Genome 541! Unit 4, lecture 3! Genomics assays

Size: px
Start display at page:

Download "Genome 541! Unit 4, lecture 3! Genomics assays"

Transcription

1 Genome 541! Unit 4, lecture 3! Genomics assays

2 Much easier to follow with slides. Good pace.! Having the slides was really helpful clearer to read and easier to follow the trajectory of the lecture.!! Linear algebra! A single slide of linear algebra / matrix notation might have helped.! For people who have not taken a math course for several years, it was hard to follow the convexity part of the lecture.! We all generally understand derivatives/hessians, not useful to do at this level of detail and generally not relevant.!! Convexity stuff! More time preparing examples would make the math more understandable.! The convexity proof was a bit confusing.

3 Is exp(x) convex? Proof from second derivative: d exp(x) =expx x d 2 exp(x) x 2 =expx 0 Proof by picture: Proof from definition: exp( x +(1 )x 0 )=exp( x)exp((1 )x 0 ) exp(x)+(1 )exp(x 0 ) (Arithmetic Mean / Geometric Mean inequality)

4 Is sin(x) convex? Counterexample from definition: (1/2) sin(2 )+(1/2) sin(0) = (1/2) 0+(1/2) 0 < sin((1/2) 0+(1/2) 2 ) =sin( ) =1 Counterexample by! second derivative: d sin(x) dx = cos(x) d 2 sin(x) dx 2 = sin(x) sin( ) = 1 < 0 Disproof by picture:

5 Is x 2 convex?

6 Is x 3 convex?

7 Today s class Genomics assays! Problem of the day: Can we predict TF binding at motifs based on DNA sensitivity data?! Convex optimization (without constraints)! Other problems:! Imputing the output of genomics data assays that haven t been performed! Unbiased discovery of functional elements and functional element types.

8 ChIP-exo has better spatial resolution than ChIP-seq

9 DamID measures TF binding through a fusion protein Dam+TF fusion protein Measure methylation at! GATCs DamID vs. ChIP-seq:! DamID can be easier! ChIP requires (specific) antibody! DamID requires fusion protein! DamID can t query post-transcriptional modification (histone mods)! ChIP has better spacial resolution! ChIP is limited by cross-linking bias! DamID is limited by GATC content and Dam reactivity! ChIP has better temporal resolution: Dam acts over ~24 hours

10 DNase-seq and ATAC-seq measure DNA accessibility Raj and McVicker. Nature Methods 2014

11 High-depth DNase-seq (DNase digital genomic footprinting (DGF)) measures bp-level TF binding Neph et al. Nature 2012

12 Paired-end DNase (DNase-FLASH) and ATACseq measure nucleosome architecture Vierstra et al. Nature Methods 2014

13 Converting genomics data sets into signal tracks Extend according to fragment length Sum Account for biases

14 Accounting for biases Expected signal: Average of control experiment in (for example) 1kb window.! Two representations of signal data:! Fold enrichment: observed / expected! Poisson p-value:! -log10(pois(observed expected) / Pois(observed observed))

15 Today s class Genomics assays! Problem of the day: Can we predict TF binding at motifs based on DNA sensitivity data?! Convex optimization (without constraints)! Other problems:! Imputing the output of genomics data assays that haven t been performed! Unbiased discovery of functional elements and functional element types.

16 Problem: Predict TF binding at motifs from DNase/ATAC-seq data

17 ! Several methods have been developed to address this problem FIMO+prior: Use prior based on DNase for motif scanning.! CENTIPEDE: Logistic regression.! Deep neural network.! PIQ: Protein Identification Quantification. Generative model.

18 Bound factors leave identifiable DNase-seq profiles Individual binding site prediction is difficult: Individual CTCF: Aggregate CTCF: MIT

19 Idea: Learn a characteristic profile for each TF CTCF bound? CTCF DNase read! counts Binding effect window = 400bp

20 Idea: Nearby factors contribute to profile Genomic position CTCF Oct4 Bound? DNase read! counts Binding effect window = 400bp

21 Overdispersion model: Poisson over normal Latent signal strength (μ) µ i N(µ 0, ) x i Pois(exp(µ i )) DNase read! counts (x)

22 Overdispersion model: Poisson over normal Latent signal strength (μ) µ i N(µ 0, ) x i Pois(exp(µ i )) DNase read! counts (x)

23 Binding model CTCF Binding indicator (I) Binding effect! (βctcf) Background! accessibility Signal strength (μ) DNase read! counts (x) Binding effect window = 400bp Binding! effect

24 Full model CTCF Oct4 Bound? Latent! intensity DNase read counts MX ˆµ i = µ i + i=1 m=1 I m Tm (i) NY P (X 1...N µ 1...N,I 1...M )= Pois (X i exp (ˆµ i ))

25 Today s class Genomics assays! Problem of the day: Can we predict TF binding at motifs based on DNA sensitivity data?! Convex optimization (without constraints)! Other problems:! Imputing the output of genomics data assays that haven t been performed! Unbiased discovery of functional elements and functional element types.

26 Gradient descent Gradient descent update step: x (k+1) x (k) + trf(x (k) ) t: Learning rate. Must be chosen.

27 Convergence properties of gradient descent! Gradient descent is guaranteed to converge if t is low enough.! The value of t depends on the curvature of the function. If f(x) satisfies!! krf(x) rf(y)k 2 apple Lkx yk 2 then gradient descent with t 1/L is guaranteed to converge.

28 Pros and cons of gradient descent Pros:! Very simple and easy to implement.! Requires computing only first derivative.! Updates to each variable can be computed independently.! Cons:! Requires tuning learning rate.! Slower than other methods.

29 Aside: Optimizing quadratic functions P is positive semi-definite. df dx = Px+ q df dx =0 =) x = P 1 q Optimum can be computed in closed-form.

30 Newton s method Newton s method update step: x (k+1) x (k) +(r 2 f(x (k) )) 1 rf(x (k) ) Newton s method minimizes second-order Taylor expansion of f:

31 Pros and cons of Newton s method Pros:! Extremely fast.! Guaranteed to converge (no hyperparameters).! Cons:! Requires second derivative.! Updates to each variable are not independent.

32 Variant: Coordinate descent Update each variable (or subset of variables) separately (using any method).!!!!!!! Works best when each subset has closed-form updates.

33 Variant: Stochastic gradient descent Choose a random example (or subset of examples) for each update step.! Usually much faster than gradient descent.! Requires decreasing the learning rate with each iteration in order to guarantee convergence.

34 PIQ optimization P (X 1...N µ 1...N,I 1...M )= ˆµ i = µ i + MX m=1 I m Tm (i) NY Pois (X i exp (ˆµ i )) i=1 Pois(X exp(µ)) = (1/X!) exp(xµ exp(µ)) NX `( ) = log P (X µ, I) = log 1 X! + X i ˆµ i exp(ˆµ i ) T (j) = ˆµ i (X i exp(ˆµ i T ˆµ T (j) i=1 = 1 if position i is the j th position of a motif of T. 0 otherwise.

35 PIQ optimization P (X 1...N µ 1...N,I 1...M )= ˆµ i = µ i + MX m=1 I m Tm (i) NY Pois (X i exp (ˆµ i )) i=1 Pois(X exp(µ)) = (1/X!) exp(xµ exp(µ)) NX `( ) = log P (X µ, I) = log 1 X! + X i ˆµ i exp(ˆµ i ) T (j) = ˆµ i (X i exp(ˆµ i T ˆµ T (j) i=1 = 1 if position i is the j th position of a motif of T. 0 otherwise.

36 PIQ optimization P (X 1...N µ 1...N,I 1...M )= ˆµ i = µ i + MX m=1 I m Tm (i) NY Pois (X i exp (ˆµ i )) i=1 Pois(X exp(µ)) = (1/X!) exp(xµ exp(µ)) NX `( ) = log P (X µ, I) = log 1 X! + X i ˆµ i exp(ˆµ i ) T (j) = ˆµ i (X i exp(ˆµ i T ˆµ T (j) i=1 = 1 if position i is the j th position of a motif of T. 0 otherwise.

37 PIQ predicts ChIP-seq peaks accurately

38 Today s class Genomics assays! Problem of the day: Can we predict TF binding at motifs based on DNA sensitivity data?! Convex optimization (without constraints)! Other problems:! Imputing the output of genomics data assays that haven t been performed! Unbiased discovery of functional elements and functional element types.

39 Semi-automated genome annotation algorithms partition and label the genome on the basis of functional genomics tracks H3k36me3 DNase1 RNA-seq Annotation HMMSeg: Day et al. Bioinformatics, 2007! ChromHMM: Ernst, J. and Kellis, M. Nature Biotechnology, 2010! Segway: Hoffman, M et al. Nature Methods, 2012

40 Semi-automated genome annotation algorithms use dynamic Bayesian network models Segment label DNase1 H3K27me3 RNA-seq hidden random variable observed random variable 40

41 Semi-automated genome annotation recovers known types of genome elements Enhancer Gene CTCF Hoffman et al. Nucleic Acids Research 2012.

42 Semi-automated genome at course resolution discovers chromatin domain types Quiescent domains Constitutive heterochromatin Facultative heterochromatin H3K9me3 X H3K27me3 QUI CON FAC Specific SPC expression domains Regulatory! elements BRD Broad expression domains 42

43 Today s class Genomics assays! Problem of the day: Can we predict TF binding at motifs based on DNA sensitivity data?! Convex optimization (without constraints)! Other problems:! Imputing the output of genomics data assays that haven t been performed! Unbiased discovery of functional elements and functional element types.

44 Problem: Can we impute the output of missing experiments? 316 assay types Experiment performed 346 cell types DnaseSeq H3K4me3 H3K27me3 H3K36me3 H3K9me3 H3K4me1 H3K27ac H3K9ac CTCF DnaseDgf K562 GM12878 H1-hESC HepG2 HeLa-S3 A549 IMR90 HUVEC NHEK H9ES MCF-7 ENCODE Roadmap Epigenomics

45 c t 0 Prediction function c t ō ct,m t,p m t f ct 0 (o ct 0,m t,p F ct 0,m t,p) Machine learning predictor: regression trees ō ct,m t,p = 1 C mt X c t 0 2C mt f ct0 (o ct0,m t,p F ct0,m t,p) Ernst and Kellis. Nature 2015.

46 Features c t 0 c t Other mark! (same sample)! features m t Other samples! (same mark)! features Ernst and Kellis. Nature 2015.

47 Imputed data has high correlation with observed data Ernst and Kellis. Nature 2015.

48 Imputed data recovers promoters and TSSs better than observed data Ernst and Kellis. Nature 2015.

49 Administrivia Homework 7 is up online. Due Friday ! Homework 8 will be up by the end of the week.! Next class: Chromatin 3D architecture.! Please write 1-minute responses.

Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics

Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics Genome 541 Gene regulation and epigenomics Lecture 2 Transcription factor binding using functional genomics I believe it is helpful to number your slides for easy reference. It's been a while since I took

More information

Genome 541! Unit 4, lecture 2! Transcription factor binding using functional genomics

Genome 541! Unit 4, lecture 2! Transcription factor binding using functional genomics Genome 541 Unit 4, lecture 2 Transcription factor binding using functional genomics Slides vs chalk talk: I m not sure why you chose a chalk talk over ppt. I prefer the latter no issues with readability

More information

Genome 541 Introduction to Computational Molecular Biology. Max Libbrecht

Genome 541 Introduction to Computational Molecular Biology. Max Libbrecht Genome 541 Introduction to Computational Molecular Biology Max Libbrecht Genome 541 units Max Libbrecht: Gene regulation and epigenomics Postdoc, Bill Noble s lab Yi Yin: Bayesian statistics Postdoc, Jay

More information

ECS171: Machine Learning

ECS171: Machine Learning ECS171: Machine Learning Lecture 4: Optimization (LFD 3.3, SGD) Cho-Jui Hsieh UC Davis Jan 22, 2018 Gradient descent Optimization Goal: find the minimizer of a function min f (w) w For now we assume f

More information

Gradient Descent. Lecturer: Pradeep Ravikumar Co-instructor: Aarti Singh. Convex Optimization /36-725

Gradient Descent. Lecturer: Pradeep Ravikumar Co-instructor: Aarti Singh. Convex Optimization /36-725 Gradient Descent Lecturer: Pradeep Ravikumar Co-instructor: Aarti Singh Convex Optimization 10-725/36-725 Based on slides from Vandenberghe, Tibshirani Gradient Descent Consider unconstrained, smooth convex

More information

Simple Techniques for Improving SGD. CS6787 Lecture 2 Fall 2017

Simple Techniques for Improving SGD. CS6787 Lecture 2 Fall 2017 Simple Techniques for Improving SGD CS6787 Lecture 2 Fall 2017 Step Sizes and Convergence Where we left off Stochastic gradient descent x t+1 = x t rf(x t ; yĩt ) Much faster per iteration than gradient

More information

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC

More information

ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier

ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier Data visualization, quality control, normalization & peak calling Peak annotation Presentation () Practical session

More information

Case Study 1: Estimating Click Probabilities. Kakade Announcements: Project Proposals: due this Friday!

Case Study 1: Estimating Click Probabilities. Kakade Announcements: Project Proposals: due this Friday! Case Study 1: Estimating Click Probabilities Intro Logistic Regression Gradient Descent + SGD Machine Learning for Big Data CSE547/STAT548, University of Washington Sham Kakade April 4, 017 1 Announcements:

More information

Stochastic Gradient Descent: The Workhorse of Machine Learning. CS6787 Lecture 1 Fall 2017

Stochastic Gradient Descent: The Workhorse of Machine Learning. CS6787 Lecture 1 Fall 2017 Stochastic Gradient Descent: The Workhorse of Machine Learning CS6787 Lecture 1 Fall 2017 Fundamentals of Machine Learning? Machine Learning in Practice this course What s missing in the basic stuff? Efficiency!

More information

Artificial Neural Networks. MGS Lecture 2

Artificial Neural Networks. MGS Lecture 2 Artificial Neural Networks MGS 2018 - Lecture 2 OVERVIEW Biological Neural Networks Cell Topology: Input, Output, and Hidden Layers Functional description Cost functions Training ANNs Back-Propagation

More information

An overview of deep learning methods for genomics

An overview of deep learning methods for genomics An overview of deep learning methods for genomics Matthew Ploenzke STAT115/215/BIO/BIST282 Harvard University April 19, 218 1 Snapshot 1. Brief introduction to convolutional neural networks What is deep

More information

Regression with Numerical Optimization. Logistic

Regression with Numerical Optimization. Logistic CSG220 Machine Learning Fall 2008 Regression with Numerical Optimization. Logistic regression Regression with Numerical Optimization. Logistic regression based on a document by Andrew Ng October 3, 204

More information

CSC321 Lecture 2: Linear Regression

CSC321 Lecture 2: Linear Regression CSC32 Lecture 2: Linear Regression Roger Grosse Roger Grosse CSC32 Lecture 2: Linear Regression / 26 Overview First learning algorithm of the course: linear regression Task: predict scalar-valued targets,

More information

Measuring TF-DNA interactions

Measuring TF-DNA interactions Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF

More information

Machine Learning Lecture 5

Machine Learning Lecture 5 Machine Learning Lecture 5 Linear Discriminant Functions 26.10.2017 Bastian Leibe RWTH Aachen http://www.vision.rwth-aachen.de leibe@vision.rwth-aachen.de Course Outline Fundamentals Bayes Decision Theory

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

ChIP seq peak calling. Statistical integration between ChIP seq and RNA seq

ChIP seq peak calling. Statistical integration between ChIP seq and RNA seq Institute for Computational Biomedicine ChIP seq peak calling Statistical integration between ChIP seq and RNA seq Olivier Elemento, PhD ChIP-seq to map where transcription factors bind DNA Transcription

More information

CS260: Machine Learning Algorithms

CS260: Machine Learning Algorithms CS260: Machine Learning Algorithms Lecture 4: Stochastic Gradient Descent Cho-Jui Hsieh UCLA Jan 16, 2019 Large-scale Problems Machine learning: usually minimizing the training loss min w { 1 N min w {

More information

Gaussian and Linear Discriminant Analysis; Multiclass Classification

Gaussian and Linear Discriminant Analysis; Multiclass Classification Gaussian and Linear Discriminant Analysis; Multiclass Classification Professor Ameet Talwalkar Slide Credit: Professor Fei Sha Professor Ameet Talwalkar CS260 Machine Learning Algorithms October 13, 2015

More information

Introduction to Gaussian Process

Introduction to Gaussian Process Introduction to Gaussian Process CS 778 Chris Tensmeyer CS 478 INTRODUCTION 1 What Topic? Machine Learning Regression Bayesian ML Bayesian Regression Bayesian Non-parametric Gaussian Process (GP) GP Regression

More information

Least Mean Squares Regression

Least Mean Squares Regression Least Mean Squares Regression Machine Learning Spring 2018 The slides are mainly from Vivek Srikumar 1 Lecture Overview Linear classifiers What functions do linear classifiers express? Least Squares Method

More information

INTEGRATING EPIGENETIC PRIORS FOR IMPROVING COMPUTATIONAL IDENTIFICATION OF TRANSCRIPTION FACTOR BINDING SITES AFFAN SHOUKAT

INTEGRATING EPIGENETIC PRIORS FOR IMPROVING COMPUTATIONAL IDENTIFICATION OF TRANSCRIPTION FACTOR BINDING SITES AFFAN SHOUKAT INTEGRATING EPIGENETIC PRIORS FOR IMPROVING COMPUTATIONAL IDENTIFICATION OF TRANSCRIPTION FACTOR BINDING SITES AFFAN SHOUKAT A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT

More information

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA

More information

Alignment. Peak Detection

Alignment. Peak Detection ChIP seq ChIP Seq Hongkai Ji et al. Nature Biotechnology 26: 1293-1300. 2008 ChIP Seq Analysis Alignment Peak Detection Annotation Visualization Sequence Analysis Motif Analysis Alignment ELAND Bowtie

More information

The classifier. Theorem. where the min is over all possible classifiers. To calculate the Bayes classifier/bayes risk, we need to know

The classifier. Theorem. where the min is over all possible classifiers. To calculate the Bayes classifier/bayes risk, we need to know The Bayes classifier Theorem The classifier satisfies where the min is over all possible classifiers. To calculate the Bayes classifier/bayes risk, we need to know Alternatively, since the maximum it is

More information

The classifier. Linear discriminant analysis (LDA) Example. Challenges for LDA

The classifier. Linear discriminant analysis (LDA) Example. Challenges for LDA The Bayes classifier Linear discriminant analysis (LDA) Theorem The classifier satisfies In linear discriminant analysis (LDA), we make the (strong) assumption that where the min is over all possible classifiers.

More information

CPSC 340: Machine Learning and Data Mining

CPSC 340: Machine Learning and Data Mining CPSC 340: Machine Learning and Data Mining Linear Classifiers: predictions Original version of these slides by Mark Schmidt, with modifications by Mike Gelbart. 1 Admin Assignment 4: Due Friday of next

More information

Lecture 10. Neural networks and optimization. Machine Learning and Data Mining November Nando de Freitas UBC. Nonlinear Supervised Learning

Lecture 10. Neural networks and optimization. Machine Learning and Data Mining November Nando de Freitas UBC. Nonlinear Supervised Learning Lecture 0 Neural networks and optimization Machine Learning and Data Mining November 2009 UBC Gradient Searching for a good solution can be interpreted as looking for a minimum of some error (loss) function

More information

Announcements Kevin Jamieson

Announcements Kevin Jamieson Announcements Project proposal due next week: Tuesday 10/24 Still looking for people to work on deep learning Phytolith project, join #phytolith slack channel 2017 Kevin Jamieson 1 Gradient Descent Machine

More information

Stochastic Gradient Descent

Stochastic Gradient Descent Stochastic Gradient Descent Machine Learning CSE546 Carlos Guestrin University of Washington October 9, 2013 1 Logistic Regression Logistic function (or Sigmoid): Learn P(Y X) directly Assume a particular

More information

MODEL-BASED APPROACHES FOR THE DETECTION OF BIOLOGICALLY ACTIVE GENOMIC REGIONS FROM NEXT GENERATION SEQUENCING DATA. Naim Rashid

MODEL-BASED APPROACHES FOR THE DETECTION OF BIOLOGICALLY ACTIVE GENOMIC REGIONS FROM NEXT GENERATION SEQUENCING DATA. Naim Rashid MODEL-BASED APPROACHES FOR THE DETECTION OF BIOLOGICALLY ACTIVE GENOMIC REGIONS FROM NEXT GENERATION SEQUENCING DATA Naim Rashid A dissertation submitted to the faculty of the University of North Carolina

More information

ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier

ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier ChIP-seq analysis M. Defrance, C. Herrmann, S. Le Gras, D. Puthier, M. Thomas.Chollier Visualization, quality, normalization & peak-calling Presentation (Carl Herrmann) Practical session Peak annotation

More information

Neural Network Training

Neural Network Training Neural Network Training Sargur Srihari Topics in Network Training 0. Neural network parameters Probabilistic problem formulation Specifying the activation and error functions for Regression Binary classification

More information

CSC321 Lecture 9: Generalization

CSC321 Lecture 9: Generalization CSC321 Lecture 9: Generalization Roger Grosse Roger Grosse CSC321 Lecture 9: Generalization 1 / 26 Overview We ve focused so far on how to optimize neural nets how to get them to make good predictions

More information

Optimization. Benjamin Recht University of California, Berkeley Stephen Wright University of Wisconsin-Madison

Optimization. Benjamin Recht University of California, Berkeley Stephen Wright University of Wisconsin-Madison Optimization Benjamin Recht University of California, Berkeley Stephen Wright University of Wisconsin-Madison optimization () cost constraints might be too much to cover in 3 hours optimization (for big

More information

Why should you care about the solution strategies?

Why should you care about the solution strategies? Optimization Why should you care about the solution strategies? Understanding the optimization approaches behind the algorithms makes you more effectively choose which algorithm to run Understanding the

More information

Geert Geeven. April 14, 2010

Geert Geeven. April 14, 2010 iction of Gene Regulatory Interactions NDNS+ Workshop April 14, 2010 Today s talk - Outline Outline Biological Background Construction of Predictors The main aim of my project is to better understand the

More information

Introduction to Machine Learning. Maximum Likelihood and Bayesian Inference. Lecturers: Eran Halperin, Lior Wolf

Introduction to Machine Learning. Maximum Likelihood and Bayesian Inference. Lecturers: Eran Halperin, Lior Wolf 1 Introduction to Machine Learning Maximum Likelihood and Bayesian Inference Lecturers: Eran Halperin, Lior Wolf 2014-15 We know that X ~ B(n,p), but we do not know p. We get a random sample from X, a

More information

Gradient Descent. Dr. Xiaowei Huang

Gradient Descent. Dr. Xiaowei Huang Gradient Descent Dr. Xiaowei Huang https://cgi.csc.liv.ac.uk/~xiaowei/ Up to now, Three machine learning algorithms: decision tree learning k-nn linear regression only optimization objectives are discussed,

More information

Value Function Methods. CS : Deep Reinforcement Learning Sergey Levine

Value Function Methods. CS : Deep Reinforcement Learning Sergey Levine Value Function Methods CS 294-112: Deep Reinforcement Learning Sergey Levine Class Notes 1. Homework 2 is due in one week 2. Remember to start forming final project groups and writing your proposal! Proposal

More information

Non-Convex Optimization. CS6787 Lecture 7 Fall 2017

Non-Convex Optimization. CS6787 Lecture 7 Fall 2017 Non-Convex Optimization CS6787 Lecture 7 Fall 2017 First some words about grading I sent out a bunch of grades on the course management system Everyone should have all their grades in Not including paper

More information

Linear Regression. Robot Image Credit: Viktoriya Sukhanova 123RF.com

Linear Regression. Robot Image Credit: Viktoriya Sukhanova 123RF.com Linear Regression These slides were assembled by Eric Eaton, with grateful acknowledgement of the many others who made their course materials freely available online. Feel free to reuse or adapt these

More information

Response Surface Methods

Response Surface Methods Response Surface Methods 3.12.2014 Goals of Today s Lecture See how a sequence of experiments can be performed to optimize a response variable. Understand the difference between first-order and second-order

More information

STA141C: Big Data & High Performance Statistical Computing

STA141C: Big Data & High Performance Statistical Computing STA141C: Big Data & High Performance Statistical Computing Lecture 8: Optimization Cho-Jui Hsieh UC Davis May 9, 2017 Optimization Numerical Optimization Numerical Optimization: min X f (X ) Can be applied

More information

Neural Networks in Structured Prediction. November 17, 2015

Neural Networks in Structured Prediction. November 17, 2015 Neural Networks in Structured Prediction November 17, 2015 HWs and Paper Last homework is going to be posted soon Neural net NER tagging model This is a new structured model Paper - Thursday after Thanksgiving

More information

#33 - Genomics 11/09/07

#33 - Genomics 11/09/07 BCB 444/544 Required Reading (before lecture) Lecture 33 Mon Nov 5 - Lecture 31 Phylogenetics Parsimony and ML Chp 11 - pp 142 169 Genomics Wed Nov 7 - Lecture 32 Machine Learning Fri Nov 9 - Lecture 33

More information

Bioinformatics 2 - Lecture 4

Bioinformatics 2 - Lecture 4 Bioinformatics 2 - Lecture 4 Guido Sanguinetti School of Informatics University of Edinburgh February 14, 2011 Sequences Many data types are ordered, i.e. you can naturally say what is before and what

More information

Logistic Regression. COMP 527 Danushka Bollegala

Logistic Regression. COMP 527 Danushka Bollegala Logistic Regression COMP 527 Danushka Bollegala Binary Classification Given an instance x we must classify it to either positive (1) or negative (0) class We can use {1,-1} instead of {1,0} but we will

More information

Computational Genomics. Systems biology. Putting it together: Data integration using graphical models

Computational Genomics. Systems biology. Putting it together: Data integration using graphical models 02-710 Computational Genomics Systems biology Putting it together: Data integration using graphical models High throughput data So far in this class we discussed several different types of high throughput

More information

Machine Learning for NLP

Machine Learning for NLP Machine Learning for NLP Linear Models Joakim Nivre Uppsala University Department of Linguistics and Philology Slides adapted from Ryan McDonald, Google Research Machine Learning for NLP 1(26) Outline

More information

CS 6140: Machine Learning Spring What We Learned Last Week 2/26/16

CS 6140: Machine Learning Spring What We Learned Last Week 2/26/16 Logis@cs CS 6140: Machine Learning Spring 2016 Instructor: Lu Wang College of Computer and Informa@on Science Northeastern University Webpage: www.ccs.neu.edu/home/luwang Email: luwang@ccs.neu.edu Sign

More information

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species 02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb

More information

Warm up. Regrade requests submitted directly in Gradescope, do not instructors.

Warm up. Regrade requests submitted directly in Gradescope, do not  instructors. Warm up Regrade requests submitted directly in Gradescope, do not email instructors. 1 float in NumPy = 8 bytes 10 6 2 20 bytes = 1 MB 10 9 2 30 bytes = 1 GB For each block compute the memory required

More information

CSC321 Lecture 9: Generalization

CSC321 Lecture 9: Generalization CSC321 Lecture 9: Generalization Roger Grosse Roger Grosse CSC321 Lecture 9: Generalization 1 / 27 Overview We ve focused so far on how to optimize neural nets how to get them to make good predictions

More information

CSCI 1951-G Optimization Methods in Finance Part 12: Variants of Gradient Descent

CSCI 1951-G Optimization Methods in Finance Part 12: Variants of Gradient Descent CSCI 1951-G Optimization Methods in Finance Part 12: Variants of Gradient Descent April 27, 2018 1 / 32 Outline 1) Moment and Nesterov s accelerated gradient descent 2) AdaGrad and RMSProp 4) Adam 5) Stochastic

More information

Nonparametric Bayesian Methods (Gaussian Processes)

Nonparametric Bayesian Methods (Gaussian Processes) [70240413 Statistical Machine Learning, Spring, 2015] Nonparametric Bayesian Methods (Gaussian Processes) Jun Zhu dcszj@mail.tsinghua.edu.cn http://bigml.cs.tsinghua.edu.cn/~jun State Key Lab of Intelligent

More information

Cheng Soon Ong & Christian Walder. Canberra February June 2018

Cheng Soon Ong & Christian Walder. Canberra February June 2018 Cheng Soon Ong & Christian Walder Research Group and College of Engineering and Computer Science Canberra February June 2018 Outlines Overview Introduction Linear Algebra Probability Linear Regression

More information

ECS289: Scalable Machine Learning

ECS289: Scalable Machine Learning ECS289: Scalable Machine Learning Cho-Jui Hsieh UC Davis Sept 29, 2016 Outline Convex vs Nonconvex Functions Coordinate Descent Gradient Descent Newton s method Stochastic Gradient Descent Numerical Optimization

More information

CS 6501: Deep Learning for Computer Graphics. Basics of Neural Networks. Connelly Barnes

CS 6501: Deep Learning for Computer Graphics. Basics of Neural Networks. Connelly Barnes CS 6501: Deep Learning for Computer Graphics Basics of Neural Networks Connelly Barnes Overview Simple neural networks Perceptron Feedforward neural networks Multilayer perceptron and properties Autoencoders

More information

1. Method 1: bisection. The bisection methods starts from two points a 0 and b 0 such that

1. Method 1: bisection. The bisection methods starts from two points a 0 and b 0 such that Chapter 4 Nonlinear equations 4.1 Root finding Consider the problem of solving any nonlinear relation g(x) = h(x) in the real variable x. We rephrase this problem as one of finding the zero (root) of a

More information

Machine Learning (CS 567) Lecture 2

Machine Learning (CS 567) Lecture 2 Machine Learning (CS 567) Lecture 2 Time: T-Th 5:00pm - 6:20pm Location: GFS118 Instructor: Sofus A. Macskassy (macskass@usc.edu) Office: SAL 216 Office hours: by appointment Teaching assistant: Cheol

More information

Accelerated Block-Coordinate Relaxation for Regularized Optimization

Accelerated Block-Coordinate Relaxation for Regularized Optimization Accelerated Block-Coordinate Relaxation for Regularized Optimization Stephen J. Wright Computer Sciences University of Wisconsin, Madison October 09, 2012 Problem descriptions Consider where f is smooth

More information

Cheng Soon Ong & Christian Walder. Canberra February June 2018

Cheng Soon Ong & Christian Walder. Canberra February June 2018 Cheng Soon Ong & Christian Walder Research Group and College of Engineering and Computer Science Canberra February June 218 Outlines Overview Introduction Linear Algebra Probability Linear Regression 1

More information

Lecture 4 Towards Deep Learning

Lecture 4 Towards Deep Learning Lecture 4 Towards Deep Learning (January 30, 2015) Mu Zhu University of Waterloo Deep Network Fields Institute, Toronto, Canada 2015 by Mu Zhu 2 Boltzmann Distribution probability distribution for a complex

More information

Class 4: Classification. Quaid Morris February 11 th, 2011 ML4Bio

Class 4: Classification. Quaid Morris February 11 th, 2011 ML4Bio Class 4: Classification Quaid Morris February 11 th, 211 ML4Bio Overview Basic concepts in classification: overfitting, cross-validation, evaluation. Linear Discriminant Analysis and Quadratic Discriminant

More information

Machine Learning. Lecture 04: Logistic and Softmax Regression. Nevin L. Zhang

Machine Learning. Lecture 04: Logistic and Softmax Regression. Nevin L. Zhang Machine Learning Lecture 04: Logistic and Softmax Regression Nevin L. Zhang lzhang@cse.ust.hk Department of Computer Science and Engineering The Hong Kong University of Science and Technology This set

More information

Comparison of Modern Stochastic Optimization Algorithms

Comparison of Modern Stochastic Optimization Algorithms Comparison of Modern Stochastic Optimization Algorithms George Papamakarios December 214 Abstract Gradient-based optimization methods are popular in machine learning applications. In large-scale problems,

More information

CS-E3210 Machine Learning: Basic Principles

CS-E3210 Machine Learning: Basic Principles CS-E3210 Machine Learning: Basic Principles Lecture 3: Regression I slides by Markus Heinonen Department of Computer Science Aalto University, School of Science Autumn (Period I) 2017 1 / 48 In a nutshell

More information

Machine Learning (CS 567) Lecture 3

Machine Learning (CS 567) Lecture 3 Machine Learning (CS 567) Lecture 3 Time: T-Th 5:00pm - 6:20pm Location: GFS 118 Instructor: Sofus A. Macskassy (macskass@usc.edu) Office: SAL 216 Office hours: by appointment Teaching assistant: Cheol

More information

Neural Networks and Deep Learning

Neural Networks and Deep Learning Neural Networks and Deep Learning Professor Ameet Talwalkar November 12, 2015 Professor Ameet Talwalkar Neural Networks and Deep Learning November 12, 2015 1 / 16 Outline 1 Review of last lecture AdaBoost

More information

Large-Scale Feature Learning with Spike-and-Slab Sparse Coding

Large-Scale Feature Learning with Spike-and-Slab Sparse Coding Large-Scale Feature Learning with Spike-and-Slab Sparse Coding Ian J. Goodfellow, Aaron Courville, Yoshua Bengio ICML 2012 Presented by Xin Yuan January 17, 2013 1 Outline Contributions Spike-and-Slab

More information

Midterm. Introduction to Machine Learning. CS 189 Spring Please do not open the exam before you are instructed to do so.

Midterm. Introduction to Machine Learning. CS 189 Spring Please do not open the exam before you are instructed to do so. CS 89 Spring 07 Introduction to Machine Learning Midterm Please do not open the exam before you are instructed to do so. The exam is closed book, closed notes except your one-page cheat sheet. Electronic

More information

INTRODUCTION TO DATA SCIENCE

INTRODUCTION TO DATA SCIENCE INTRODUCTION TO DATA SCIENCE JOHN P DICKERSON Lecture #13 3/9/2017 CMSC320 Tuesdays & Thursdays 3:30pm 4:45pm ANNOUNCEMENTS Mini-Project #1 is due Saturday night (3/11): Seems like people are able to do

More information

LECTURE 22: SWARM INTELLIGENCE 3 / CLASSICAL OPTIMIZATION

LECTURE 22: SWARM INTELLIGENCE 3 / CLASSICAL OPTIMIZATION 15-382 COLLECTIVE INTELLIGENCE - S19 LECTURE 22: SWARM INTELLIGENCE 3 / CLASSICAL OPTIMIZATION TEACHER: GIANNI A. DI CARO WHAT IF WE HAVE ONE SINGLE AGENT PSO leverages the presence of a swarm: the outcome

More information

NONLINEAR CLASSIFICATION AND REGRESSION. J. Elder CSE 4404/5327 Introduction to Machine Learning and Pattern Recognition

NONLINEAR CLASSIFICATION AND REGRESSION. J. Elder CSE 4404/5327 Introduction to Machine Learning and Pattern Recognition NONLINEAR CLASSIFICATION AND REGRESSION Nonlinear Classification and Regression: Outline 2 Multi-Layer Perceptrons The Back-Propagation Learning Algorithm Generalized Linear Models Radial Basis Function

More information

Warm up: risk prediction with logistic regression

Warm up: risk prediction with logistic regression Warm up: risk prediction with logistic regression Boss gives you a bunch of data on loans defaulting or not: {(x i,y i )} n i= x i 2 R d, y i 2 {, } You model the data as: P (Y = y x, w) = + exp( yw T

More information

Marks. bonus points. } Assignment 1: Should be out this weekend. } Mid-term: Before the last lecture. } Mid-term deferred exam:

Marks. bonus points. } Assignment 1: Should be out this weekend. } Mid-term: Before the last lecture. } Mid-term deferred exam: Marks } Assignment 1: Should be out this weekend } All are marked, I m trying to tally them and perhaps add bonus points } Mid-term: Before the last lecture } Mid-term deferred exam: } This Saturday, 9am-10.30am,

More information

Classification CE-717: Machine Learning Sharif University of Technology. M. Soleymani Fall 2012

Classification CE-717: Machine Learning Sharif University of Technology. M. Soleymani Fall 2012 Classification CE-717: Machine Learning Sharif University of Technology M. Soleymani Fall 2012 Topics Discriminant functions Logistic regression Perceptron Generative models Generative vs. discriminative

More information

Introduction to Logistic Regression and Support Vector Machine

Introduction to Logistic Regression and Support Vector Machine Introduction to Logistic Regression and Support Vector Machine guest lecturer: Ming-Wei Chang CS 446 Fall, 2009 () / 25 Fall, 2009 / 25 Before we start () 2 / 25 Fall, 2009 2 / 25 Before we start Feel

More information

Lecture 5: Linear models for classification. Logistic regression. Gradient Descent. Second-order methods.

Lecture 5: Linear models for classification. Logistic regression. Gradient Descent. Second-order methods. Lecture 5: Linear models for classification. Logistic regression. Gradient Descent. Second-order methods. Linear models for classification Logistic regression Gradient descent and second-order methods

More information

Machine Learning Lecture 7

Machine Learning Lecture 7 Course Outline Machine Learning Lecture 7 Fundamentals (2 weeks) Bayes Decision Theory Probability Density Estimation Statistical Learning Theory 23.05.2016 Discriminative Approaches (5 weeks) Linear Discriminant

More information

Ad Placement Strategies

Ad Placement Strategies Case Study 1: Estimating Click Probabilities Tackling an Unknown Number of Features with Sketching Machine Learning for Big Data CSE547/STAT548, University of Washington Emily Fox 2014 Emily Fox January

More information

Automatic Differentiation and Neural Networks

Automatic Differentiation and Neural Networks Statistical Machine Learning Notes 7 Automatic Differentiation and Neural Networks Instructor: Justin Domke 1 Introduction The name neural network is sometimes used to refer to many things (e.g. Hopfield

More information

Computational statistics

Computational statistics Computational statistics Lecture 3: Neural networks Thierry Denœux 5 March, 2016 Neural networks A class of learning methods that was developed separately in different fields statistics and artificial

More information

Ad Placement Strategies

Ad Placement Strategies Case Study : Estimating Click Probabilities Intro Logistic Regression Gradient Descent + SGD AdaGrad Machine Learning for Big Data CSE547/STAT548, University of Washington Emily Fox January 7 th, 04 Ad

More information

CS 179: LECTURE 16 MODEL COMPLEXITY, REGULARIZATION, AND CONVOLUTIONAL NETS

CS 179: LECTURE 16 MODEL COMPLEXITY, REGULARIZATION, AND CONVOLUTIONAL NETS CS 179: LECTURE 16 MODEL COMPLEXITY, REGULARIZATION, AND CONVOLUTIONAL NETS LAST TIME Intro to cudnn Deep neural nets using cublas and cudnn TODAY Building a better model for image classification Overfitting

More information

IPAM Summer School Optimization methods for machine learning. Jorge Nocedal

IPAM Summer School Optimization methods for machine learning. Jorge Nocedal IPAM Summer School 2012 Tutorial on Optimization methods for machine learning Jorge Nocedal Northwestern University Overview 1. We discuss some characteristics of optimization problems arising in deep

More information

Variables which are always unobserved are called latent variables or sometimes hidden variables. e.g. given y,x fit the model p(y x) = z p(y x,z)p(z)

Variables which are always unobserved are called latent variables or sometimes hidden variables. e.g. given y,x fit the model p(y x) = z p(y x,z)p(z) CSC2515 Machine Learning Sam Roweis Lecture 8: Unsupervised Learning & EM Algorithm October 31, 2006 Partially Unobserved Variables 2 Certain variables q in our models may be unobserved, either at training

More information

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye! Today Gene regulation Synteny Good bye! Gene regulation What governs gene transcription? Genes active under different circumstances. Gene regulation What governs gene transcription? Genes active under

More information

CPSC 540: Machine Learning

CPSC 540: Machine Learning CPSC 540: Machine Learning First-Order Methods, L1-Regularization, Coordinate Descent Winter 2016 Some images from this lecture are taken from Google Image Search. Admin Room: We ll count final numbers

More information

Algorithms for NLP. Language Modeling III. Taylor Berg-Kirkpatrick CMU Slides: Dan Klein UC Berkeley

Algorithms for NLP. Language Modeling III. Taylor Berg-Kirkpatrick CMU Slides: Dan Klein UC Berkeley Algorithms for NLP Language Modeling III Taylor Berg-Kirkpatrick CMU Slides: Dan Klein UC Berkeley Announcements Office hours on website but no OH for Taylor until next week. Efficient Hashing Closed address

More information

Sparse vectors recap. ANLP Lecture 22 Lexical Semantics with Dense Vectors. Before density, another approach to normalisation.

Sparse vectors recap. ANLP Lecture 22 Lexical Semantics with Dense Vectors. Before density, another approach to normalisation. ANLP Lecture 22 Lexical Semantics with Dense Vectors Henry S. Thompson Based on slides by Jurafsky & Martin, some via Dorota Glowacka 5 November 2018 Previous lectures: Sparse vectors recap How to represent

More information

ANLP Lecture 22 Lexical Semantics with Dense Vectors

ANLP Lecture 22 Lexical Semantics with Dense Vectors ANLP Lecture 22 Lexical Semantics with Dense Vectors Henry S. Thompson Based on slides by Jurafsky & Martin, some via Dorota Glowacka 5 November 2018 Henry S. Thompson ANLP Lecture 22 5 November 2018 Previous

More information

Least Mean Squares Regression. Machine Learning Fall 2018

Least Mean Squares Regression. Machine Learning Fall 2018 Least Mean Squares Regression Machine Learning Fall 2018 1 Where are we? Least Squares Method for regression Examples The LMS objective Gradient descent Incremental/stochastic gradient descent Exercises

More information

GRADIENT = STEEPEST DESCENT

GRADIENT = STEEPEST DESCENT GRADIENT METHODS GRADIENT = STEEPEST DESCENT Convex Function Iso-contours gradient 0.5 0.4 4 2 0 8 0.3 0.2 0. 0 0. negative gradient 6 0.2 4 0.3 2.5 0.5 0 0.5 0.5 0 0.5 0.4 0.5.5 0.5 0 0.5 GRADIENT DESCENT

More information

Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)

More information

Sample questions for Fundamentals of Machine Learning 2018

Sample questions for Fundamentals of Machine Learning 2018 Sample questions for Fundamentals of Machine Learning 2018 Teacher: Mohammad Emtiyaz Khan A few important informations: In the final exam, no electronic devices are allowed except a calculator. Make sure

More information

Distributed Estimation, Information Loss and Exponential Families. Qiang Liu Department of Computer Science Dartmouth College

Distributed Estimation, Information Loss and Exponential Families. Qiang Liu Department of Computer Science Dartmouth College Distributed Estimation, Information Loss and Exponential Families Qiang Liu Department of Computer Science Dartmouth College Statistical Learning / Estimation Learning generative models from data Topic

More information