CBMB2008. Nucleic Acid NMR. Yuan-Chao Lou 羅元超. Institute of Biomedical Sciences Academia Sinica 2011/04/27

Transcription

1 CBMB2008 ucleic Acid MR Yuan-Chao Lou 羅元超 Institute of Biomedical Sciences Academia Sinica 2011/04/27

2 Outline I. ucleic acids hold diverse structures and functions a. In vitro SELEX b. Diverse structures of nucleic acids II. MR spectroscopy for nucleic acid assignment a. The building blocks of nucleic acids b. Resonance assignment in nucleic acids III. Advanced developments in MR spectroscopy a. Residual Dipolar Coupling (RDC) b. Transverse Relaxation-Optimized Spectroscopy (TROSY) c. Paramagnetic spin labeling IV. Cases of protein/nucleic acids complexes

3 I. ucleic acids hold diverse structures and functions

4 ucleic acids have diverse functions * It serves multiple functions: Carrier of heritable information Catalysis: nucleic acid enzymes Aptamer: nucleic acid monoclonal antibody (SELEX) * Targets for drug interaction

5 SELEX Methodology Systematic Evolution of Ligands by EXponential enrichment The ligands that emerge from SELEX have been called aptamers Gold, L., Polisky, B., Uhlenbeck, O. & Yarus, M. (1995). Diversity of oligonucleotide functions. Annu. Rev. Biochem. 64,

6 SELEX Methodology SELEX is a technology for the identification of high affinity oligonucleotide ligands. Large pool of random sequence single-stranded oligonucleotides, whether RA or DA, can be thought of conformationally not as short strings but rather as sequence-dependent folded structures. This conformational complexity means that such a library is a source of high affinity ligands for a surprising variety of molecular targets, including nucleic acid binding proteins such as polymerases and transcription factors, non-nucleic acid binding proteins such as cytokins and growth factors, as well as small organic molecules such as ATP. The range of applications of this technology extends from basic research reagents to the identification of novel diagnostic and therapeutic reagents, such as thrombin and HIV-1 integrase inhibitors.

7 First prepare a DA oligonucleotide with random sequences in the central region. Then use PCR to amplify the oligonucleotides SELEX Methodology Use a biotinlabeled DA primer to separate DA double strands If RA, then a reverse PCR was performed to amplify the few oligonucleotides

8 The consensus sequences must form a conserved secondary structure Consensus Sequences

9 DA Aptamers as Potential anti-hiv Agents a. Recently several DA aptamers have been screened using SELEX to exhibit nanomolar activity as anti-hiv1- integrase inhibitors b. The aptamers adopt novel G- quadruplex structures 1. Chou, S.-H., Chin, K.-H. & Wang, A. H.-J. (2005). DA aptamers as potential anti-hiv agents. Trend in Biochem. Sci. 30, May. 2. Phan, A. T., Kuryavyi, V., Ma, J.-B., Faure, A., Andreola, M.-L. & Patel, D. J. (2005). An interlocked dimeric parallel-stranded DA quadruplex: A potent inhibitor of HIV-1 integrase. Proc. atl. Acad. Sci. USA 102,

10 Possible Multi-stranded G-Quadruplex structures 1. G-tetrad H-bonding 2. G-tetrad hydrophobic stacking

11 A ovel G-Quadruplex structures for 5 -GGGGTGGGAGGAGGGT-3 1. Interlocked dimer 2. Three reversal loops 3. Contain G- G-G-G-A pentad 4. Four hanging out bases

12 A ovel G-Quadruplex structures for 5 -GGGGTGGGAGGAGGGT-3

13 G-Quadruplex and HIV1- Integrase Complex G-Quadruplex is situated in the center to block the active site of HIV1-I

14 ucleic acids have diverse structures * Triplex, Quadruplex, i-motif multistranded structures in the promoter, centromere, or telomere region * Left-handed duplex structures

15 Human Telomere, Telomerase, and Cancer Chemotherapy a. Human telomere contains tandem repeats of TTAGGG sequence b. DA polymerase cannot synthesize end of chromosome c. The end problem needs to be fixed, or a cell will age or die due to the loss of its chromosome content d. Telomerase comes as a rescue. It is quite active in cancer cell, but not in normal cell e. The substrate of a telomerase is the singlestranded (TTAGGG)n hanging. Since it can form a G-quadruplex, hence an agent that can stabilize such a structure can serve a drug for cancer therapy.

16 Human Telomere, Telomerase, and Cancer Chemotherapy A simple mechanism of telomerase action 5' 3' A reverse transcriptase

17 ucleic Acids with Canonical GC and AT Paired Duplex under eutral Condition

18 ucleic Acids with G-rich sequences in a duplex may form separated multiplestranded G- quadruplex and i-motif structures at acidic (ph 4.5) condition

19 ucleic Acids with G-rich sequences in a promoter may form separated multiplestranded G- quadruplex and i-motif structures Phan, A. T. & Mergny, J.-L. (2002). Human telomeric DA: G-quadruplex, i-motif and Watson-Crick double helix. ucl. Acids. Res. 30,

20 RA structure By Michael Sattler

21 Proteins recognize unusual RA structural elements RA structure: protein recognition By stabilizing an adjacent interaction surface, bulges can participate in complex protein binding sites. Structure (2000) 8, R47-R54.

22 ucleic Acids are Special Biomolecules * It serves not only as targets for cancer chemotherapy, but also as inhibitors (aptamers) toward other targets such as HIV-1 integrase.

23 II. MR Spectroscopy for ucleic Acid Assignment

24 The building blocks of nucleic acids omenclature, structures, and atom numbering for the sugars contained in common nucleotides.

25 omenclature, structures, and atom numbering for the bases contained in common nucleotides. Labile protons

26 1D 1 H MR spectrum in ucleic Acids (in D 2 O) H 2 H 6 H 8 H 1 H 5 H 2 H 3 H 4 H 5 H 5 CH 3

27 1D 1 H MR spectrum in ucleic Acids (in H 2 O) imino amino aromatic

28 Why Imino Protons have Very Downfielded Resonances Ring-current shifting effect A/G > C/T Inductive effect H-bonded effect

29 OE-based assignment in unlabeled nucleic acids

30 MR of canonical DA duplexes 1) Systematic assignment by 2D OESY in H 2 O 2) Systematic assignment by 2D OESY in D 2 O 1. Hare, D. R., Wemmer, D. E., Chou, S.-H., Drobny, G. & Reid, B. R. (1983). Assignment of the non-exchangeable proton resonances of d(cgcgaattcgcg) using two-dimensional nuclear magnetic resonance methods. J. Mol. Biol. 171, Tseng, Y.-Y. & Chou, S.-H. (1999). Systematic MR assignment pathways for DA exchangeable protons. J. Chin. Chem. Soc. 46,

31 Regular B-form DA Duplex Structure * Watson-Crick G C and A T H-bonding * Intra-strand base-base hydrophobic stacking

32 Typical 1D and 2D-OESY MR Spectra In D 2 O b a c T4H4 T12 A14H4 CH 3 T4 CH 3 A6H8 A14H8 T4H6 T12H6 A14H1 T4H1 C9H4 T4/A14 H5 /H5

33 Flowcharts for resonance assignment in nucleic acids A. OE-based assignment in unlabeled nucleic acids I (H 2 O) II (H 2 O) III (D 2 O) Assignment of imino (and amino) resonances to establish base pairing OESY imino-imino, amino-imino Partial resonance assignment of non-exchangeable protons via OE connectivities to amino and/or imino protons OESY imino-h2/h6/h8/h5/h1 Identification of sugar proton spin systems (mainly H1 /H2 /H2 /H3 ) ( 1 H, 1 H) COSY/TOCSY Identification of aromatic spin systems (Cytosine/Thymine H5/H6) ( 1 H, 1 H) COSY/TOCSY Sequential resonance assignment OESY H6/H8-H1, H6/H8-H2 H2 IV (D 2 O) Assignment of 31 P resonances and confirm/extend H3,H4,H5,H5 assignments ( 1 H, 31 P) HETCOR/HETTOC Progress in uclear Magnetic Resonance Spectroscopy (1998) 32, p

34 Imino Proton to Amino to Aromatic Protons H Me O H H8 b. Imino to amino/aromatic d. Aromatic to H2 /H2 H6 R T O 1 H H2 A R 6 a. Imino to imino c. Amino to aromatic H8 R O G H 2 H H H H C O H5 R H6

35 I. Assignment of imino (and amino) resonances in H 2 O Imino Proton Assignments by 2D OESY spectrum 2G-18T-17G-5G-15T-7T-8G-12T-11G ' CGACGATGACGTCATCGTCG-3' 3'-GCTGCTACTGCAGTAGCAGC-5' G 8G H Me R T O O H H H A H R H 7T 2G 17G 11G b imino proton H O H H H 12T 15T a R G H H H O C R H 18T imino proton J. Chin. Chem. Soc. (1999) 46, p

36 II. OESY imino-h2/h6/h8/h5/h1 in H 2 O b. Imino to amino/aromatic Imino Proton to Amino and Aromatic H Me O H H8 H5 H6 R T O H H2 A R H H8 O H H5 R G H H H O C R H6 H2 J. Chin. Chem. Soc. (1999) 46, p

37 III. Identification of aromatic spin systems in D 2 O Only intra-strand aromatic to aromatic connectivities D Me O D H8 H6 R T O D H2 A R D H8 O D H5 R G D D O C R H6 D J. Chin. Chem. Soc. (1999) 46, p

38 III. Sequential resonance assignment in D 2 O OESY H6/H8-H1, H6/H8-H2 H2 Cytosine: CH5-CH6 JMB (1983) 171, p Duplex-hairpin 5' CGCGTATACGCG-3' ucleic Acids Res. (1985) 13, p

39 III. Sequential resonance assignment in D 2 O OESY H6/H8-H1 Only intra-residue cross peaks were marked. a-f. are the six big CH5-CH6 cross peaks. J. Chin. Chem. Soc. (1999) 46, p

40 III. Sequential resonance assignment in D 2 O OESY H6/H8-H2 H2 Only intra-residue cross peaks were marked. J. Chin. Chem. Soc. (1999) 46, p

41 1 H- 31 P Correlation Spectrum G-p-C-p-G-p-A-p-T-p-A-p-G-p-A-p-G-p-C-p-G G-p-C-p-G-p-A-p-G-p-A-p-T-p-A-p-G-p-C-p-G (n-1) H3'- (n) P (n) P - (n) H4' 7p 3p 6p 2p, 5p, 9p 11p 10p b) Phosphate buffer 31 P 6A 2C 5T 8A 4A 1G 10C 9G 7G 3G 6A 9G 2C 10C 5T 11G H 4 ' H 3 ' 5' H 2 " O O H 5 ' H 5 " O ε (t) P γ - O O β H 2 ' Base H 1 ' H 2 " Base 8p 4p 7G 3G 8A 4A H 4 ' H 3 ' 3' O H 2 ' H 1 ' JACS (1992) 114,

42 OE-based and via through-bond coherence transfer assignment in labeled nucleic acids

43 Flowcharts for resonance assignment in nucleic acids B. OE-based assignment in labeled nucleic acids I (H 2 O) Exchangeable proton/nitrogen correlation 2D 15 -HMQC imino 1 H optimized G 1H, U 3H amino 1 H optimized C 4H 2, G 2H 2, A 6H 2 Exchangeable proton/nitrogen sequential assignment 3D 15 -OESY-HMQC (imino 15 edited OESY) imino-imino, amino-imino 3D 15 -OESY-HMQC (amino 15 edited OESY) amino-imino II (H 2 O) Partial resonance assignment of non-exchangeable proton from OE connectivities with amino and/or imino protons 3D 15 -OESY-HMQC (imino 15 edited OESY) aromatic-imino Progress in uclear Magnetic Resonance Spectroscopy (1998) 32, p

44 Flowcharts for resonance assignment in nucleic acids B. OE-based assignment in labeled nucleic acids (continued) III (D 2 O) Identification of sugar proton spin systems 3D HCCH-COSY H1 -H2 3D HCCH-RELAY H1 -H2 /H3 3D HCCH-TOCSY Identification of sugar carbon spin systems 2D 13C-CT-HSQC/HMQC 3D HCCH-COSY H1 -C2 3D HCCH-RELAY H1 -C2 /C3 3D HCCH-TOCSY H1 -C2 /C3 /C4 /C5 Identification of proton/carbon aromatic spin systems 2D 13 C-CT-HSQC/HMQC H6-C6, H8-C8, H5-C5, H2-C2 2D/3D HCCH-COSY H6-H5, H6-C6/ C5, H5-C6/ C5 Sequential resonance assignment 3D 13 C-OESY-HMQC H6/H8-H1, H6/H8-H2 H2 IV (D 2 O) Assignment of 31 P resonances e.g. ( 1 H, 31 P) HETCOR/HETTOC Progress in uclear Magnetic Resonance Spectroscopy (1998) 32, p

45 Flowcharts for resonance assignment in nucleic acids C. Assignment via through-bond coherence transfer in labeled nucleic acids I (H 2 O) II (H 2 O) III (D 2 O) Exchangeable proton/nitrogen correlation 2D 15 -HMQC imino 1 H optimized G 1H, U 3H amino 1 H optimized C 4H 2, G 2H 2, A 6H 2 Through-bond amino/imino to non-exchangeable base proton correlations HCCH/HCCH 1. Through-bond H2-H8 correlations {HCCH-TOCSY/( 1 H, 13 C) HMBC} 2. Through-bond base-sugar correlations {HC (base) with HC (sugar), HCCH, HCH, {HC (sugar) with H89(H8)C8H8}, {HC (sugar) with (Hb,Hb) HSQC}, {(H1, C8/6) HSQC with (H8/6, C8/6) HSQC} 3. Through-bond sugar correlations {HCCH-COSY/ HCCH-TOCSY} 4. Sequential resonance assignment via through-bond sugar-phosphate backbone correlations ( 1 H, 13 C, 31 P) HCP/ PCH/ PCCH-TOCSY/ HPHCH Progress in uclear Magnetic Resonance Spectroscopy (1998) 32, p

46 RA synthesis by in vitro transcription Transcription D A dt dc dg ra rg rc R A RA samples at natural isotopic abundance and enriched in 15 and 13 C can be prepared with T7 RA polymerase. da ru T7 polymerase DA template Transcription starting 3 ATTATGCTGAGTGATATCCTTATACTATGTAAACTAGTCATATAGG 5 5 TAATACGACTCACTATAG 3 Top strand RA synthesized 5 3 GGAAUAUGAUACAUUUGAUCAGUAUAUCC

47 Heteronuclear Chemical Shifts in ucleotides Current Protocols in ucleic Acid Chemistry (2000)

48 2D 15 1 H HMQC spectra of RA imino resonances at different conditions PAS (1997) 94, p

49 The 1 H- 13 C HSQC spectra of labeled nucleic acids (A) H6/H8-C6/C8, (B) H1 -C1, (C) H2 /H2 -C2, and (D) H3 -C3

50 Intraresidue correlation via through-bond coherence transfer MR experiments Adenine H2-H8 or H5-H6 correlation H1,H2, H3 H4 H5 H5 correlations, HCCH-TOCSY H8-H1 correlation, HC ucleotide spin system

51 Correlation in the base-sugar: HC 3D spectra 2D and 3D TROSY-HC for obtaining ribose base and intra-base correlations in the nucleotides of DA and RA. Dotted arrows indicate the intra-base transfers and solid arrows the ribose-base transfers. H6/H8 H1 JACS. 2001, 123,

52 3D HCCH-TOCSY Progress in uclear Magnetic Resonance Spectroscopy (1998) 32, p H1

53 Interresidue correlation through bond (HCP) 2 spin systems can be linked Adenine H3 -C3 -P(n-1) Residue n Guanine H5,H5 (n-1)-c5 (n-1)-p(n-1) OH Progress in uclear Magnetic Resonance Spectroscopy (1998) 32, p

54 Direct observation of H-bonds in nucleic acid base pairs by inter-nucleotide 2 J couplings J H-COSY J H HSQC 3D 13 C-OESY 1 H3-15 3(U) to 15 1(A) the connectivity between 1 H3(U329) and the 1 H2-13 C2 (A32) 1 H2 (A) to 15 1(A) and 15 3(A) JACS. (1998) 120,

55 Structural Determination of ucleic Acids by MR 1) Similar to those used in protein 2) First build a nucleic acid sequence template 3) Input H-bonded constraints 4) Input all exchangeable and non-exchangeable distance constraints and/or dihedral constraints 5) Use Distance Geometry calculation to get some initial structures 6) Use Molecular Dynamics method to refine the structures 3 5 Distance geometry calculator (XPLOR-IH) Distance constraints (OEs) Dihedral angles constraints (J-coupling) 3 5

56 III. Advanced developments in MR Spectroscopy

57 ew Techniques in MR Spectroscopy (1). Residual Dipolar Coupling (RDC) OE, dihedral angle and H-bond are short-range restraints and have limitations for some structure determination, like extended structures or multiple-domain structure. RDC is a novel restraint and provides global structure information. or (2). Transverse Relaxation-Optimized Spectroscopy (TROSY) TROSY, which was developed by K. Wüthrich, can select one fourth of the signals that relax more slowly than the others. The utilization of TROSY techniques push the size limit of MR spectroscopy to 30~50 kda. (3). Other Applications Paramagnetic Spin Labeling.

58 Residual Dipolar Coupling (RDC) Values of static dipolar coupling constant of two-spin systems in protein backbone Residual dipolar couplings arise from dipole-dipole interactions between nuclei. In aqueous solution, the isotropic orientation of the molecules average out the dipolar couplings. However, in oriented media, the molecular tumbled anisotropically. The order of 10-4 to 10-3 of anisotropy tuned the dipolar coupling constant to be a residual value of few Hz, which are well detectable by MR spectroscopy.

59 Residual Dipolar Coupling (RDC) The residual dipolar coupling between two spins A and B are given by : <D AB > = - C(B o ) [ χ a (3cos 2 θ -1) + 3/2 χ r (sin 2 θ cos2φ) ] where C(B o ) = S(B o2 /15kT)[γ A γ B h/(4π 2 r AB3 ). γ A and γ B are gyromagnetic ratios of A and B. r AB is the distance between A and B. So, B o, D AB S (order parameter), D AB

60 Alignment Media Phages (Pf1, fd, TMV) (Zweckstetter, JBMR) Bicelles (Sanders & Schwonek, Biochemistry, 1992; Ottiger&Bax, JBMR 1998) Polyacrylamide gels (Tycko,JBMR; Grzesiek JBMR; Chou, JBMR) Paramagnetic tagging (Opella, Griesinger, Byrd) CPBr/hexanol (Barrientos, J. Mag. Res, ~2000) C12E5/hexanol (Ruckert&Otting, JACS 2000) Cellulose crystallites (Matthews, JACS, ~2000)

61 Alignment of Molecules in Anisotropic Solutions The most-used media for RDC measurement are : (a). Phospholipid bicelles and (b). Filamentous phage

62 15 -IPAP HSQC for H RDC values Isotropic solution mg/ml Pf1 J H J H + D H 15 Chemical Shift (ppm) 1 H Chemical Shift (ppm)

63 3D HCO for C RDC values Isotropic solution mg/ml Pf1 J C J C + D C 13 C Chemical Shift (ppm) 1 H Chemical Shift (ppm)

64 Structure Refinement with RDC Restraints <D AB >(θ,φ) = D a [ χ a (3cos 2 θ -1) + 3/2 D r (sin 2 θ cos2φ) ] X Z Y

65

66 Transverse Relaxation-Optimized Spectroscopy (TROSY) (a). one-decoupled HSQC (b). Decoupled HSQC (c). TROSY-HSQC 15 1 H 1. Main relaxation source for 1 H and 15 : dipole-dipole (DD) coupling and, at high magnetic fields, chemical shift anisotropy (CSA). 2. Different relaxation rates (line width) for each of the four components of 15-1 H correlation. 3. The narrowest peak (the blue peak) is due to the constructive canceling of transverse relaxation caused by chemical shift anisotropy (CSA) and by dipole-dipole coupling at high magnetic field. 4. TROSY selectively detect only the narrowest component (1 out of 4).

67 Interference between DD and CSA Relaxation DD + CSA (large) (large) DD CSA (large) (large) (A) At High Magnetic Field (TROSY line-narrowing effect) DD (large) + CSA (small) DD CSA (large) (small) (B) At Low Magnetic Field (almost no TROSY line-narrowing effect) DD relaxation is field-independent. However, CSA relaxation B 02, therefore at high magnetic fields, CSA relaxation can be comparable to DD relaxation, and the interference effect on relaxation can be observed.

68 TROSY Effect is Field Dependent and Motion Dependent 800 (kda) Linewidth 150 kda 50 kda Magnetic field strength Optimal field strength: 1 GHz for amide H; 600 MHz for CH in aromatic moieties ( MHz applicable).

69 Deuteration- MR structural study of larger proteins Deuteration is also an important techniques for MR study of larger proteins (> 20kDa). It is achieved by raising the E. coli. in D 2 O medium (T$ 10,000 / 1L D 2 O). Because of the significantly lower gyromagnetic ratio of 2 H compared to 1 H (γ[ 2 H] / γ[ 1 H] = 0.15), replacement of protons with deuterons removes contributions to proton linewidths from proton-proton dipolar relaxation and 1 H- 1 H scalar couplings. The effect of deuteration is similar with that of TROSY and both techniques are frequently used for MR study of larger proteins.

70 The Sensitivity and Resolution Gain by TROSY and Deuteration 2 H, 15 -Gyrase-45 (45 kda), 750 MHz Current Opinion in Structural Biology (1999) 9, p,

71 Paramagnetic Relaxation Enhancement (PRE) Paramagnetic spin labeling MTSL MTSL= S-(2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl methanesulfonothioate.

72 Spin Labeling on DA by EDTA- Derivatized Deoxythymidine

73 PRE Effects as Mn 2+ -chelated

74 PRE Effects Observed as Spin Labeling at Either End of the DA

75 Specific SRY/DA Interactions

76 IV. Cases of protein/nucleic acids complexes

77 The common DA recognition motifs Helix-turn-helix (HTH) domain Zinc-finger (ZF) domain By Dr. Song Tan

78 The common DA recognition motifs Winged-helix (WH) domain S204 - α1 C- G213 α3 196 Chemical shift change plot based on MR titration data Recognition helix E S204 G213 Wing α2 E172

79 The common RA recognition motifs RP/RRM domain RP: ribonucleoprotein RRM: RA-recognition motif Structure (1997) 5, p

80 The common RA recognition motifs The KH domains KH: K-homology motif The invariant Gly X X Gly segment is shown in yellow, and the variable loop in red. (a) A view of the β-sheet face of the KH domain. (b) A 90 rotation from the view shown in (a). Structure (1999) 7, p

81 MR spectroscopy as a tool for secondary structure determination of large RAs. three intermolecular helices four-way helical junction 1 G-U 2 U-U 21 Watson-Crick Annu. Rev. Biophys. Biomol. Struct. (2006) 35,p

82 The structure of HCV IRES domain II Dependence of RDC values on the orientation of the interdipolar vector (C-H) and the alignment tensor Refinement of the HCV IRES domain II structures calculated with by the use of different sets of RDCs Rmsd = 7.48Å Rmsd = 5.79Å Rmsd = 2.18Å Annu. Rev. Biophys. Biomol. Struct. (2006) 35,p

83 Structure of the HIV-1 ucleocapsid protein with SL3 Ψ-RA recognition element Science (1998) 279, p

84 Structure of the HIV-1 ucleocapsid protein with SL3 Ψ-RA recognition element Science (1998) 279, p

85 The best fit superposition and space-filling representation of the SL3 RA in the C-SL3 complex Science (1998) 279, p

86 Recognition of the mra AU-rich element by the zinc finger domain of TIS11d (a) The ensemble of best 20 structures superposed on backbone heavy atoms in ordered regions of the protein and RA. (b) Ribbon representation of a single structure with the addition of green side chains for the zinc-coordinating ligands. (c) Backbone superposition of the structure ensembles of fingers 1 and 2. Finger 1 (Arg153-Phe180) is dark blue (backbone), green (zinc coordinating side chains) and red (intercalating aromatic rings); the bound RA (U6, A7, U8, U9) is orange. The corresponding colors for finger 2 are light blue, yellow, pink and yellow. 5 -UUAUUUAUU-3 SMB (2004) 11, p

87 Comparison between nucleolin RBD12-sRE complex and the other RBD-RA complexes RBD: RA biding domain RE: nucleolin recognition element EMBO J (2000) 19, p

88 Thank you