximum likelihood (v2) Ramesh Johari
MS&E 226: Small Data Lecture 11: Maximum likelihood (v2) Ramesh Johari ramesh.johari@stanford.edu 1 / 18 The likelihood function 2 / 18 Estimating the parameter This lecture develops the methodology behind
More information, Seventh Grade Math, Quarter 1
2017.18, Seventh Grade Math, Quarter 1 The following Practice Standards and Literacy Skills will be used throughout the course: Standards for Mathematical Practice Literacy Skills for Mathematical Proficiency
More informationPractice Problems Section Problems
Practice Problems Section 4-4-3 4-4 4-5 4-6 4-7 4-8 4-10 Supplemental Problems 4-1 to 4-9 4-13, 14, 15, 17, 19, 0 4-3, 34, 36, 38 4-47, 49, 5, 54, 55 4-59, 60, 63 4-66, 68, 69, 70, 74 4-79, 81, 84 4-85,
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More information