Supplementary Information

Size: px

Start display at page:

Download "Supplementary Information"

Austin Dominick Ray
5 years ago
Views:

1 The ISME Journal Supplementary Information Ciobanu et al. SI Tables Table S1 List of studied samples and depths Sample name Core depth below the seafloor (m) 1H3 4 2H1* 6 3H1* 15 3H5 21 4H1 25 4H5* 31 5H H X* X X* X* X* X X R* R R* R* R* R* R* R* R* R* R* 1922 *Samples analyzed by using 454-pyrosequencing of 6S/18S rrna gene-tagged amplicons and real-time PCR.

2 Table S2 Primers used in this study Primer Target Sequence * (5 3 ) Tm Bac 341F Bacteria 16S rrna CCTACGGGAGGCAGCAG 58 C Uni 907R Bacteria 16S rrna CCGTCAATTCMTTTGAGTTT 50 C Bac AF Bacteria 16S rrna GTGCCAGCMGCCGCGGTAATAC 64 C Bac BR Bacteria 16S rrna CCGTCAATTCCTTTGAGTTT 51 C Bac 8F Bacteria 16S rrna AGAGTTTGATCATGGCTCAG 58 C 1492R Bacteria 16S rrna ACGGHTACCTTGTTACGACTT 50 C Arc 27Fa Archaea 16S rrna TCYGGTTGATCCTGSCGG 58 C Arc 806R Archaea 16S rrna GGACTACVSGGGTATCTAAT 50 C Arc 519R Archaea 16S rrna GGTDTTACCGCGGCKGCTG 61 C Euk 82F Eukarya 18S rrna GAADCTGYGAAYGGCTC 52 C Euk 516R Eukarya 18S rrna ACC AGACTTGCCCTCC 54 C Euk 42F Eukarya 18S rrna CTCAARGAYTAAGCCATGCA 53 C * Degenerated primers: R=G/A, Y=T/C, M=A/C, K=G/T, S=G/C, W=A/T, H=A/C/T, B=G/T/C, V=G/C/A, D=G/A/T, N=G/A/T/C. Primers used for pyrosequencing.

3 Table S3 Fusion primers used in this study ϯ

4 Table S4 Sequencing information Bacteria Archaea Eukarya Primer sets used for 454-pyrosequencing Bac AF/Bac BR Arc 27Fa/Arc 519R Euk42F/Euk516R Target regions of the 16S/18S rrna gene V4-V5 V1-V3 V1-V3 Average length of the target region (bp) Total number of tag sequences* Total OTUs at 3% difference * Trimmed reads that passed quality controls

5 Table S5 Vertical distribution of OTUs at 3% divergence that occurred more than 100 times

6 Table S6 Molecular identification of the fungal strain from sample 88X1 based on the ITS1 region of rrna Identity / Alignment Fungal strain 88X1 Cadophora malorum (JQ796752) Cadophora malorum (GU004209) Cadophora fastigiata (JN942894) Fungal strain 88X / / /238 Cadophora malorum (JQ796752) Cadophora malorum (GU004209) Cadophora fastigiata (JN942894) / / /

7 SI Figures Figure S1 Flow-diagram of the 454-pyrosequencing strategy.

8 (A) Touchdown PCR 95 C 7 min 95 C 1 min *61 C 1 min X C 1.5 min 95 C 1 min *51 C 1 min X C 1.5 min 72 C 7 min Bacterial primer sets Direct PCR: BacAF/BacBR, : 20:16 cycles Nested PCR: Bac341F/Uni907R, : 20:7 cycles; BacAF/BacBR, : 10:9 cycles Archaeal primer sets Direct PCR: ARC27Fa/ARC519R, : 20:16 cycles Nested PCR: ARC27Fa/ARC806R, : 20:7 cycles; ARC27Fa/ARC519R, : 10:9 cycles Eukaryotic primer sets Nested PCR: Euk42F/Euk516R, : 20:7 cycles; Euk82F/Euk516R, : 10:9 cycles (B) Fusion primer configuration A key Primer F MID Primer R MID key B Figure S2 A. Touchdown PCR programs used for direct and nested PCR amplifications, and primer pairs used for each domain. B. Diagram of general fusion primer configuration. Direct PCR amplifications were done with fusion primers specifically designed for each domain. Nested PCR amplifications were performed with normal primers for the first round and with fusion primers for the second round.

9 Figure S3 Core photographs of contact between Units II and III, and thin section photomicrographs illustrating changes in lithology and diagenesis in Units II and III. A. Glauconitic limestone above the unconformity, Subunit IIC (interval 317-U1352C-140R-1, 6 26 cm). B. Stylolitic white limestone below the unconformity, Unit III (interval 317-U1352C-141R-2, cm). C. Stylolitic white limestone with purple banding and pyrite concentrated in a stylolite, Unit III (interval 317-U1352C-144R-2, cm). D. Muddy limestone with layers of marlstone and purple banding, Unit III (interval 317-U1352C-148R-1, cm). E. Section of a high-amplitude stylolite passing through pelagic limestone with sparse foraminifers in Unit III. The stylolite is marked by brownish clay, along which the foraminifers are truncated (Sample 317- U1352B-141R-2, 15 cm). F, G. Abrupt high-angle contact between muddy limestone to limestone (transitional) below (within host rock) and glauconitic sandy marlstone above (potential injection material) in Unit II. Limestone color is a function of the foraminifer/nannofossil ratio (higher in light limestone; lower in dark limestone) (Sample 317-U1352C-137R-2, 58 cm). (Source: IODP report 317)(Fulthorpe et al., 2011).

10 Figure S4 Number of OTUs found for Archaea (red bars), Eukarya (green bars) and Bacteria (blue bars) for each depth sample. OTUs were defined using a strict 3% dissimilarity threshold between 16S or 18S rdna gene sequences. Numbers indicated to the right of each bar correspond to tag sequences constituting OTUs that were obtained by 454-pyrosequencing for each domain and depth sample.

11 Figure S5 Heat-map matrixes of β-diversity indices calculated by MOTHUR at 3% difference between OTUs. The index score indicates the similarity between two bacterial, archaeal or eukaryotic communities: Chao estimator for shared community richness; Pearson correlation coefficient for assessment of similarity in community membership; Spearman correlation coefficient for assessment of similarity in community structure.

12 Pearson correlations (r) between environmental parameters and their significance based on p-values NS not significant * 0.01<P<0.05 (light grey) ** <0.01 (dark grey) *** <0.001 (dark) Network of correlations between the 14 environmental parameters characterizing IODP Leg317 sediment core. Inner box parameters are proxys for outer box ones. Positive correlation Negative correlation *** ** * PARAMETERS Ethane Alkalinity Ammonium Calcium Magnesium ph Salinity Sulfate 1 *** *** NS NS ** ** NS ** NS NS ** NS *** 0,943 1 *** NS NS ** NS NS NS ** NS NS NS *** 0,943 1,000 1 NS NS ** NS NS NS ** NS NS NS *** 0,019-0,061-0,061 1 NS NS NS * NS ** NS NS NS NS -0,382-0,310-0,310-0,217 1 NS NS NS NS NS NS NS NS NS Ethane 0,656 0,710 0,710-0,112-0,143 1 NS NS NS NS NS NS NS ** Alkalinity -0,860-0,439-0,439-0,352 0,554-0,266 1 NS *** NS NS NS NS NS Ammonium 0,461 0,627 0,627 0,674-0,217 0,583-0,309 1 NS ** NS ** NS NS Calcium 0,851 0,288 0,288 0,201-0,355 0,061-0,879-0,003 1 NS NS NS NS * Magnesium -0,541-0,846-0,846-0,871 0,192-0,353 0,237-0,893-0,030 1 NS * * NS ph 0,005 0,015 0,015 0,254-0,116 0,157 0,144-0,376-0,025 0,105 1 NS NS NS Salinity -0,736-0,541-0,541-0,479 0,194-0,406 0,565-0,821-0,488 0,701 0,502 1 * NS Sulfate -0,453-0,522-0,522-0,525-0,111 0,481 0,016-0,600-0,129 0,720 0,242 0,756 1 NS -0,968-0,942-0,942 0,073 0,318-0,645 0,500 0,112-0,686 0,201-0,401 0,238 0,245 1 ph Alkalinity Ammonium Organic Calcium carbon Sulfate Inorganic carbon Calcium carbonate Ethane Magnesium Salinity Figure S6 Relationships between environmental parameters based on Pearson correlations (r). A network of correlations was built based on both positive and negative correlations.,,,, and were chosen as proxies for Ammonium, Sulfate, Magnesium, Salinity, Ethane, Calcium and Alkalinity.

Euryarchaeota_MBG-E Euryarchaeota_SAGMEG MBG-B MCG Unclassified_Cren. Thermococcales MBG-E SAGMEG Axis 1 (64.91%) Axis 2 (21.

13 Axis 2 (24.72 %) Unclassified Crenarchaeota 2H1 3H1 MBG-E MBGB 4H5 Thermococcales MCG SAGMEG 73x ARCHAEA 42x Crenarchaeota_MBG-B Crenarchaeota_MCG Unclassified_Crenarchaeota Euryarchaeota_Thermococcales Euryarchaeota_MBG-E Euryarchaeota_SAGMEG MBG-B MCG Unclassified_Cren. Thermococcales MBG-E SAGMEG Axis 1 (64.91%) Axis 2 (21.77 %) uncultured_eukaryota Streptophyta_Rosales Streptophyta_Poales Ascomycota_Mycocaliciales Stramenopiles_Ochromonadales Basidiomycota_Tremellales Stramenopiles_Bicosoecida 73x 42x Streptophyta_Malpighiales Streptophyta_Solanales Ascomycota_Sordariomycetes Ascomycota_Saccharomycetales 68x 34R Axis 1 (67.41%) 128R 87R EUKARYA 122R Basidiomycota_Malasseziales Basidiomycota_Wallemiales Basidiomycota_Filobasidiales Basidiomycota_Microbotryomycetes_incertae_sedis Ascomycota_Capnodiales Ascomycota_Chaetothyriales Streptophyta_Liliopsida_Poales Streptophyta_Eudicotyledons_Malpighiales Streptophyta_Eudicotyledons_Rosales Streptophyta_Eudicotyledons_Solanales uncultured_eukaryota Ascomycota_Dothideomycetes_Capnodiales Ascomycota_Eurotiomycetes_Chaetothyriales Ascomycota_Eurotiomycetes_Mycocaliciales Ascomycota_unclassified_Sordariomycetes Ascomycota_Saccharomycetes_Saccharomycetales Basidiomycota_Tremellomycetes_Tremellales Basidiomycota_Tremellomycetes_Filobasidiales Basidiomycota_Wallemiomycetes_Wallemiales Basidiomycota_Microbotryomycetes_incertae_sedis Basidiomycota_Exobasidiomycetes_Malasseziales Stramenopiles_Bicosoecida_Bicosoecida Stramenopiles_Chrysophyceae_Ochromonadales DA052 S035 Corynebacteriales OPB41 Caldilineales GIF3 GIF9 JG30_KF_CM66 MSB_5B2 MSBL5 Napoli_4B_65 Sh765B_AG_111 vadinba26 Bacillales Nitrospirales MSBL9 Caulobacterales Rhizobiales Sphingomonadales Burkholderiales Neisseriales Desulfarculales Desulfobacterales Myxococcales Pseudomonadales Xanthomonadales Kazan_3B_09 BHI80_139 OP9 ML635J_21 MLE1_12 Poales Malpighiales Rosales Solanales uncultured_euk. Capnodiales Chaetothyriales Mycocaliciales Sordariomycetes Saccharomycetales Tremellales Filobasidiales Wallemiales Microbo. _incertae_sedis Malasseziales Bicosoecida Ochromonadales Axis 2 (20.02 %) 4H5 42x 61x Actinobacteria_OPB41 2H1 3H1 Proteobacteria_Rhizobiales Chloroflexi_JG30-KF-CM66 Spirochaetes_Kazan-3B-09 BHI Chloroflexi_Napoli-4B-65 Proteobacteria_Desulfobacterales Chloroflexi_GIF3 Chloroflexi_Caldilineales _GIF9 Planctomycetes_MSBL9 _MSBL5 Candidate_division_OP9 _vadinba26 Nitrospirae_Nitrospirales Proteobacteria_Desulfarculales _MSB-5B2 Acidobacteria_S035 _Sh765B-AG-111 Firmicutes_ Bacillales 105R Proteobacteria_Caulobacterales Proteobacteria_ Xanthomonadales Axis 1 (66.97%) Proteobacteria_Burkholderiales 125R BACTERIA 148R Proteobacteria_Myxococcales Acidobacteria_DA052 Actinobacteria_Corynebacteriales Proteobacteria_Sphingomonadales Unclas. Bacteria_MLE1-12 Proteobacteria_Neisseriales Proteobacteria_Pseudomonadales Unclas. Bacteria_ML635J R 147R Acidobacteria_Acidobacteria_DA052 Acidobacteria_Acidobacteria_S035 Actinobacteria_Actinobacteria_Corynebacteriales Actinobacteria_OPB41 Chloroflexi_Caldilineae_Caldilineales Chloroflexi_GIF3 Chloroflexi_GIF9 Chloroflexi_JG30_KF_CM66 Chloroflexi_MSB_5B2 Chloroflexi_MSBL5 Chloroflexi_Napoli_4B_65 Chloroflexi_Sh765B_AG_111 Chloroflexi_vadinBA26 Firmicutes_Bacilli_Bacillales Nitrospirae_Nitrospira_Nitrospirales Planctomycetes_Phycisphaerae_MSBL9 Proteobacteria_Alphaproteobacteria_Caulobacterales Proteobacteria_Alphaproteobacteria_Rhizobiales Proteobacteria_Alphaproteobacteria_Sphingomonadales Proteobacteria_Betaproteobacteria_Burkholderiales Proteobacteria_Betaproteobacteria_Neisseriales Proteobacteria_Deltaproteobacteria_Desulfarculales Proteobacteria_Deltaproteobacteria_Desulfobacterales Proteobacteria_Deltaproteobacteria_Myxococcales Proteobacteria_Gammaproteobacteria_Pseudomonadales Proteobacteria_Gammaproteobacteria_Xanthomonadales Spirochaetes_Spirochaetes_Kazan_3B_09 BHI80_139 Candidate_division_OP9 Uncultured_Bacteria_ML635J_21 Uncultured_Bacteria_MLE1_ Figure S7 Relationships between order abundances of archaeal, eukaryotic and bacterial 16S/18S rrna genetag sequences and selected environmental parameters. (Left part) Principal Component Analyses(PCA) with sediment samples(black dots), microbial taxa(blue vectors) and environmental parameters (red vectors). (Right part) Correlation matrices of regularized canonical correlation analysis(rcca) with a color scale, indicating positive correlation values in red tones and negative correlation values in blue.

14 Figure S8 Culture flow-diagram. Legend: TCI, tissue culture insert; ASW, artificial seawater.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure