The influence of genes regulating transmembrane transport of Na + on the salt resistance of Aeluropus lagopoides

Transcription

1 CSIRO PUBLISHING Funtionl Plnt Biology The influene of genes regulting trnsmemrne trnsport of N + on the slt resistne of Aeluropus lgopoides Muhmmd Zheer Ahmed A,B, Tkyoshi Shimzki B, Slmn Gulzr A, Akir Kikuhi B, Bilquees Gul A, M. Ajml Khn A,C,F, Hns W. Koyro D, Bernhrd Huhzermeyer E nd Kzuo N. Wtne B A Institute of Sustinle Hlophyte Utilistion (ISHU), University of Krhi, Krhi-7527, Pkistn. B Gene Reserh Center, University of Tsuku, Tennodi, Tsuku City, Irki, , Jpn. C Qtr Shell Professoril Chir of Sustinle Development, Deprtment of Interntionl Affirs, College of Arts nd Sienes, Qtr University, PO Box 2713, Doh, Qtr. D Institute of Plnt Eology, Justus-Lieig University Gießen, D Gießen, Germny. E Institute of Botny, Leiniz Universität Hnnover, Herrenhäuser Str. 2, 3419 Hnnover, Germny. F Corresponding uthor. Emil: jml.khn@qu.edu.q This pper origintes from presenttion t the COST WG2 Meeting Putting hlophytes to work genetis, iohemistry nd physiology Hnnover, Germny, August 212. Astrt. Plntlets of Aeluropus lgopoides (Linn.) Trin. Ex Thw. were grown t different NCl onentrtions (26, 167, 373 nd 747 mm) for 3, 7 nd 15 dys; their growth, osmoti djustment, gs exhnge, ion omprtmentlistion nd expression of vrious genes relted to N + flux ws studied. Plntlets showed optiml growth in non-sline (ontrol; 26 mm NCl) solutions, wheres CO 2 /H 2 O gs exhnge, lef wter onentrtion nd wter use effiieny deresed under ll slinity tretments, ompnied y inresed lef senesene, root sh, sodium ontent nd lef osmollity. A derese in mlondildehyde (MDA) ontent with time ws orrelted with N + umultion in the lef poplst nd onomitnt inrese in N + seretion rte. A. lgopoides umulted higher onentrtion of N + in root thn in lef vuoles, orresponding with higher expression of V-NHX nd lower expression of PM-NHX in root thn lef tissue. It ppers tht V-ATPse plys vitl role during N + trnsport y produing n eletromotive fore, driving ion trnsport. Lef lium inresed with inresing slinity, with more rpid umultion t high slinity thn t low slinity, inditing possile involvement of C 2+ in mintining K + :N + rtio. Our results suggest tht A. lgopoides suessfully omprtmentlised N + t slinities up to 373 mm NCl y upregulting the gene expression of memrne linked trnsport proteins (V-NHX nd PM-NHX). At higher slinity (747 mm NCl), redution in the expression of V-NHX nd PM-NHX in leves without ny hnge in the rte of slt seretion, is possile use of the toxiity of NCl. Additionl keywords: gene expression, growth, ion regultion, N + sequestrtion, photosynthesis, slt stress. Reeived 18 Novemer 212, epted 24 Jnury 213, pulished online 4 Mrh 213 Introdution Slinity is one of the most importnt environmentl ftors tht limit plnt growth nd produtivity worldwide (Koyro et l. 211). Given this senrio, there is need to improve slt tolerne of rops, tsk requiring etter understnding of this multi-geni trit. The detrimentl effets of slinity on plnts inlude osmoti stress nd exessive N + umultion in the ytoplsm, whih ffets ritil iohemil proesses (Mthuis nd Amtmnn 1999), with disturne of ion homeostsis, dmge to plsm memrne integrity (Kwski et l. 21) nd impt on photosyntheti mhinery (Aogdllh 21). This omplexity exists oth in hlophytes nd glyophytes (Zhu 21; Tester nd Dvenport 23), lthough pproprite regultion of the trnsriptome in Journl ompiltion CSIRO 213 hlophytes ontrols n rry of physiologil proesses tht mkes them slt resistnt (Mthuis nd Amtmnn 1999; Zhu 21). The survivl of plnts on sline medi depends on ion-speifi mehnisms suh s the omprtmentlistion of K + in the ytoplsm nd N + in the vuole, in ddition to osmoti djustment nd defene ginst oxidtive stress (Blumwld 2; Chen et l. 27; Cosentino et l. 21). Plnts my redue the quntity of N + nd mintin higher K + :N + rtios in ytoplsm, prtiulrly in photosyntheti tissues, y limiting unidiretionl N + influx into roots (Wng et l. 29), reduing entry of N + into the xylem strem, retrievl of N + from the xylem (Tester nd Dvenport 23), re-trnslotion of N + from

2 B Funtionl Plnt Biology M. Z. Ahmed et l. shoots to roots, omprtmentlistion of N + into vuoles or ell wlls nd seretion from ove ground tissues (Nz et l. 29). The omprtmentlistion of N + in ellulr orgnelles provides n effiient mehnism to prevent its deleterious effets in the ytosol nd lso to hieve lower wter potentil ompred with the growth medi (Blumwld 2; Tester nd Dvenport 23; Flowers nd Colmer 28). The tive outwrd trnsport of N + from the ell nd omprtmentlistion in vuoles is medited vi slt overly sensitive (SOS) pthwy (SOS1: PM-NHX) nd tonoplst N + :H + ntiporter (V-NHX), respetively, using energy generted through H + -trnsloting ATPses (H + -ATPse) or pyrophosphtse (H + -PPse). Tissue speifi N + prtitioning is n importnt strtegy whih is speies dependent (Flowers nd Colmer 28). Monoots do umulte N + in lower rtio with K + in shoots ompred with diots (Flowers nd Colmer 28; Mrum 28) nd ~15% of monootyledonous hlophytes exrete N + nd Cl through i-ellulr epiderml slt glnds (Adms et l. 1998). Overexpression of genes relted to N + flux hs een reported to improve slt tolerne in some plnts (Xue et l. 24; Heet l. 25). Suh studies indite tht N + omprtmentlistion into the vuole nd expression of V-NHX, H + -ATPse, H + -PPse nd SOS1 ply mjor role in slt tolerne (Oh et l. 29). Moreover, N + sequestrtion in the vuole lso implies prevention of its leking k into ytosol (Shl nd Mky 211). Aeluropus lgopoides (Linn.) Trin. Ex Thw. (Poee) is stoloniferous, slt sereting, perennil grss tht is distriuted in semi-desert limtes (Vziri et l. 211). This grss n survive in up to 1 M NCl; however, slinity greter thn 3 mm NCl is onsidered toxi (Gulzr et l. 23). A. lgopoides is eing utilised s forge in some prts of Indi nd the Irnin plteu euse of low shoot sodium onentrtion (Tortinejd et l. 2). A. lgopoides n lso e used to prevent soil erosion nd id snd dune stilistion due to its highly developed network of roots nd high slinity tolerne (Tewri 197). A. lgopoides is lso reported s wild reltive of whet (Rzvi et l. 26). Therefore, it is suitle model plnt to understnd the slt resistne mehnism in grsses nd ould help to develop slt resistne of erels (Flowers nd Colmer 28). The possiility of improving slt resistne in whet y symmetri somti hyridistion long with its wild reltive hs een reported (Yue et l. 21). Severl other eologil nd physiologil studies on A. lgopoides hve een onduted (Wghmode nd Joshi 1982; Wghmode nd Hegde 1984; Joshi nd Bhoite 1988; Sher et l. 1994; Bhskrn nd Selvrj 1997; Arsji 2), whih indites tht it umultes sustntil mounts of N + nd Cl in its roots. Sohnin et l.(21) reported tht its slts sereting ility helps in regulting shoot N + of A. lgopoides seedlings rised in 45 mm NCl for 1 dys. They lso determined, using proteomis, tht 2.1% of proteins were upregulted, wheres 2.4% were downregulted. Those upregulted were ssoited with energy formtion, mino id iosynthesis, C 4 photosynthesis nd detoxifition, whih my e involved in slt resistne of A. lgopoides. Similrly, Rzvi et l.(26) using differentil disply mplified frgment length polymorphism (DD-AFLP) predited possile involvement of genes relted to the signlling sdes, regultion of gene expression nd osmoti djustment in the survivl of A. lgopoides under hrsh onditions (suh s drought). However, informtion is lking out hnges in gene expression s relted to hnges in growth nd physiologil nd iohemil mehnisms. Therefore, we investigted erly nd lte responses of plnt growth, physiologil mehnisms nd expression of N + mnipulting genes, s well s the regultion of N +,ina. lgopoides in vrious slinities (26, 167, 373 nd 747 mm NCl). The ojetives of the present work were to: (1) investigte the hnges in the response of growth, gs exhnge, wter reltions nd N + flux under NCl; (2) investigte the oordintion etween root nd lef tissues for modulting N + flux; (3) oserve the reltionship etween kinetis of N + umultion nd expression of N + mnipulting genes; nd (4) understnd the importne of temporl vrition in slt seretion nd the expression of N + mnipulting genes in NCl resistne of A. lgopoides. Mterils nd methods Plnt mteril Aeluropus lgopoides (Linn.) Trin. Ex Thw. ws olleted from ostl hitts of Hwks By, Krhi, Pkistn ( N, E) nd perpetul ulture in green net-enlosed system tht redues light y 6% nd filittes ir irultion (semi-mient environmentl ondition) ws estlished. Plntlets originting from tillers of A. lgopoides growing in eh snd were su-irrigted with hlf-strength Hoglnd nutrient solution (Hoglnd nd Arnon 195). Growth onditions Plntlets of A. lgopoides were trnsferred to pots (one plnt per pot; pot size: 6 1 m) ontining wshed soil olleted from nturl popultions of A. lgopoides nd suirrigted with nutrient solution. Plntlets were grown under the semi-mient environmentl onditions desried ove. Plntlets of similr size (1 month old; six lef stge) were seleted for the experiment nd divided into four groups (26, 167, 373 nd 747 mm NCl; 48 plntlets per group) whih were further distriuted into four sugroups (, 3, 7 nd 15 dys; 12 plntlets per su-group). The ontrol group ws irrigted with nutrient solution (whih ontined 26 mm NCl) nd sline tretments were given using NCl in Hoglnd solution solutions (Tle 1). The slinity ws inresed stepwise (15 mm NCl dily) until the desired onentrtion ws rehed. The volume of nutrient solutions Tle 1. NCl tretment (mm) Conentrtion of N + nd K +, eletril ondutivity, ph nd osmoti potentil in used NCl tretments N + (mm) K + (mm) EC (ms m 1 ) ph OP (mosmol kg 1 H 2 O)

3 Slt resistne in Aeluropus lgopoides Funtionl Plnt Biology C ws djusted with wter every lternte dy to ompenste for evportion nd ws repled fter 5 dys. Hrvest nd growth prmeters Plnts were hrvested on, 3, 7 nd 15 dys fter the desired slt onentrtions were rehed. Eh individul ws refully removed from the soil nd the leves wshed y dipping twie in distilled wter for few seonds nd then wiped with tissue pper nd roots were wshed with respetive NCl solution followed y ie-old 1 mm CCl 2 solution (to remove sodium from surfe). Roots nd shoots were seprted nd FW determined for eh plnt. A portion of the fresh smples were immeditely frozen in liquid nitrogen, stored t 8 C nd susequently freeze-dried. The reminder of the smples ws oven-dried t 75 C for 48 h (when no weight hnge ws oserved). Tissue wter onentrtion (WC) for shoot nd root ws determined seprtely using the eqution: WC = ((FW DW)/FW) 1. The growth rte of A. lgopoides ws determined using four individul, from eh slinity tretment. Non-destrutive prmeters (shoot length, lef length nd numer of leves inluding totl nd senesed leves were reorded fter, 3, 7 nd 15 dys from the strt of the experiment. Mesurement of N +,K + nd C 2+ in tissue sp To determine the onentrtion of N +,K + nd C 2+ in lef nd root tissues press-sp ws used. Root nd fully-expnded young leves (third node from the tip) were rinsed (s indited ove) immeditely efore olletion from individuls growing in different NCl tretments fter, 3, 7 nd 15 dys. Smpled were wrpped in luminium foil nd immeditely frozen t 18 C. Close to the time of mesurements, frozen smples were thwed nd hnd squeezed to extrt ll the sp s desried y Cuin et l. (29). Extrted smples were mixed thoroughly, diluted nd used for the determintion of N +,K + nd C 2+ y tomi sorption spetrometer (AA-7; Perkin Elmer, Snt Clr, CA, USA). We estimted the seletive sorption rtio of K + vs N + from the medium (SA) nd the seletive trnsport rtio of K + vs N + from root-to-shoot (ST) ws lulted using the following formule (Deez et l. 21): SA ¼ ½K=ðK þ NÞŠ root ½K=ðK þ NÞŠ medium ; ST ¼ ½K=ðK þ NÞŠ lef ½K=ðK þ NÞŠ root : Determintion of N + onentrtion in the lef poplst nd symplst Five plnts were hrvested from 26 nd 747 mm NCl tretments fter 15 dys of tretment. Aoveground prts of plnts were divided into three equl zones (lower (first 3 nodes from ground), middle (4 6 nodes) nd upper (7 9 nodes)). Leves were olleted from eh zone nd sp from the poplst nd symplst olleted seprtely y entrifugtion (Yu et l. 1999). The smples were spun t 2g for 15 min t 4 C to otin the poplsti sp. After entrifugtion, smples were frozen t 8 C for 4 h nd then thwed t room temperture efore ð1þ ð2þ extrtion of the symplsmi sp y entrifugtion t 2g for 15 min t 4 C. N + onentrtion in the sp ws determined y tomi sorption spetrometer (Perkin Elmer). Seretion of N + To determine the rte of N + seretion, leves were rinsed with 2 ml deionised wter in Eppendorf tues (Eppendorf, Sn Diego, CA, USA). Fully expnded young leves (third node from the top) of three plntlets were tgged from eh sugroup (, 3, 7 nd 15 dys) of NCl tretments (26, 167, 373 nd 747 mm). Tgged leves of eh sugroup were prewshed 3 dys efore the olletion of dt (, 3, 7 nd 15 dys of experiment). The mount of N + sereted ws determined y tomi sorption spetrometer (Perkin Elmer) nd the re of rinsed leves ws determined y ImgeJ softwre ver ( ij/, essed 1 Septemer 21). The rte of N + seretion ws expressed in mmol N + m 2 dy 1. Lef osmollity Sp ws extrted (s indited ove) from the frozen leves nd used diretly to determine the osmollity y vpour pressure osmometer (VAPRO-552; Wesor In., Logn, UT, USA) (Gui et l. 1991). The ontriution of N + nd K + to lef y s ws lulted y vn t Hoff eqution (Krmer nd Boyer 1995). Gs-exhnge mesurements The rte of net photosynthesis (P n ), respirtion (R), stomtl ondutne (g s ) nd trnspirtion (E) were mesured on rndomly hosen plntlets (n = 4) from eh slinity tretment fter, 3, 7 nd 15 dys from the dy of NCl pplition. Mesurements were tken on fully-expnded leves (from third node) using 2 3 m hmer (64 8 ler hmer ottom) of portle photosynthesis system (64XT, Li-Cor In., Linoln, NE, USA) t mient RH 6 8%, referene CO 2 of 38 mmol m 2 s 1, flow rte of 5 mmol s 1 nd photosynthetilly tive rdition of 6 mmol m 2 s 1. Eh lef ws first equilirted in the hmer until onstnt redings were otined. Lipid peroxidtion/mlondildehyde ontent The level of lipid peroxidtion in lef smples ws determined in terms of mlondildehyde (MDA) ontent (Heth nd Pker 1968). For the MDA ssy,.1 g fresh tissue (root nd shoot) ws homogenised with 1 ml trihloroeti id (TCA) 1% nd entrifuged t 1 g for 5 min t 4 C (Sorvl Evolution RC, Kendro, Newtown, CT, USA). For mesurement of MDA onentrtion, 4 ml of 2% trihloroeti id ontining.5% 2-thiorituri id ws dded to 1 ml liquot of the superntnt. The mixture ws heted t 95 C for 3 min, ooled quikly in n ie th nd then entrifuged t 1 g for 1 min t 4 C. The sorne of the superntnt ws red t 532 nd 6 nm. The onentrtion of MDA ws lulted using the MDA extintion oeffiient of 155 mm 1 m 1. The result of MDA ws expressed s mgmg 1 FW. Quntifition of gene expression y qrt PCR RNA ws extrted from A. lgopoides lef nd root tissues (n = 4), hrvested t, 3, 7 nd 15 dys from eh tretment

4 D Funtionl Plnt Biology M. Z. Ahmed et l. (26, 167, 373 nd 747 mm NCl). Smples were frozen in liquid nitrogen, ground fine nd RNA extrted with n RNAqueous Kit (Amion, Austin, TX, USA). Qulity nd quntity of RNA ws heked using Spetrophotometer (DU Series 7, Bekmn Coulter) nd integrity y eletrophoresis on 1% grose gel. DNA ws removed from RNA smples using DNse (DNA free kit, Amion) following the mnufturer s instrutions. First-strnd of DNA ws synthesised from 1 mg RNA (DNA free) y using the protool of DNA Tkr RNA PCR Kit (AMV; ver 3.). The DNA ws ooled to 4 C nd stored t 2 C for susequent use for expression nlysis of different genes. For quntittive rel time PCR (qrt PCR), primers (see Tle 2) were designed using seleted gene sequenes of A. lgopoides present in the NCBI dtse. Atin gene of A. lgopoides ws used s n internl referene for qrt PCR. Quntittive RT PCR of different genes ws performed y using the protool for 2 ml retion mixture in light yler-rousel-sed system (Rohe Dignostis, Almed, CA, USA). Dilutions of the extrted plsmid (from 1 4 to 1 8 pg) were used in qrt PCR to plot stndrd urves of seleted genes. Dilutions for stndrd urve, DNA of smples (from eh NCl tretment nd time period) nd negtive ontrols were run in duplite. PCR effiieny ws lulted with ll stndrd urves hving n R 2 of.99 or higher. The dt ws quntified using LightCyler softwre ver. 4. (Rohe). Sttistil nlyses Sttistil nlysis ws onduted using SPSS ver. 11. for windows (SPSS In., Chigo, IL, USA). Anlysis of vrine (ANOVA) ws used to identify signifint effets of NCl onentrtion nd durtion of slinity stress on growth, gs exhnge, wter reltion, MDA ontent, tions nd expression of genes, nd signifine level ws P <.5. A Bonferroni test ws performed to ompre individul mens if the effets were signifint. Dt in the form of mens nd stndrd errors were used to onstrut grphs y Sigm Plot for Windows ver. 1. (Systt Softwre, Sn Jose, CA, USA). Correltion nlyses were onduted using the orreltion funtions in Exel. Person oeffiients were lulted to ssess orreltions etween different vriles. Results Growth nd wter ontent Lef elongtion rte, numer of leves nd height of plnt deresed with the inreses in slinity, wheres lef elongtion stopped t 747 mm NCl. Inrese in lef senesene ws oserved t the highest slinity (Fig. 1). Lef Tle 2. Primer sequenes nd NCBI-reords used for seleted genes Gene Primer nme Sequene (5! 3 ) NCBI-ID PM-NHX PMN-F PMN-R TATCGAATGGTGCTCGGAAGA, AGCCCAGCCACAGTACCGATA ISHU-Al-4 GW V-NHX V-NHX-F V-NHX-R GCAGGTCCTCAATCAGGATG, ACTCCAAGGAAGGTGCTTGA AlNHX GU H + -ATPse ATP-F ATP-R GAGGACTGCAAGAGCGGATTAC, TACCAAGCTCAGAAATCTGTCG ISHU-Al-3 GW ACTIN ACT-F ACT-R TACGAAGGGTTTACGCTTCCT, TCTCCAACTCCTCCTCGTAAT ISHU-Al-2 GW Lef elongtion rte (mm dy 1 ) Inrese in height of shoot/plnt (%) F = 65.88; p =.1 F = ; p =.1 F = 3.459; p =.1 F = ; p = NCl (mm) Averge numer of senesed leves/plnt Inrese in numer of leves/plnt (%) Fig. 1. Growth prmeters of Aeluropus lgopoides in four NCl onentrtions for 15 d. F- nd P- vlues were otined from one-wy ANOVA. In the lower two grphs, the % inrese is ompred with initil time vlue. Vlues with similr Bonferroni letter were not signifintly different t P <.5.

5 Slt resistne in Aeluropus lgopoides Funtionl Plnt Biology E Wter ontent (% of fresh weight) Lef T: F = ; P <.1 S: F = ; P <.1 Wter ontent (% of fresh weight) T: NS S: NS Root Ash ontent (% of dry weight) T: F = ; P <.1 S: NS 3 d 7 d 15 d T: F = ; P <.1 S: F = 3.77; P < NCl (mm) Fig. 2. Effet of NCl onentrtions nd time of exposure to slinity on wter nd sh ontents in lef nd root tissues of Aeluropus lgopoides. F- nd P-vlues were otined from onewy ANOVA y using T (time period of slinity exposure) nd S (NCl tretment). For eh time period, vlues t different slinity levels with similr Bonferroni letter were not signifintly different t P <.5 (NS, non-signifint). wter onentrtion (wter s % of FW) ws signifintly redued t 747 mm NCl, wheres no hnge ws reorded in root wter onentrtion. Ash ontent inresed signifintly (P <.1) in roots with slinity, ut no suh hnges were reorded in leves (Fig. 2). Flux in N +,K + nd C 2+ N + in oth root nd lef tissue inresed t lest 1-fold when plntlets of A. lgopoides were exposed to 747 mm NCl onentrtions for n extended period (15 dys, Fig. 3). Moreover, the mount of lef N + ws t lest three times lower in 747 mm NCl ompred with the root tissues fter 3 nd 7 dys of experiment (Figs 3, 4e). Lef K + remined unhnged in up to 373 mm NCl. However, there ws signifint redution with time t 747 mm NCl (Fig. 3). Root K + ws generlly lower ompred with lef K +. At low slinity, root K + onentrtion inresed with time, lthough there ws no hnge t higher slinity onentrtion. Lef C 2+ ws higher thn root nd showed rpid inrese in 167 to 373 mm NCl lthough there ws no signifint hnge in root C 2+ (Fig. 3). The rtio etween lef N + nd K + inresed with inrese in slinity nd time of exposure, with pproximtely 1 12 fold higher N + :K + oserved t 747 mm NCl, reltive to ontrol fter 15 dys (Fig. 4, ). Roots hd more N + ontent thn leves in 373 nd 747 mm NCl (Fig. 4e). The vlues for seletive trnsport (ST) of K + were lower thn those for seletive sorption (SA) (Fig. 4, d). Slightly higher vlues of ST were reorded in 373 nd 747 mm NCl tretments thn in the ontrol (Fig. 4). However, the vlues of SA were higher thn the ontrol vlues in ll NCl tretments (Fig. 4). SA ws lower (~35%) in plnts treted with 747 mm thn 373 mm NCl t the eginning of experiment ut there ws no differene fter 15 dys (Fig. 4). Seretion of N + Seretion of N + from lef tissue inresed with n inrese in slinity nd durtion of NCl tretments (Fig. 4f ). The rte of N + seretion in 167 mm NCl ws similr to the ontrol (whih ontined 26 mm NCl; Tle 1). However, 2-fold inrese ws reorded in N + seretion with further inrese in slinity. An erlier inrese in N + seretion rte ws oserved in 747 mm when ompred with 373 mm NCl (Fig. 4f ). Conentrtion of N + in poplst nd symplst Lef N + onentrtions were similr in oth poplst nd symplst under non-sline ontrol (Fig. 5). An inrese in onentrtion of N + in the poplst of leves (seleted from lower three nodes of the plnt) ws reorded when plnts were exposed to 747 mm NCl (Fig. 5). Osmollity of lef sp nd ontriution of N + nd K + to osmollity There ws no differene in lef osmollity of plnts grown for 3 dys t 26, 167 nd 373 mm NCl, ut ~3-fold inrese oserved in 747 mm NCl (Fig. 6). Mximum osmollity (~25 mosmol kg 1 H 2 O) ws found in leves from plntlets treted with 373 nd 747 mm NCl for 7 nd 15 dys. At the time of hrvest, the osmoti ontriution of N + nd K + ws 4% up to 167 mm NCl nd it inresed to 6% in 373 mm nd 75% in 747 mm NCl (Fig. 6). The ontriution of N + to osmollity

6 F Funtionl Plnt Biology M. Z. Ahmed et l. 1 8 Lef N + T: F = 11.86; P <.1 S: F = ; P <.1 Root T: F = ; P <.1 S: F = ; P <.1 Conentrtion of N +, K + nd C ++ in tissue sp (mm) K + C ++ T: F = 1.37; P <.1 S: F = 1.123; P <.1 T: F =.466; P <.1 S: F = ; P <.1 T: F = 4.262; P <.1 S: F = 5.48; P <.1 T: NS S: NS 3 d 7 d 15 d NCl (mm) Fig. 3. Conentrtion of N +,K + nd C ++ in lef nd root tissues of Aeluropus lgopoides treted with different NCl onentrtions for 3, 7 nd 15 d (n = 3). F- nd P-vlues were otined from one-wy ANOVA y using T (time period of slinity exposure) nd S (NCl tretment). For eh time period, vlues t different slinity levels with similr Bonferroni letter were not signifintly different t P <.5 (NS, non-signifint). ws sustntilly higher thn K + in plnts treted with NCl (Fig. 6). Gs-exhnge kinetis The gs-exhnge prmeters remined unhnged in ontrol plnts with the pssge of time (Tle 3). After 3 dys there ws no hnge in net photosynthesis (P n ) in up to 373 mm NCl nd grdul derese ws oserved with inrese in slinity nd exposure time (Tle 3). Respirtion rte (R) inresed trnsiently up to 373 mm NCl on dy 3 (Tle 3). There ws no initil hnge in stomtl ondutne (g s ) nd trnspirtion rte (E), lthough 9% redution ws reorded in 747 mm NCl. We noted tht g s nd E grdully deresed during the ltter prt of the experiment with n inrese in NCl (Tle 3). There ws no mjor hnge in wter use effiieny (WUE) mong ll tretments, with the exeption t 747 mm slinity fter 15 dys, where derese of 66% in WUE ws oserved ompred with other tretments (Tle 3). Peroxidtion of lipid memrne A progressive inrese in MDA ontent ws oserved in leves treted with NCl fter 3 dys exposure, whih grdully deresed with the pssge of time. Around 4% inrese in MDA ws oserved t 747 mm fter 15 dys in omprison to the ontrol (Tle 3). Gene expression A onstitutive nd unhnged expression of AlNHX, PM-NHX nd H + -ATPse ws oserved in the ontrol tretment in oth lef nd root (Fig. 7). The expression of AlNHX (V-NHX) in leves progressively inresed under ll slinities reltive to ontrol, ut this expression grdully deresed with time t 373 nd 747 mm NCl (Fig. 7, ). The expression of AlNHX in roots ws higher in ll NCl tretments prtiulrly t 747 mm NCl where it ws t lest 12 times greter thn respetive non-sline ontrol. During initil periods, expression of H + -ATPse ws higher (2- to 4-fold) in leves treted with NCl thn in the leves from

7 Slt resistne in Aeluropus lgopoides Funtionl Plnt Biology G N + /K Lef T: F = ; P <.1 S: F = ; P <.1 3 d 7 d 15 d () Root T: F = 23.87; P <.1 S: F = 185.2; P <.1 () N + /K + 3 T: F = 3.266; P <.5 S: F = 15.66; P <.1 () T: F = ; P <.1 S: F = ; P <.1 (d) 3 ST SA N + (lef/root) T: F = 2.928; P <.5 S: F = ; P <.1 (e) NCl (mm) T: F = 1.595; P <.5 S: F = 18.65; P <.1 (f) Rte of N + seretion (µmol m 2 d 1 ) Fig. 4. N + :K + rtio in lef () nd root (), ST, seletive trnsport rtio of K + vs. N + from root to shoot () SA, seletive sorption rtio of K + vs. N + from the medium (d), quntity of N + in lef vs. root (e) nd rte of N + seretion from leves ( f ) ofaeluropus lgopoides in different NCl onentrtions nd their time of exposure to slinity. F- nd P-vlues were otined from one-wy ANOVA y using T (time period of slinity exposure) nd S (NCl tretment). For eh time period, vlues t different slinity levels with similr Bonferroni letter were not signifintly different t P <.5. ontrol plntlets, wheres expression delined lter t 373 nd 747 mm NCl (Fig. 7). Expression of H + -ATPse ws 2-fold higher in leves thn in roots (Fig. 7, d). Expression of H + - ATPse gene in root inresed with n inrese in slinity nd exposure time (Fig. 7d). Expression of PM-NHX ws 1-fold higher in lef thn root tissue (Fig. 7e, f ). Moreover, expression in leves did not hnge under low slinity, ut inresed under high slinity (Fig. 7e). Expression of PM-NHX in root tissue inresed with n inrese in slinity nd durtion of exposure to NCl solutions (Fig. 7f ). Disussion Slt resistne in plnts is sed on hin of events, inluding physiologil nd moleulr proesses triggered through differentil expression of genes (Aogdllh 21; Yng et l. 21). However, ny hnge in these events ould negtively ffet slt resistne of prtiulr speies, whih depends oth on the extent nd length of exposure to slinity (Munns 22; Aogdllh 21). Some hlophytes grow est in the presene of some slinity, wheres others (espeilly grsses) in non-sline ondition even if they hve high slt resistne (Gulzr et l. 23; Brhoumi et l. 27; Flowers nd Colmer 28). A. lgopoides my survive in more thn 1 mm NCl, ut its est growth ws reorded in non-sline ondition (Fig. 1; Gulzr et l. 23). There ws no hnge in WC of roots throughout the experiment, wheres inorgni ontent inresed with the inrese in slinity s lso reported efore in A. lgopoides (Sohnin et l. 21) nd other slt tolernt grsses (Bell nd O Lery 23; Brhoumi et l. 27). The wter onentrtion of lef tissue deresed y 1% t 373 mm nd ~3% in 747 mm NCl s delyed response of NCl tretments, whih hd ffeted lef osmollity. However, the vlues of WC remined in the norml rnge (65 85%) for grsses (Tiku nd Snydon 1971; Howrd nd Mendelssohn 1999). Hlophyti grsses ommonly redue lef trnspirtion rte to minimise

8 H Funtionl Plnt Biology M. Z. Ahmed et l. N + in tissue sp (mm) 2 Apoplst 26 mm Symplst mm mm 747 mm Upper Middle Lower Upper Middle Lower Shoot zone Fig. 5. Distriution of N + etween poplst nd symplst in leves olleted from three zones (lower, 3 nodes; middle, 4 6 nodes; upper, 7 9 nodes)) of Aeluropus lgopoides plnts treted with 26 nd 747 mm of NCl for 15 dys. N + uptke, though t the ost of redued growth nd photosynthesis (Munns 22; Flowers nd Colmer 28). An inrese in lef osmollity in plnts under slinity, inditing osmoti djustment, is frequently oserved (Munns nd Tester 28). Osmoti djustment is ttriuted to the umultion of vuolr ions or prodution of omptile orgni solutes (Flowers nd Colmer 28). There ws little hnge in lef osmollity up to 373 mm NCl during the first 3 dys, ut 2- fold inrese ws oserved in 747 mm NCl, inditing derese in wter ontent under highly sline onditions. However, fter 15 dys, high lef osmollity in 373 mm NCl with lmost 5% ontriution of N + indites n effiient N + omprtmentlistion in plnts. A ontriution of N + nd K + of >4% of osmollity is ommon feture of slt-tolernt grsses (Mrum 28), whih my results in deresed metoli ost for osmolyte prodution (Hsegw et l. 2; Bell nd O Lery 23). However, ion toxiity my our if the onentrtion of N + in tissue sp exeeds from 65 mm s indited y umultion of higher MDA ontent t 747 mm NCl. Aeluropus lgopoides ppers to mintin K + homeostsis up to 373 mm NCl, ut N + :K + rtio inresed progressively with inresing NCl onentrtion. K + homeostsis in oth roots nd leves is likely to e due to seletive sorption nd trnsport (Bell nd O Lery 23; Gulzr et l. 23; Wng et l. 29). Plnts my hieve seletive sorption nd trnsport Osmollity (mosmol Kg 1 fresh weight) Contriution to osmollity (%) () T: F = 51.57; P <.1 S: F = ; P <.1 3 d 7 d 15 d () 8 S: F = ; P =.1 A NCl (mm) of K + over N + ross the memrnes through stelr K + outwrd retifiers (SKORs) nd KUP-HAK protein hnnels (Snt- Mrí et l. 1997; Gymrd et l. 1998). In ddition, the prevention of K + loss from the ell lso ppers to e ruil prt of K + mintenne (Chen et l. 27). When plntlets of B C N + K + D Fig. 6. Osmollity () nd reltive osmoti ontriution of N + nd K + () in lef tissue of Aeluropus lgopoides in different NCl onentrtions. F- nd P-vlues were otined from one-wy ANOVA y using T (time period of slinity exposure) nd S (NCl tretment). For eh time period, vlues t different slinity levels with similr Bonferroni letter (lower se nd upper se letters were used for N nd K respetively) were not signifintly different t P <.5. Tle 3. Gs-exhnge prmeters (P n, photosynthesis; R, respirtion; g s, stomtl ondutne; E, trnspirtion; WUE, wter use effiieny) nd MDA ontent in Aeluropus lgopoides fter 3 nd 15 dys of vrious NCl onentrtions Vlues re mens s.e. P-vlues were otined from one-wy ANOVA y using T (time period of slinity exposure) nd S (NCl tretment) (NS, non-signifint). Vlues with different Bonferroni letters re signifintly different t P <.5 Prmeter Dy NCl (mm) ANOVA P n (mmol CO 2 m 2 s 1 ) ± ± ± ±.37 T: P <.5 S: P < ± ± ±.92.3 ±.7d R (mmol m 2 s 1 ) ± ± ± ±.33 T: P <.5 S: P < ± ± ±.4.79 ±.19 g s (mol H 2 Om 2 s 1 ) 3.1 ±.2.1 ±.3.11 ±.2.1 ±.1 T: P <.5 S: P < ±.1.7 ±.1.2 ±..1 ±.d E (mmol H 2 Om 2 s 1 ) 3 4. ± ± ± ±.16 T: P <.1 S: P < ± ± ±.7.32 ±.4d WUE (mmol CO 2 mmol 1 H 2 O) ± ± ± ±.16 T: NS S: P < ± ± ± ±.12 MDA (mmol g 1 FW) ±.8d ± ± ±.32 T: P <.1 S: P < ± ± ± ±.47

9 Slt resistne in Aeluropus lgopoides Funtionl Plnt Biology I Reltive gene expression tin Lef () T: F = ; P <.1 S: F = ; P <.1 () T: F = 22.2; P <.1 S: F = 5.781; P <.1 (e) T: F = ; P <.1 S: F = ; P <.1 3 d 7 d 15 d Root () T: F = ; P <.1 S: F = 69.13; P < T: F = ; P =.1 S: F = ; P =.1 NCl (mm) (d) (f) T: F =.76; P <.5 S: F = ; P <.1 25 Fig. 7. Reltive expression of seleted genes ginst ting (housekeeping gene) in Aeluropus lgopoides treted with different NCl onentrtions for 3, 7 nd 15 dys. Dt for gene expression of AlNHX (V-NHX;, ), H + -ATPse (, d) nd PM-NHX (e, f) re shown in lef (,, e) nd root (, d, f) respetively. Insert: insert shows the sme grph (f) with different sle. F- nd P-vlues were otined from one-wy ANOVA y using T (time period of slinity exposure) nd S (NCl tretment). For eh time period, vlues t different slinity levels with similr Bonferroni letter were not signifintly different t P <.5. A. lgopoides were exposed to 747 mm NCl for longer period (15 dys), K + defiieny in leves ws oserved whih ould hve led to restrited growth nd loss of seletive K + sorption from sline medium s well s seletive K + trnsport through xylem (Hu nd Shmidhlter 25; Wng et l. 29). There ws no signifint hnge in the rte of photosynthesis up to 373 mm NCl fter 3 dys, ut shrp deline ws oserved fter long-term exposure to ll onentrtions of NCl. A positive reltionship mong photosynthesis, stomtl ondutne nd trnspirtion (r =.999; P <.1) indites tht the redution in photosynthesis is possily linked to stomtl losure to prevent wter loss (Crroll et l. 21). Moreover, redution in trnspirtion my lso redue the N + loding into the xylem strem nd susequently its trnsport towrds lef tissues, so tht the longevity of plnt is inresed y mintining N + t sutoxi level (M et l. 24). A growth inhiition t 373 mm NCl my indite the ility of plnt to ope with slinity y ompromising CO 2 ssimiltion (Sr et l. 212). However, poor growth with sustntilly redued photosynthesis t 747 mm NCl ould e result of insuffiient retive oxygen speies (ROS) quenhing (Sohnin et l. 21), whih is refleted y higher MDA (4% of respetive non-sline tretment) onentrtion. This oxidtive dmge ould lso e onsequene of the rpid inrese in lef N + (three times higher thn ontrol) whih might e injurious for light hrvesting omplex or enzymes relted to CO 2 ssimiltion (Prid nd Ds 25). Sohnin et l. (21) reported derese in photosynthesis with downregultion in proteins of oth light retion nd Clvin yle (LSU nd SSU of RuBisCO), when A. lgopoides plntlets were exposed to 45 mm NCl for 1 dys. Respirtion rte in plnts treted with 373 mm NCl ws higher thn other slinity levels used for 3 dys, is onsistent with greter energy demnd for N + regultion nd osmoti djustment esides tivting ny defene system. A

10 J Funtionl Plnt Biology M. Z. Ahmed et l. Tle 4. Representtion of hnges in different prmeters of Aeluropus lgopoides fter tretment with 373 nd 747 mm NCl for 15 dys The diretion of rrow shows the hnge in omprison with the non-sline tretment nd numer of rrows shows signifint differene (P <.5) etween 373 nd 747 mm NCl tretments Prmeters NCl (mm) Leves Growth rte # ## WC # ## Osmollity " " P n # ## R # ## WUE # MDA " Seretion rte of N + " " K + # N + " "" VNHX " " PMNHX H-ATPse " Roots K + N + " " VNHX " " PMNHX " "" H-ATPse " " onsiderle derese in respirtion of A. lgopoides fter 15 dys t ll NCl onentrtions indites possile shift of metolism towrds mino id synthesis (Sohnin et l.(21). The low rte of respirtion t 747 mm NCl indites ioni toxiity tht is ontrolled y inpproprite expression of genes s well s indequte seretion of slt (Tle 3). The removl of toxi ions suh s N + from the metolilly tive ytoplsm is the key for slt resistne (Munns nd Tester 28; Oh et l. 29) whih is hieved either y N + omprtmentlistion in the vuole (V-NHX) or ontinuous removl to nd exretion from the poplst (PM-NHX) (Cosentino et l. 21) using energy in the form of eletromotive fore generted through protein enoded y H + - ATPse nd H + -PPse genes (Hedrih et l. 1989). The extent of N + omprtmentlistion in vuoles of root nd shoot tissues vries with speies (Aogdllh 21; Yng et l. 21). In generl, hlophyti grsses umulte ions in roots (Mrum 28), lthough shoot nd lef tissues ply only minor role in ion umultion under NCl stress (Brhoumi et l. 27). Our dt indite tht lef versus root rtio of sodium ontent deresed with inrese in NCl onentrtions. This lso vlidtes the finding tht the expression of V-NHX gene ws 2-fold higher in roots thn leves. In ontrst, PM-NHX ws higher in leves thn roots, whih shows o-ordintion with V-NHX. The expression of V-NHX nd PM-NHX ws dependent on the durtion of NCl tretment (Khedr et l. 211). Higher expression of V-NHX nd PM-NHX in leves ws prompt response of NCl tretment, whih ould hve helped in deresing N + ontent in ytoplsm nd to mintin wter onentrtion (perentge of FW) (Khedr et l. 211). However, the expression of oth genes deresed with time of exposure to NCl, whih my hve used shift to N + seretion mehnism. In ddition, 4-fold inresed onentrtion of N + ws noted in the poplst thn symplst, whih ould hve enhned the rte of N + seretion through slt glnds (Nz et l. 29). Although, the expression of PM-NHX gene ws downregulted with time ut still N + trnsfer to the poplst is possile euse of higher stility of PM-NHX protein under sline ondition ompred with non-sline ontrol (Chung et l. 28). The expression of oth genes (PM-NHX nd V-NHX) nd slt seretion rte ws similr in plntlets treted with 373 nd 747 mm NCl fter 15 dys, ut the tissue sp onentrtion of N + ws 3% higher in 747 mm NCl tretment, suggesting N + toxiity in plnts treted with 747 mm NCl. An inrese in C 2+ onentrtion in plntlets exposed to 373 mm NCl for 15 dys possily help in loking N + uptke vi NSCC (non-seletive tion hnnel; Demidhik nd Tester 22) nd improving K + seletivity y KOR (potssium outwrd retifying hnnel; Wng et l. 29). The lolistion of H + -trnsloting denosine tri-phosphtse enzyme is previously reported oth in tonoplst nd plsm memrne ut in this study expression of H + -ATPse gene ws positively orrelted with the expression of V-NHX gene in oth leves (r =.821; P <.1) nd roots (r =.7; P <.1). Our results suggest tht the expression of H + - ATPse is of gret importne in A. lgopoides to generte n eletrohemil grdient so tht n effiient sequestrtion of N + in vuoles my our s reported for other speies (Aogdllh 21; Yng et l. 21). The upregultion of ATP synthse in A. lgopoides under slt stress (Sohnin et l. 21) might e helpful in N + prtitioning through H + - ATPse. We onlude tht NCl indued hnges in growth, physiologil nd moleulr mehnisms of A. lgopoides ould e relted to ioni homeostsis in plnts. Plntlets of A. lgopoides suessfully omprtmentlised N + in 373 mm NCl t the ost of growth redution y hieving K + homeostsis nd preventing dmge. This prtitioning is mde possile y proper oordintion of AlNHX, H + -ATPse nd PM-NHX genes in lef nd root tissues (Tle 4). Seond, redution in gs exhnge prmeters helped plnts redue wter loss to minimise N + uptke. Inresed seretion of N + through leves my hve ontriuted in voiding toxiity. However, 747 mm NCl proved to e toxi s plnts not only suffered from K + defiieny, ut lso showed pprent signs of dmge. This dmge ould e result of ineffetive N + seretion s well s inpproprite gene expression ontrolling N + flux. Referenes Arsji GA (2) Identifition nd investigtion on some of eophysiologil hrteristis of Aeluropus spp. in sline nd lkline rngelnds in the north of Gorgn. Pjouhesh-V-Szndegi 46, Aogdllh GM (21) Sensitivity of Trifolium lexndrinum L. to slt stress is relted to the lk of long-term stress-indued gene expression. Plnt Siene 178, doi:1.116/j.plntsi Adms P, Nelson DE, Ymd S, Chmr W, Jensen RG, Bohnert HJ, Griffiths H (1998) Growth nd development of Mesemrynthemum

11 Slt resistne in Aeluropus lgopoides Funtionl Plnt Biology K rystllinum (Aizoee). New Phytologist 138, doi:1.146/ j x Brhoumi Z, Djeli W, Chïi W, Adelly C, Smoui A (27) Slt impt on photosynthesis nd lef ultrstruture of Aeluropus littorlis. Journl of Plnt Reserh 12, doi:1.17/s z Bell H, O LeryJ(23) Effetsof slinity ongrowth nd tionumultion of Sporoolus virginius (Poee). Amerin Journl of Botny 9, doi:1.3732/j Bhskrn C, Selvrj T (1997) Sesonl inidene nd distriution of VA-myorrhizl fungi in ntive sline soils. Journl of Environmentl Biology 18, Blumwld E (2) Sodium trnsport nd slt tolerne in plnts. Current Opinion in Cell Biology 12, doi:1.116/s () Crroll AB, Pllrdy SG, Gllen C (21) Drought stress, plnt wter sttus nd florl trit expression in fireweed, Epiloium ngustifolium (Ongree). Amerin Journl of Botny 88, doi:1.237/ Chen Z, Pottosin II, Cuin TA, Fuglsng AT, Tester M, Jh D, Zeped-Jzo I, Zhou M, Plmgren MG, Newmn IA, Shl S (27) Root plsm memrne trnsporters ontrolling K + /N + homeostsis in slt stressed rley. Plnt Physiology 145, doi:1.114/pp Chung J-S, Zhu J-K, Bressn RA, Hsegw PM, Shi H (28) Retive oxygen speies medite N + -indued SOS1 mrna stility in Aridopsis. The Plnt Journl 53, doi:1.1111/j x x Cosentino C, Fisher-Shlies E, Bertl A, Thiel G, Homnn U (21) N + /H + ntiporters re differentilly regulted in response to NCl stress in leves nd roots of Mesemrynthemum rystllinum. New Phytologist 186, doi:1.1111/j x Cuin TA, Tin Y, Betts SA, Chlmndrier R, Shl S (29) Ioni reltions nd osmoti djustment in durumnd red whet under sline onditions. Funtionl Plnt Biology 36, doi:1.171/fp951 Deez A, Sdoui D, Slm I, Huhzermeyer B, Adelly C (21) Responses of Btis mritim plnts hllenged with up to two-fold sewter NCl slinity. Journl of Plnt Nutrition nd Soil Siene 173, doi:1.12/jpln Demidhik V, Tester M (22) Sodium fluxes through non-seletive tion hnnels in the plsm memrne of protoplsts from Aridopsis thlin roots. Plnt Physiology 128, doi:1.114/pp.1524 Flowers TJ, Colmer TD (28) Slinity tolerne in hlophytes. New Phytologist 179, doi:1.1111/j x Gymrd F, Pilot G, Lome B, Bouhez D, Bruneu D, Bouherez J, Mihux-Ferriere N, Thiud JB, Senten H (1998) Identifition nd disruption of plnt shker-like outwrd hnnel involved in K + relese into the xylem sp. Cell 94, doi:1.116/s () Gui R, Xiloynnis C, Flore JA (1991) Gs exhnge prmeters, wter reltions nd rohydrte prtitioning in leves of field grown Prunus domesti following fruit removl. Physiologi Plntrum 83, doi:1.1111/j t126.x Gulzr S, Khn MA, Ungr IA (23) Effet of slinity on growth, ioni ontent, plnt-wter sttus in Aeluropus lgopoides. Communitions in Soil Siene nd Plnt Anlysis 34, doi:1.181/css Hsegw PM, Versn RAJ, Zhu K, Bonhert HJ (2) Plnt ellulr nd moleulr responses to high slinity. Annul Review of Plnt Physiology nd Plnt Moleulr Biology 51, doi:1.1146/nnurev. rplnt He C, YnJ, Shen G, Fu L, HoldyAS, Auld D, BlumwldE, ZhngH (25) Expression of n Aridopsis vuolr sodium/proton ntiporter gene in otton improves photosyntheti performne under slt onditions nd inreses fier yield in the field. Plnt & Cell Physiology 46, doi:1.193/pp/pi21 Heth RL, Pker L (1968) Photoperoxidtion in isolted hloroplsts. I. Kinetis nd stoihiometry of ftty id peroxidtion. Arhives of Biohemistry nd Biophysis 125, doi:1.116/ (68) Hedrih R, Kurkdjin A, Guern J, Flugge UI (1989) Comprtive studies on the eletril properties of the H + trnsloting ATPse nd pyrophosphtse of the vuolr-lysosoml omprtment. EMBO Journl 8, Hoglnd DR, Arnon DI (195) The wter-ulture method for growing plntswithoutsoil. Cliforni AgriulturlExperimentSttion347,1 32. Howrd RJ, Mendelssohn IA (1999) Slinity s onstrint on growth of oligohline mrsh mrophytes. I. Speies vrition in stress tolerne. Amerin Journl of Botny 86, doi:1.237/26567 Hu Y, Shmidhlter U (25) Drought nd slinity: omprison of their effets on minerl nutrition of plnts. Journl of Plnt Nutrition nd Soil Siene 168, doi:1.12/jpln Joshi AJ, Bhoite AS (1988) Flututions of minerl ions in sline soils nd hlophyti grss Aeluropus lgopoides L. Annls of Arid Zone 27, Kwski S, Borhert C, Deyholos M, Wng H, Brzille S, Kwi K, Glrith D, Bohnert HJ (21) Gene expression profiles during the initil phse of slt stress in rie. The Plnt Cell 13, Khedr AHA, Serg MS, Nemt-All MM, El-Ng AZA, Nd RM, Quik WP, Aogdllh GM (211) Growth stimultion nd inhiition y slt in reltion to N + mnipulting genes in xero-hlophyte Atriplex hlimus L. At Physiologie Plntrum 33, doi:1.17/s z Koyro H-W, Khn MA, Lieth H (211) Hlophyti rops: resoure for the future to redue the wter risis? Emirtes Journl of Food nd Agriulture 23, Krmer PJ, Boyer JS (1995) Wter reltions of plnts nd soils. (Ademi Press: London) M XL, Zhng Q, Shi HZ, Zhu JK, Zho YX, M CL, Zhng H (24) Moleulr loning nd different expression of vuolr N + /H + ntiporter gene in Sued sls under slt stress. Biologi Plntrum 48, doi:1.123/b:biop Mthuis FJM, Amtmnn A (1999) K + nutrition nd N + toxiity: the sis of ellulr K + /N + rtios. Annls of Botny 84, doi:1.16/ no Mrum KB (28) Reltive slinity tolerne of turfgrss speies nd ultivrs. In Hndook of turfgrss mngement nd physiology. (Ed. M Pessrkli) p (CRC Press: New York) Munns R (22) Comprtive physiology of slt nd wter stress. Plnt, Cell & Environment 25, doi:1.146/j x Munns R, Tester M (28) Mehnisms of slinity tolerne. Annul Review of Plnt Biology 59, doi:1.1146/nnurev.rplnt Nz N, Hmeed M, Whid A, Arshd M, Ahmd MSA (29) Ptterns of ion exretion nd survivl in two stoloniferous rid zone grsses. Physiologi Plntrum 135, doi:1.1111/j x Oh D-H, Leidi E, Zhng Q, Hwng S-M, Li Y, Quintero FJ, Jing X, D Urzo MP, Lee SY, Zho Y, Bhk JD, Bressn RA, Yun D-J, Prdo JM, Bohnert HJ (29) Loss of hlophytism y interferene with SOS1 expression. Plnt Physiology 151, doi:1.114/pp Prid AK, Ds AB (25) Slt tolerne nd slinity effets on plnts: review. Eotoxiology nd Environmentl Sfety 6, doi:1.116/j.eoenv Rzvi K, Mlooi MA, Mohsenzdeh S (26) Identifition nd hrteriztion of mrna trnsripts differentilly expressed in response to high slinity using DD-AFLP in Aeluropus lgopoides. In 4th Ntionl Biotehnology Congress, August, Kermn, Irn.

12 L Funtionl Plnt Biology M. Z. Ahmed et l. Sr A, Dyf F, Renult S (212) Differentil physiologil nd iohemil responses of three Ehine speies to slinity stress. Sienti Hortiulture 135, doi:1.116/j.sient Snt-Mrí GE, Ruio F, Duovsky J, Rodriguez-Nvrro A (1997) The HAK1 gene of rley is memer of lrge gene fmily nd enodes high-ffinity potssium trnsporter. The Plnt Cell 9, Shl S, Mky A (211) Ion trnsport in hlophytes. Advnes in Botnil Reserh 57, doi:1.116/b Sher M, Sen DN, Mohmmed S (1994) Sesonl vritions in sugr nd protein ontent of hlophytes in Indin desert. Annls of Arid Zone 33, Sohnin H, Motmed N, Jzii FR, Nkmur T, Komtsu S (21) Slt stress indued differentil proteome nd metolome response in the shoots of Aeluropus lgopoides (Poee), hlophyte C 4 plnt. Journl of Proteome Reserh 9, doi:1.121/pr9974k Tester M, Dvenport R (23) N + tolerne nd N + trnsport in higher plnts. Annls of Botny 91, doi:1.193/o/mg58 Tewri A (197) A note on the vlue of Sporoolus oromndelinus (Trin.) Kunth nd Aeluropus lgopoides (Linn.) s feed nd soil inder. Plnt Siene 2, Tiku BL, Snydon RW (1971) Slinity tolerne within the grss speies. Plnt nd Soil 35, doi:1.17/bf Tortinejd NM, Mghsoodlowrd H, Ghrsh AM (2) Nutritive vlue of Aeluropus littorlis nd Aeluropus lgopoides in sheep. Journl of Agriulturl Sienes nd Nturl Resoures 7, Vziri A, Motmed N, Nghvi MR, Yzdni B, Niknm V (211) Physiologil nd iohemil responses of Aeluropus lgopoides nd Aeluropus littorlis to drought stress. Journl of Mediinl nd Aromti Plnts 2, Wghmode AP, Hegde BA (1984) Effet of sodium hloride on pyruvte orthophosphte dikinse of sline grss Aeluropus lgopoides (Linn.). Trin. Biovigynm 1, Wghmode AP, Joshi GV (1982) Photosyntheti nd photorespirtory enzymes nd metolism of 14 C-sustrtes in isolted lef ells of the C 4 speies of Aeluropus lgopoides L. Photosyntheti 16, Wng C-M, Zhng J-L, Liu X-S, Li Z, Wu G-Q, Ci J-Y, Flowers TJ, Wng SM (29) Puinelli tenuiflor mintins low N + level under slinity y limiting unidiretionl N + influx resulting in high seletivity for K + over N +. Plnt, Cell & Environment 32, doi:1.1111/j x Xue Z-Y, Zhi D-Y, Xue G-P, Zhng H, Zho Y-X, Xi G-M (24) Enhned slt tolerne of trnsgeni whet (Tritium estivum L.) expressing vuolr N + /H + ntiporter gene with improved grin yields in sline soils in the field nd redued level of lef N +. Plnt Siene 167, doi:1.116/j.plntsi Yng MF, Song J, Wng BS (21) Orgn-speifi responses of vuolr H + - ATPse in the shoots nd roots of C 3 hlophyte Sued sls to NCl. Journl of Integrtive Plnt Biology 52, doi:1.1111/j x Yu Q, Tng C, Chen Z, Kuo J (1999) Extrtion of poplsti sp from plnt roots y entrifugtion. New Phytologist 143, doi:1.146/j x Yue W, Xi GM, Zhi DY, Chen HM (21) Trnsfer of slt tolerne from Aeleuropus littorlis sinensis to whet (Tritium estivum L.) vi symmetri somti hyridiztion. Plnt Siene 161, doi:1.116/s (1)382-x Zhu JK (21) Plnt slt tolerne. Trends in Plnt Siene 6, doi:1.116/s ()