Insecticidal Activity and Histopathological Effects of Vip3Aa Protein from Bacillus thuringiensis on Spodoptera litura

Transcription

1 (2016), 26(10), Review Research Article jmb Insecticidal Activity and Histopathological Effects of Vip3Aa Protein from Bacillus thuringiensis on Spodoptera litura Feifei Song 1, Yunfeng Lin 1, Chen Chen 1, Ensi Shao 1,2, Xiong Guan 1,3, and Zhipeng Huang 1,3 * Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education, College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou, Fujian, P.R. China China National Engineering Research Center of JUNCAO Technology, Fujian Agriculture and Forestry University, Fuzhou, Fujian, P.R. China Fujian-Taiwan Joint Center for Ecological Control of Crop Pests, Fujian Agriculture and Forestry University, Fuzhou, Fujian, P.R. China Received: May 2, 2016 Revised: July 5, 2016 Accepted: July 6, 2016 First published online July 19, 2016 *Corresponding author Phone: ; Fax: ; zhipengh6841@163.com pissn , eissn Copyright 2016 by The Korean Society for Microbiology and Biotechnology Vegetative insecticidal proteins (Vips) are insecticidal proteins synthesized by Bacillus thuringiensis during the vegetative stage of growth. In this study, Vip3Aa protein, obtained by in vitro expression of the vip3aa gene from B. thuringiensis WB5, displayed high insecticidal activity against Spodoptera litura aside from Spodoptera exigua and Helicoverpa armigera. Bioassay results showed that the toxicity of Vip3Aa protein against S. litura larvae statistically decreased along with the increase of the age of the larvae, with LC = ng/cm for neonatal larvae, LC = ng/cm for first instar larvae, LC = ng/cm for second instar larvae, and LC = ng/cm for third instar larvae. The accumulative mortality of 100% larvae appeared at 72 h for all instars of S. litura larvae, when feeding respectively with 83.22, , , and ng/cm of Vip3Aa toxin to the neonatal and first to third instar larvae. The histopathological effects of Vip3Aa toxin on the midgut epithelial cells of S. litura larvae was also investigated. The TEM observations showed wide damage of the epithelial cell in the midgut of S. litura larvae fed with Vip3Aa toxin. Keywords: Vip3Aa protein, Spodoptera litura, toxicity, histopathological effects Introduction Bacillus thuringiensis is a gram-positive bacterium with wide insecticidal activity against numerous organisms such as mites, nematodes, protozoans, and insects of the orders Diptera, Coleoptera, Homoptera, Lepidoptera, Hymenoptera, Ortoptera, and Phthiraptera [36]. The Cry proteins or deltaendotoxins produced by this bacterium are the most wellknown insecticidal proteins and have been extensively used for biocontrol of pests [22]. Besides Cry proteins, other virulence factors of this bacterium are β-exotoxin, Cyt, secreted insecticidal protein, and vegetative insecticidal proteins (Vips) [32]. Vips, synthesized during the vegetative stage of growth by several strains of B. thuringiensis, contribute to the insecticidal activity of this bacterium against insects [16, 44] and share no sequence homology with Cry proteins [14]. Relative to the narrow-spectrum activity of many Cry proteins [34], Vips have a broad range of activity spectra [32]. Since the first vip gene was reported [17], a considerable number of new vip genes had been screened [3, 6, 23, 28, 30, 31, 35, 42]. So far, more than 100 Vips have been recognized and classified into four groups, Vip1, Vip2, Vip3, and Vip4, based on the amino acid sequence similarity ( lifesci.sussex.ac.uk/home/neil_crickmore/bt/vip.html). Vip1 and Vip2 proteins combine to form a binary toxin and display high insecticidal activity against some coleopteran [40] and homopteran insects [35], whereas Vip3 proteins are active against a wide variety of lepidopteran insects [23, 42]. Some studies indicated that Vip3 proteins display toxicity against many lepidopteran pests: Mamestra brassicae, Spodoptera littoralis, Lobesia botrana [30, 33], Spodoptera

2 Bioactivity of Vip3Aa Protein from Bacillus thuringiensis 1775 frugiperda [19, 38], Tuta absoluta [37], Trichoplusia ni [18], Dendrolimus pini, Cydia pomonella [7], Manduca sexta [25], Plutella xylostella [11, 21, 30], Ectomyelois ceratoniae [12], Ephestia kuehniella [3], Helicoverpa armigera [15, 18, 25, 26], Heliothis virescens [17, 21], and Spodoptera exigua [15, 17]. However, differences in toxicity among Vip3 proteins had been found. The insecticidal activity of Vip3Aa59 is significantly higher than Vip3Aa58 towards D. pini [7]. Vip3Aa, Vip3Ae, Vip3Af, and Vip3Ab are active against most of the tested insects, whereas Vip3Ad shows no toxicity [33]. For Agrotis ipsilon, Vip3Aa1, Vip3Aa2, Vip3Ab, and Vip3Ae display insecticidal activity [33], but Vip3Aa9 and Vip3Ad are the opposite [22]. In addition, some lepidopteran insects, such as Bombyx mori [18], Danaus plexippus [25], Ostrinia nubilalis [17, 25, 41], and Pieris brassicae [11], are not susceptible to Vip3 proteins. So far, little is known about the mode of action of Vip3 proteins. It is usually accepted that, as with Cry proteins, Vip3 proteins need to be solubilized in the insect gut by proteolysis and then bound to specific receptors in the brush border epithelial midgut cells, which leads to pore formation and cell lyses [24, 25, 27]. Several studies have shown that the target receptors in the insect midgut of Vip proteins are different from Cry proteins [9, 20, 27, 38], which suggests the potential for using Vip proteins to complement or substitute Cry proteins on species with low susceptibility or resistance to the latter. A Vip-Cry fusion protein can be another way to expand the insecticidal spectrum of B. thuringiensis toxins [4]. Spodoptera litura is a highly dispersive and polyphagous species [43] that is known to be a serious pest of many economically valuable crops, such as cotton, chili, taro, tobacco, groundnut, tea, cabbage, eggplant, cauliflower, capsicum, potato, and castor [5, 8, 39], and is also notorious as one of the most destructive pests of agricultural crops in China. In order to know the potential of Vip3 proteins for use in the control of S. litura, we obtained a Vip3Aa protein by cloning and expression from B. thuringiensis WB5, assayed its insecticidal activity against S. litura, and investigated the histopathological change in the midgut of S. litura caused by this toxin. This study will contribute to the application of Vip3Aa protein for biocontrol of S. litura. Materials and Methods Insects S. litura, S. exigua, and H. armigera were purchased from Ke Yun Biology Co. (China) and reared in a growth chamber under controlled conditions of temperature at 27 ±2 Q C, relative humidity of 55 ± 5%, and photoperiod of 16: 8 h (light/dark). Preparation and Purification of Vip3Aa Protein The entire coding region of the vip3aa gene (GenBank Accession No. AF500478) of B. thuringiensis WB5 was amplified by PCR with High Fidelity Phusion DNA polymerase, using genomic DNA as template and Vip3A-F/Vip3A-R (5 GACATATGAACA AGAATAATACTAAATTAAGCAC3 /5 AGTCTAGATTACTTA ATAGAGACATCGTAAAAATG3 ) as primers. The PCR product was purified, cloned into the pmd18-t vector (Takara), and confirmed by sequencing. For in vitro gene expression, the vip3aa gene was inserted into multiple cloning sites of the pczn1 expression vector (Zoonbio Biotechnology) and then transformed into E. coli BL21. The transformants were grown at 37 Q C overnight in LB medium supplemented with ampicillin (100 µg/ml) in an orbital shaker at 220 rpm. These precultures were used as seed and transferred to 1,000 ml of the same culture medium and incubated in the same condition. When the OD of the cultures had reached about 0.6, Vip3Aa expression was induced with 0.2 mm isopropyl-dthiogalactopyranoside at 16 Q C for 4 h. After centrifugation at 1,200 g for 10 min at 4 Q C, the pellet was resuspended in Ni-IDA Binding-Buffer and sonicated (on ice, for 20 min, with a 5 sec pause in between, at 400 W). The suspension was centrifuged at 1,200 g for 10 min at 4 Q C, and the supernatant was collected and purified by Ni-IDA-Sepharose affinity column. The Vip3Aa protein eluted from the Ni-column was dialyzed with 0.01 mol/l PBS buffer (NaCl 8.0 g/l, KCl 0.2 g/l, Na HPO 1.44 g/l, KH PO 0.24 g/l, ph 7.2) to remove imidazole. The concentrations of Vip3Aa protein were estimated using the Bradford method [13]. Bioassays First instar larvae of three destructive pests (S. litura, S. exigua, and H. armigera) of agricultural crops in China were used for testing their susceptibilities to Vip3Aa toxin. The larvae were fed with three concentrations (1,200, 120, and 12 ng/cm ) of Vip3Aa toxin and 0.01 mol/l PBS buffer (as control) in artificial solid diet, respectively. Thirty larvae were used for each treatment. The bioassays were performed in a growth chamber at 27 ±2 Q C, 55 ±5% (RH), and 16:8 h (light:dark) for 8 days, with the corresponding diet replaced every 24 h. Mortality due to each treatment was recorded every 24 h for 8 days. The toxicity of Vip3Aa toxin to the neonate and first to third instar larvae of S. litura, which is sensitive to Vip3Aa toxin, were further assayed. Various concentrations of Vip3Aa toxin were prepared by dilution with 0.01 mol/l PBS buffer, with 5-fold serial dilution for the neonate larvae and 2.5-fold for the first to third instar larvae. The different instar larvae were fed with various concentrations of Vip3Aa toxin in artificial solid diet, respectively. For each instar and each concentration, 10 larvae of S. litura were used. Treatments were duplicated and repeated six times. The environmental conditions and negative control for the bioassay were the same as those used in the susceptibility bioassay. Mortality from each treatment was recorded every 24 h for 8 days. Probit analysis of mortality data after the toxin treatment for 72 h, October 2016 Vol. 26 No. 10

3 1776 Song et al. to estimate median lethal concentrations (LC ), 90% lethal concentrations (LC ), and 95% confidence interval (CI), was carried out with DPS software. Sample Preparation for Histopathology Observation Third instar S. litura larvae were starved for 2 h, and then fed with LC of Vip3Aa toxin and 0.01 mol/l PBS buffer (as control) in artificial diet for 24 h. After chilled on ice for 30 min, the guts were excised and fixed in 2.5% glutaraldehyde and then 1% osmic acid stationary liquid. Tissues were dehydrated via increasing ethanol concentrations, and then rinsed in 100% acetone and fixed by embedding and curing. Images were captured by transmission electron microscopy (JEM-2010 (HR)). Results Purification of Vip3Aa Protein The gene that encodes Vip3Aa protein was cloned from B. thuringiensis WB5 and in vitro expressed in E. coli BL21. The Vip3Aa protein was obtained after the expressed products were purified by affinity chromatography with an Ni-column. Analysis by 12% SDS PAGE showed that the molecular mass of Vip3Aa protein was about 88 kda (Fig. 1). The Vip3Aa protein was dissolved with 0.01 mol/l PBS buffer and stored at -20 Q C for use in bioassays and histopathological observations. Qualitative Screening of Insect Susceptibility to Vip3Aa Protein To investigate whether the obtained Vip3Aa is toxic to S. litura, S. exigua, and H. armigera, an initial qualitative screening was carried out. The data showed that S. litura larvae were the most sensitive to Vip3Aa toxin, followed by S. exigua. Vip3Aa protein at a low concentration (12 ng/cm ) could cause mortality of 40% to S. litura, and 100% mortality at 120 ng/cm. Compared with S. litura, Vip3Aa protein at a higher concentration could cause similar mortality to S. exigua. H. armigera larvae were insensitive to Vip3Aa toxin, with a mortality of only 16.7% caused by the highest concentration (1200 ng/cm ) of this protein (Fig. 2). Toxicity of Vip3Aa Protein against S. litura Larvae On the basis of the above susceptibility assay, we further tested the toxicity of Vip3Aa toxin to the neonate and first to third instar larvae of S. litura. After been fed Vip3Aa toxin, the lower instar larvae were more sensitive to the toxin. For neonatal larvae, death could be observed at 24 h after feeding with 3.33 ng/cm of Vip3Aa toxin. Even if the first, second, and third instar larvae were fed with , and 1, ng/cm of Vip3Aa toxin, respectively, Fig. 1. SDS-PAGE analysis of purification Vip3Aa protein. Lane M, protein marker; Lane 1, Vip3Aa protein. no death was observed at 24 h. The accumulative mortality of 100% larvae appeared at 72 h for all instars of larvae, when feeding 83.22, , , and ng/cm of Vip3Aa toxin to the neonatal larvae, first instar larvae, second instar larvae, and third instar larvae, respectively (Fig. 3). These results revealed that the toxicity of Vip3Aa protein against S. litura larvae statistically decreased along with the increase of the age of the larvae, which corresponds to an increase of LC observed from low to high instar larvae, with LC = ng/cm for neonatal larvae, LC = ng/cm for first instar larvae, LC = ng/cm for second instar larvae, and LC = ng/cm for third instar larvae (Table 1). Histopathological Effects of Vip3Aa Protein on S. litura Larvae The bioassay showed that Vip3Aa protein was toxic to Fig. 2. Qualitative screening of insect susceptibility to Vip3Aa toxin.

4 Bioactivity of Vip3Aa Protein from Bacillus thuringiensis 1777 S. litura larvae. The histopathological effects of Vip3Aa toxin on the midgut epithelial cells of S. litura larvae were detected. The observations of the midgut cross-sections showed wide damage of the midgut epithelial cells of S. litura larvae caused by Vip3Aa toxin (Fig. 4B), compared with the control (Fig. 4A). In the midgut of S. litura larvae fed with Vip3Aa toxin, the histopathological modifications included vacuolization of the cytoplasm, cellular swelling, and brush border membrane destruction (Fig. 4B-Am), the karyotheca of the cell nucleus crinkled and the chromatins dispersedly distributed (Fig. 4B-N), and mitochondria swelling and deformation with disintegration and lysis of cristae (Fig. 4B-Mi). In contrast, the midgut of S. litura larvae fed with PBS showed a well-preserved layer of epithelial cells with unaffected apical microvilli membrane (Fig. 4A-Am), a smooth karyotheca of the cell nucleus with homogeneous chromatins (Fig. 4A-N), and elliptical mitochondria with apparent cristae (Fig. 4A-Mi). Discussion Fig. 3. Accumulative mortality of S. litura larvae of different instars after treatment with Vip3Aa toxin. The neonate and first to third instar larvae of S. litura were fed with different concentrations (ng/cm ) of Vip3Aa toxin and 0.01 mol/l PBS buffer (as control, CK) in artificial solid diet. It is accepted that lepidopteran insects appear to be one of the biggest groups of crop pests [29]. Among them, Spodoptera larvae are polyphagous pests, damaging a variety of commercially important crops around the world. The three species analyzed in this study are common pests of lepidopteran, which cause extreme losses to many crops in China. B. thuringiensis Vip3 proteins exhibit strong features for controlling a wide variety of lepidopteran species. In this study, we investigated the toxicities of Vip3Aa protein, obtained by in vitro expression of the vip3aa gene from B. thuringiensis WB5, against different instar larvae of S. litura (Table 1). The results showed that the toxicity of Vip3Aa toxin against S. litura larva statistically decreased with increases in the age of the larvae. The LC value of the toxin for neonatal larvae of S. litura was 2.6 ng/cm (Table 1), Table 1. LC and LC of Vip3Aa toxin against S. litura larvae*. LC (ng/cm ) Vip3Aa toxin Treatment LC (ng/cm ) b ± (SEM) D p-value E (CI min.- max.) C (CI min.- max.) C Neonatal larvae ( ) ( ) ± First instar larvae ( ) ( ) ± Second instar larvae ( ) ( ) ± Third instar larvae ( ) ( ) ± *LC, LC, and fiducial limit (95%) values are given in ng of toxin per cm of diet surface. C (CI min. max.): confidence interval (CI 95%); D b ± (SEM): angular coefficient and standard error, parameters of the nonlinear equation for calculation; E Data were significant when p < 0.05; CDE DPS, Data Processing System software was used for the procedures of modeling conducting. These data were calculated automatically by this software. October 2016 Vol. 26 No. 10

5 1778 Song et al. epithelial midgut cells. The histopathological effects of Vip3Aa toxin on the midgut epithelial cells of S. litura larvae were also investigated in this study. The TEM observations (Fig. 4B) showed wide damage of the epithelial cells in the midgut of S. litura larvae fed with Vip3Aa toxin. This may explain the mechanism of the insecticidal activity to a certain extent. However, the gut proteins interacting with Vip3Aa toxin remain to be identified. Future studies to identify potential Vip3Aa receptors in the midgut of S. litura based on toxin-receptor interactions are warranted, as they will be critical for clarifying the mode of action of Vip3 toxins. Acknowledgments This study was supported by the Project of Fujian-Taiwan Joint Center for Ecological Control of Crop Pests (No. Minjiaoke [2013] 51), National Natural Science Foundation of China (No ), and State Administration of Grain (No ). References Fig. 4. Histopathological effects of Vip3Aa toxin on S. litura larvae midgut. Panel A indicates the ultrastructure of the midgut of larvae fed with PBS buffer. Panel B indicates the ultrastructure of the midgut of larvae fed with Vip3Aa toxin. Me: midgut epithelium; Bm: basement membrane; L: lumen; Am: apical membrane; N: nucleus; Mi: mitochondria. which is lower than that for S. frugiperda (LC = ng/cm ), S. albula (LC = 3.90 ng/cm ), S. eridania (LC = 2.78 ng/cm ), and S. cosmioides (LC = 3.44 ng/cm ) [10], and S. littoralis (LC = 305 ng/cm ) [2], S. exigua (LC = 290 ng/cm ), [14] and Ephestia kuehniella (LC = 36 ng/cm ) [1]. In addition, we observed depressed growth of larvae that survived being fed the toxin. It can therefore be deduced that the Vip3Aa toxin is effective for controlling the population growth of S. litura. Although little is known until now about the mode of action of Vip3 proteins, it is commonly accepted that they need to be solubilized in the insect gut to an active toxin and then bound to specific receptors in the brush border 1. Abdelkefi-Mesrati L, Boukedi H, Chakroun M, Kamoun F, Azzouz H, Tounsi S, et al Investigation of the steps involved in the difference of susceptibility of Ephestia kuehniella and Spodoptera littoralis to the Bacillus thuringiensis Vip3Aa16 toxin. J. Invertebr. Pathol. 107: Abdelkefi-Mesrati L, Boukedi H, Dammak-Karray M, Sellami-Boudawara T, Jaoua S, Tounsi S Study of the Bacillus thuringiensis Vip3Aa16 histopathological effects and determination of its putative binding proteins in the midgut of Spodoptera littoralis. J. Invertebr. Pathol. 106: Abdelkefi-Mesrati L, Tounsi S, Jaoua S Characterization of a novel vip3-type gene from Bacillus thuringiensis and evidence of its presence on a large plasmid. FEMS Microbiol. Lett. 244: Ahmad A, Javed MR, Rao AQ, Khan MA, Ahad A, Din SU, et al In-silico determination of insecticidal potential of Vip3Aa-Cry1Ac fusion protein against lepidopteran targets using molecular docking. Front. Plant Sci. 6: Ahmad M, Iqbal Arif M, Ahmad M Occurrence of insecticide resistance in field populations of Spodoptera litura (Lepidoptera: Noctuidae) in Pakistan. Crop Prot. 26: Asokan R, Swamy HM, Arora DK Screening, diversity and partial sequence comparison of vegetative insecticidal protein (vip3a) genes in the local isolates of Bacillus thuringiensis Berliner. Curr. Microbiol. 64: Baranek J, Kaznowski A, Konecka E, Naimov S Activity of vegetative insecticidal proteins Vip3Aa58 and Vip3Aa59 of Bacillus thuringiensis against lepidopteran pests.

6 Bioactivity of Vip3Aa Protein from Bacillus thuringiensis 1779 J. Invertebr. Pathol. 130: Baskar K, Ignacimuthu S Antifeedant, larvicidal and growth inhibitory effects of ononitol monohydrate isolated from Cassia tora L. against Helicoverpa armigera (Hub.) and Spodoptera litura (Fab.) (Lepidoptera: Noctuidae). Chemosphere 88: Ben Hamadou-Charfi D, Boukedi H, Abdelkefi-Mesrati L, Tounsi S, Jaoua S Agrotis segetum midgut putative receptor of Bacillus thuringiensis vegetative insecticidal protein Vip3Aa16 differs from that of Cry1Ac toxin. J. Invertebr. Pathol. 114: Bergamasco VB, Mendes DR, Fernandes OA, Desiderio JA, Lemos MV Bacillus thuringiensis Cry1Ia10 and Vip3Aa protein interactions and their toxicity in Spodoptera spp. (Lepidoptera). J. Invertebr. Pathol. 112: Bhalla R, Dalal M, Panguluri SK, Jagadish B, Mandaokar AD, Singh AK, et al Isolation, characterization and expression of a novel vegetative insecticidal protein gene of Bacillus thuringiensis. FEMS Microbiol. Lett. 243: Boukedi H, Ben Khedher S, Triki N, Kamoun F, Saadaoui I, Chakroun M, et al Overproduction of the Bacillus thuringiensis Vip3Aa16 toxin and study of its insecticidal activity against the carob moth Ectomyelois ceratoniae. J. Invertebr. Pathol. 127: Bradford MM A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: Caccia S, Chakroun M, Vinokurov K, Ferre J Proteolytic processing of Bacillus thuringiensis Vip3A proteins by two Spodoptera species. J. Insect Physiol. 67: Cai J, Xiao L, Yan B, Bin G, Chen Y, Ren G Vip3A is responsible for the potency of Bacillus thuringiensis 9816C culture supernatant against Helicoverpa armigera and Spodoptera exigua. J. Gen. Appl. Microbiol. 52: Donovan WP, Donovan JC, Engleman JT Gene knockout demonstrates that vip3a contributes to the pathogenesis of Bacillus thuringiensis toward Agrotis ipsilon and Spodoptera exigua. J. Invertebr. Pathol. 78: Estruch JJ, Warren GW, Mullins MA, Nye GJ, Craig JA, Koziei MG Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proc. Natl. Acad. Sci. USA 93: Fang J, Xu X, Wang P, Zhao JZ, Shelton AM, Cheng J, et al Characterization of chimeric Bacillus thuringiensis Vip3 toxins. Appl. Environ. Microbiol. 73: Figueiredo CS, Marucci SC, Tezza RID, Lemos MVF, Desidério JA Characterization of the vip3a gene and toxicity of Vip3Aa50 protein to fall armyworm and velvetbean caterpillar. Pesqui. Agropecu. Bras. 48: Gouffon C, Van Vliet A, Van Rie J, Jansens S, Jurat-Fuentes JL Binding sites for Bacillus thuringiensis Cry2Ae toxin on heliothine brush border membrane vesicles are not shared with Cry1A, Cry1F, or Vip3A toxin. Appl. Environ. Microbiol. 77: Gulzar A, Wright DJ Sub-lethal effects of Vip3A toxin on survival, development and fecundity of Heliothis virescens and Plutella xylostella. Ecotoxicology 24: Hernandez-Martinez P, Hernandez-Rodriguez CS, Rie JV, Escriche B, Ferre J Insecticidal activity of Vip3Aa, Vip3Ad, Vip3Ae, and Vip3Af from Bacillus thuringiensis against lepidopteran corn pests. J. Invertebr. Pathol. 113: Hernandez-Rodriguez CS, Boets A, Van Rie J, Ferre J Screening and identification of vip genes in Bacillus thuringiensis strains. J. Appl. Microbiol. 107: Lee MK, Miles P, Chen JS Brush border membrane binding properties of Bacillus thuringiensis Vip3A toxin to Heliothis virescens and Helicoverpa zea midguts. Biochem. Biophys. Res. Commun. 339: Lee MK, Walters FS, Hart H, Palekar N, Chen JS The mode of action of the Bacillus thuringiensis vegetative insecticidal protein Vip3A differs from that of Cry1Abendotoxin. Appl. Environ. Microbiol. 69: Liao C, Heckel DG, Akhurst R Toxicity of Bacillus thuringiensis insecticidal proteins for Helicoverpa armigera and Helicoverpa punctigera (Lepidoptera: Noctuidae), major pests of cotton. J. Invertebr. Pathol. 80: Liu JG, Yang AZ, Shen XH, Hua BG, Shi GL Specific binding of activated Vip3Aa10 to Helicoverpa armigera brush border membrane vesicles results in pore formation. J. Invertebr. Pathol. 108: Lone SA, Yadav R, Malik A, Padaria JC Molecular and insecticidal characterization of Vip3A protein producing Bacillus thuringiensis strains toxic against Helicoverpa armigera (Lepidoptera: Noctuidae). Can. J. Microbiol. 62: Nicholson GM Fighting the global pest problem: preface to the special toxicon issue on insecticidal toxins and their potential for insect pest control. Toxicon 49: Palma L, de Escudero IR, Maeztu M, Caballero P, Muñoz D Screening of vip genes from a Spanish Bacillus thuringiensis collection and characterization of two Vip3 proteins highly toxic to five lepidopteran crop pests. Biol. Control 66: Palma L, Hernandez-Rodriguez CS, Maeztu M, Hernandez- Martinez P, Ruiz de Escudero I, Escriche B, et al Vip3C, a novel class of vegetative insecticidal proteins from Bacillus thuringiensis. Appl. Environ. Microbiol. 78: Palma L, Muñoz D, Berry C, Murillo J, Caballero P Bacillus thuringiensis toxins: an overview of their biocidal activity. Toxins 6: Ruiz de Escudero I, Banyuls N, Bel Y, Maeztu M, Escriche B, Munoz D, et al A screening of five Bacillus thuringiensis Vip3A proteins for their activity against lepidopteran pests. J. Invertebr. Pathol. 117: Sanahuja G, Banakar R, Twyman RM, Capell T, Christou P Bacillus thuringiensis: a century of research, development October 2016 Vol. 26 No. 10

7 1780 Song et al. and commercial applications. Plant Biotechnol. J. 9: Sattar S, Maiti MK Molecular characterization of a novel vegetative insecticidal protein from Bacillus thuringiensis effective against sap-sucking insect pest. J. Microbiol. Biotechnol. 21: Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, et al Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62: Sellami S, Cherif M, Abdelkefi-Mesrati L, Tounsi S, Jamoussi K Toxicity, activation process, and histopathological effect of Bacillus thuringiensis vegetative insecticidal protein Vip3Aa16 on Tuta absoluta. Appl. Biochem. Biotechnol. 175: Sena JA, Hernandez-Rodriguez CS, Ferre J Interaction of Bacillus thuringiensis Cry1 and Vip3A proteins with Spodoptera frugiperda midgut binding sites. Appl. Environ. Microbiol. 75: Wang Y, Choi JY, Roh JY, Liu Q, Tao XY, Park JB, et al Genomic sequence analysis of granulovirus isolated from the tobacco cutworm, Spodoptera litura. PLoS One 6: e Warren GW Vegetative insecticidal proteins: novel proteins for control of corn pests, pp In Carozzi NB, Koziel M (eds.). Advances in Insect Control: The Role of Transgenic Plants. Taylor & Francis, London. 41. Yu CG, Mullins MA, Warren GW, Koziel MG, Estruch JJ The Bacillus thuringiensis vegetative insecticidal protein Vip3A lyses midgut epithelium cells of susceptible insects. Appl. Environ. Microbiol. 63: Yu X, Zheng A, Zhu J, Wang S, Wang L, Deng Q, et al Characterization of vegetative insecticidal protein vip genes of Bacillus thuringiensis from Sichuan Basin in China. Curr. Microbiol. 62: Zhou J, Zhang G, Zhou Q Molecular characterization of cytochrome P450 CYP6B47 cdnas and 5'-flanking sequence from Spodoptera litura (Lepidoptera: Noctuidae): its response to lead stress. J. Insect Physiol. 58: Zhu C, Ruan L, Peng D, Yu Z, Sun M Vegetative insecticidal protein enhancing the toxicity of Bacillus thuringiensis subsp kurstaki against Spodoptera exigua. Lett. Appl. Microbiol. 42: