Evidence for a second genomic island conferring multidrug resistance in a clonal group of

Transcription

1 JCM Accepts, published online ahead of print on 1 April 0 J. Clin. Microbiol. doi:./jcm Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Evidence for a second genomic island conferring multidrug resistance in a clonal group of Salmonella Typhimurium and its monophasic variant circulating in Italy, Denmark and United Kingdom Claudia Lucarelli, 1* Anna Maria Dionisi, 1 Mia Torpdahl, Laura Villa, 1 Caterina Graziani, Katie Hopkins, John Threlfall, Alfredo Caprioli, Ida Luzzi 1 Affiliations: 1 Department of Infectious, Parasitic and Immuno-Mediated Diseases, Istituto Superiore di Sanità, Rome, Italy. Department of Bacteriology, Mycology and Parasitology, Statens Serum Institut, Copenhagen, Denmark. Department of Veterinary Public Health and Food Safety, Istituto Superiore di Sanità, Rome, Italy. Health Protection Agency, Gastrointestinal, Emerging and Zoonotic Infections, Centre for Infections, London NW EQ, United Kingdom. *Author for correspondance: Claudia Lucarelli Istituto Superiore di Sanità Viale Regina Elena, 0011 Roma Tel Fax claudia.lucarelli@iss.it Downloaded from on October 1, 01 by guest 1

2 Running title Multidrug-resistant clonal group in Salmonella Typhimurium Abstract During the 000 s a new clonal group with resistances to ampicillin, streptomycin, sulphonamides and tetracycline (ASSuT) emerged in Italy among strains of S. Typhimurium (STM) and its monophasic variant, Salmonella enterica subspecie enterica serovar,[],1:i:. The PulseNet Europe database, allowed us to identify ASSuT strains, both STM and its monophasic variant, isolated in Denmark and UK, with the same or very closely related pulsed-field gel electrophoresis (PFGE) patterns as the Italian strains, suggesting that the ASSuT clonal group is circulating in different European countries. With the aim to analyze the molecular basis of antibiotic resistance, resistance genes were identified and their localization investigated, in ASSuT strains, and, as controls, in strains, with different resistance patterns and PFGE profiles, both belonging to STM and its monophasic variant, isolated from humans in Italy, Denmark and UK. All the ASSuT strains were positive for the following resistance genes: bla TEM-1, stra-strb, sul and tet(b). Localization experiment demonstrated that the ASSuT resistance genes are chromosomally located. This study confirms that a multidrug resistant clonal group ASSuT of STM and its monophasic variant emerged and is circulating in Italy, Denmark and United Kingdom. Moreover, the results of this work demonstrates that the multidrug resistance in this clonal group of Salmonella is conferred by a new genomic island. Downloaded from on October 1, 01 by guest

3 Introduction Salmonella enterica serovar Typhimurium (STM) is one of the most important foodborne zoonotic pathogens over the world and the increasing occurrence and spread of multidrug resistant (MDR) strains is a matter of concern. MDR STM definitive phage-type (DT), resistant to ampicillin, chloramphenicol, streptomycin and spectinomycin, sulphonamides and tetracyclines (R-type ACSSpSuT) is a clear example of a clone that emerged in one country (UK in 10s) and subsequently became widely distributed in at least four continents (1). Recently strains of STM and its monophasic variant, Salmonella enterica serovar,[],1:i:-, characterised by the tetra-resistance pattern ASSuT (with or without additional resistances, but lacking resistance to chloramphenicol) has emerged in Italy (). These strains accounted for more than 0% of isolates from cases of human infection during the last years, and were also observed among isolates from different farm animal species (0). Pulsed-Field Gel Electrophoresis (PFGE) analysis showed that these tetra-resistant strains belonged to a unique clonal group, different from the DT ACSSpSuT clone (1). Using the PulseNet Europe database () it has been possible to verify that ASSuT strains of STM and its monophasic variant isolated in Denmark and UK exhibited the same or very closely related PFGE patterns as the Italian strains, suggesting that an ASSuT clonal group was circulating in different European countries. In Denmark, strains with the ASSuT R-type accounted for. % of STM strains from humans over the period 1-00 (1); during the period the frequency of ASSuT strains from humans increased, varying from to %. Moreover a study of strains from pigs highlighted that, from 00 to 00, the main phage type became DT, and 0% of strains of this phage type belonged to R-type ASSuT. Over the same period the frequency of isolation of DT strains decreased (1). In England and Wales, the ASSuT resistance pattern, with additional resistance to furazolidone (Fu), was first detected in 1 in STM DT. Such strains, which possessed resistance determinants on both conjugative and non-conjugative plasmids, caused substantive outbreaks in Downloaded from on October 1, 01 by guest

4 both cattle and humans until 11 (1). During the 10s there was an increase, from 1% in 11 to % in 10, of strains with ASSuT R-type, mainly belonging to DT1 (). Since 1, DT1 was second only to DT in cases of human infection; of these strains, % were multiresistant, with strains of R-type ASSuT predominating. Previous studies have shown that strains of DT1 of R-type ASSuT have often been associated with pigs and outbreaks associated with pigs have been reported (0). In addition in 00 strains DT R-type ASSuT, with a unique PFGE profile (STYMXB.00, according to PulseNet nomenclature) caused an outbreak in the northeast of England (). From January 00 to December 00, there were strains of R-type ASSuT, with or without additional resistances from a total of isolates from human infections (%) reported to the Health Protection Agency (HPA Salmonella dataset In DT strains of R-type ACSSuSpT the resistance genes for ampicillin (A; bla PSE-1 ), chloramphenicol (C; flor), streptomycin-spectinomycin (SSp; aada) sulphonamides (Su; sul1) and tetracyclines (T; tet(g)) are chromosomally-integrated within the -kb Salmonella Genomic island 1 (SGI-1) (). In contrast, the genes responsible for the tetra-resistance in the ASSuT clonal group have not been identified so far. The aim of this study was to analyze the molecular basis and location of the ASSuT tetra-resistance in STM and its monophasic variant strains from cases of human infection in Italy, Denmark and the UK over the period Downloaded from on October 1, 01 by guest

5 Materials and methods Bacterial strains A total of STM and its monophasic variant strains were included in this study. Of these, strains with R-type ASSuT showing a pattern relatedness,% each other when analysed by PFGE. Eleven strains, with different R-types, and showing PFGE profiles related ( strains) and unrelated ( strains) to ASSuT strains were included as control. A detailed description of the strains is reported in Figure 1. Strains were definitively assigned to serovar Typhimurium or its monophasic variant on the basis of the presence or absence of the fljb gene (1). Antimicrobial susceptibility testing was performed, for Italian and Danish strains, using the disk diffusion method, according to the CLSI recommendations (, ), and for UK strains by the method of Frost (1). The antimicrobials tested were those included in the Enternet reference panel (). PFGE was performed according to Pulsenet protocol () using XbaI as restriction enzyme. PCR amplification Standard PCR amplifications were performed with specific primers for the genes conferring resistance to ampicillin (bla SHV, bla OXA, bla TEM, bla PSE ), streptomycin (stra-strb, aada), sulphonamides (sul1, sul), tetracyclines (tet(a), tet(b), tet(c), and tet(g)), using conditions described in table 1. In addition the presence of class 1 integron gene cassettes was investigated using specific primers for the and conserved segment. PCR amplicons of the bla TEM gene were fully sequenced in order to assess which subtype of the TEM gene was harboured. Transfer experiment Conjugation experiments were performed using as recipient strain, Escherichia coli CSHNa R, as described by Maimone et al. () with few modifications. Overnight cultures of the donor and Downloaded from on October 1, 01 by guest

6 recipient strains were mixed in Nutrient Broth at a ratio of 1: and incubated overnight at three temperatures: C, C and C. Trasconjugants were selected on Luria-Bertani (LB) agar plates containing nalidixic acid (0 µg/ml) together with tetracycline ( µg/ml) or ampicillin ( µg/ml). Plasmid DNA was prepared with a PureLink HiPure Plasmid Filter Purification Kit (Invitrogen, Milan, Italy). Transformation experiments were performed using MAX Efficiency DHα competent cells (Invitrogen, Milan, Italy) and transformants selected on LB-agar plates containing ampicillin (0 µg/ml) or tetracycline ( µg/ml) (). PFGE with I-Ceu I and preparation of total DNA PFGE with I-Ceu I enzyme, was performed according to the PulseNet protocol (), with few modifications. Briefly, cell density for plug preparation was at 00 nm, final concentration of proteinase K in the plug was 1 mg/ml, and 1 additional wash each in H O and in TE buffer. The plugs were digested with 0.0 U of I-Ceu I enzyme (New England, Biolabs, Ipswich, MA) for h at C as described by Liu et al. (). DNA fragments were separated on a 0.% agarose gel and Lambda ladder concatamers (New England, Biolabs, Ipswich, MA) were used as a molecular marker. The preparation of total DNAs was performed using Wizard Genomic DNA Purification Kit (Promega, Milan, Italy). Total DNAs were digested with KpnI enzyme and electrophoresed in a 0.% agarose gel, at 1 V for 1 hours. Southern Blot Hybridization Restriction fragments, obtained by PFGE with I-CeuI and total DNA digestion with KpnI, were transferred onto positively-charged nylon membranes (Roche Diagnostics, Monza, Italy) by standard methods () and hybridized with PCR-generated probes labelled with digoxigenin, for Downloaded from on October 1, 01 by guest

7 specific resistance genes, integrase gene and for ribosomal DNA (table 1), under high-stringency conditions, at C without formammide, according to the manufacturer s procedure (DIG DNA Labeling and Detection kit, Roche Diagnostics, Monza, Italy). Downloaded from on October 1, 01 by guest

8 RESULTS Genetic characterization of the ASSuT resistance-profile The investigation by PCR of the antimicrobial resistance genes showed that all ASSuT strains, were positive for bla TEM-1, stra-strb, sul and tet(b) and negative for all the other genes tested and for class 1 integron(s) (Table ). All strains of R-type ASSu harboured bla TEM-1, stra-strb, sul genes and two strains of R-type SSuT, were positive for stra-strb, sul and tet(b). The strains not-assut but positive for tet(b) showed PFGE profiles related to ASSuT strains. In particular strains with R-types SSuT and tetracycline resistant strains exhibited the PFGE profile STYMXB.00; one tetracycline resistant strain showed the PFGE profile STYMXB.0, a related profile observed only in some Danish ASSuT strains. PFGE profiles STYMXB.00 and the related STYMXB.00 were also showed by three strains of R-type ASSu, which showed the same resistance genes profile of the ASSuT strains, with the exception of tet(b) (Table ). Tetracycline resistance genes different from tet(b), were found in strains with SSuT and T resistance patterns (tet(a)), and in one tetracycline-resistant strain (tet(c)). Localization of resistance genes Conjugation and transformation experiments were performed on representative strains of R-type ASSuT, belonging to different PFGE profiles, STYMXB.00 and STYMXB.0. The experiments failed to transfer any genes encoding antimicrobial resistance from donor to recipient strain, suggesting inability of horizontal transfer and a chromosomal localization of the resistance genes. Chromosomal localization of resistance genes was investigated by PFGE using the I-Ceu I restriction enzyme on a selection of 1 strains, including 1 strains from Italy, 1 from Denmark and from UK. The strains were representative of each PFGE profile and all harbouring tet(b) gene. The danish strains of R-type ASSu were included as well. Downloaded from on October 1, 01 by guest

9 Chromosomal digestion yielded seven PFGE fragments with sizes ranging from 0 to more than,000 kb. Southern blot hybridization was performed with specific probes for bla TEM-1, stra-strb, sul, tet(b), 1S r-dna and integrase of class 1 integron (inti). All the probes bound to a fragment of approximately 0 kb fragment as did the ribosomal probe, thus demonstrating the chromosomal location of the resistance determinants (Figure ). Conversely, all the strains were negative for the presence of inti (data not shown). A southern blot experiment of total DNA, digested with KpnI, was performed on strains with a PFGE pattern similarity.% ( ASSuT strains, 1 SSuT, ASSu, and T). Hybridization with specific probes for the four resistance genes showed that all the genes co-localized on a fragment of about 0 kb (Figure ) on ASSuT strains, independently from their PFGE profile. An exception was represented by a strain with PFGE profile STYMXB.0, for which the resistance genes are localized in a fragment slightly smaller. A similar finding has been showed by a strain SSuT STYMXB.00 and a strain ASSu, with PFGE profile STYMXB.00. In addition in one strain ASSu STYMXB.00 and in two strains resistant only to tetracycline, with PFGE profile STYMXB.00 and STYMXB.0, the resistance genes are localized on a Kpn-I fragment of approximately 0 kb (Figure ). Downloaded from on October 1, 01 by guest

10 DISCUSSION Resistance to antimicrobials in Salmonella is regarded as an important threat to public health. Results from a European collaborative study showed that % of strains were resistant to at least one antimicrobial and 1% were multiresistant (). Among different serovars, STM consistently exhibited the highest percentage of strains with multiple resistance, belonging mainly to the ACSSpSuT DT clone (1). The dissemination of this multiresistant clone is still a matter of concern, despite a marked reduction of its frequency in Europe since 00 (). In Italy, from 000, strains with R-type ASSuT became increasingly common, both in STM and its monophasic variant strains (1, 0). In addition, an increase in the frequency of these strains has been observed, both in Denmark and United Kingdom. Until recently, comparison of strains from different countries has been difficult, mainly because of the lack of standardization in typing methodology. Standardization of PFGE coupled with the establishment of a central database and a common nomenclature system, facilitated by the international network PulseNet Europe, has made easier the identification of clones circulating within and between countries. In this study, the PulseNet database assisted in ascertaining that strains of R-type ASSuT isolated in Denmark and UK exhibited the same PFGE profiles of Italian strains (1), with the unique exception of STYMXB.0 a PFGE profile showed only by Danish monophasic variant strains, but which has an, % homology with the other PFGE profiles. The aim of this study was to analyze the molecular basis of antibiotic resistance in strains of R-type ASSuT, both STM and its monophasic variant, isolated from humans in Italy, Denmark and UK. All the ASSuT strains, regardeless their origin, harboured the same resistance genes: bla TEM-1, strastrb, sul and tet(b). These resistance genes are common in Salmonella spp. and the association of these genes has been frequently described. In particular stra-strb are usually associated with sul. Both genes are frequently located on small broad-host-range plasmids such as RSF or ppb1, but have also been detected on the chromosome of a STM isolate (1). Moreover a similar association of the four resistance genes in ASSuT strains has been observed in various plasmids, for Downloaded from on October 1, 01 by guest

11 example phcm1, typical of S. Typhi (0), and pu0l, found in a STM isolate (). In relation to tetracycline resistance, in all ASSuT strains the only gene coding the resistance to tetracycline was tet(b). This gene has previously been identified in STM strains at a frequency of %, but always in combination with tet(a), tet(g), or both (1). In addition tet(b) was the unique gene encoding tetracycline resistance also in strains showing an R-type different from ASSuT but with PFGE profile related to the main profile STYMXB.00. The localization experiments on ASSuT strains demonstrated that the resistance genes were localized on the bacterial chromosome, in particular on a KpnI fragment of approximately 0 kb. Just in the Danish strains with a PFGE profile STYMXB.0, the resistance genes are localized on a fragment with a slightly smaller size, probably due to deletion(s) not affecting resistances genes. Overall these findings are indicative of the existence of a new resistance island, different from SGI- 1 of the ACSSpSuT DT clone, not only in terms of resistance gene content but also for the absence of class 1 integrons. In this respect SGI-1 possesses two class 1 integrons, located in the chromosome and carrying the aada, bla PSE-1 and sul1 genes, conferring resistance to streptomycin, β-lactams and sulphonamides, in addition to the flor and tet(g) genes, conferring resistance to chloramphenicol and tetracyclines, respectively (). The chromosomal localization of resistance genes was also demonstrated in strains with R-types different from ASSuT, but with related PFGE profiles. However, in strains with R-types SSuT, ASSu and only resistant to tetracycline, the genes are localized on a KpnI fragment smaller than the fragment detected in ASSuT strains. It is conceivable that, rearrangements or deletions of the resistance island may be occurred, thereby generating partial resistance patterns. A similar finding has been described in DT strains showing a partial R-types but the same PFGE profile of ACSSpSuT strains, and in which deleted SGI1 was observed (,,,, ). Despite STM ASSuT strains having been described in the US (1, ), Spain (), France () and the Czech Republic (), to our knowledge no molecular analyses have been undertaken in relation to the resistance genes or their genetic background. However, a partial characterization performed Downloaded from on October 1, 01 by guest

12 on French ASSuT strains, concerning the presence of integrons and β lactam resistance genes, demonstrated that these strains were negative for class 1 integrons and harboured the bla TEM-1 gene (). Similarly, in the Czech Republic, strains of STM ASSuT were negative for the presence of SGI-1 and class 1 integron (). Although not conclusive, the result of these studies are in agreement with our results and seems to suggest that the strains of R-type ASSuT from the respective countries may belong to the same clonal group as described above, suggesting its wide dissemination within Europe. Finally, this study provides additional support of belonging to the same clonal group of STM strains and of its monophasic variant with R-type ASSuT. The monophasic variant strains studied exhibited the same chromosomally-located resistance genes as the ASSuT STM strains. In contrast, Spanish monophasic variant strains of R-type ACSSuT and with additional resistance to gentamicin and trimethoprim, exhibited DT-related PFGE profiles, but differed from the DT clone in terms of resistance gene profile and localization (1, ). In conclusion, this study demonstrates the existence of a second genomic island carrying antibiotic resistance genes distinct from those previously detected in SGI1. This new genomic island confers resistance to ampicillin, streptomycin, sulphonamides and tetracyclines in a clonal group of STM and monophasic variant circulating in Italy, Denmark and United Kingdom. Further studies are needed to complete the characterization of this new resistance island and to better understand its organization. Downloaded from on October 1, 01 by guest 1

13 Acknowledgments This study was partially funded by the European Community Network of Excellence Med-Vet-Net Workpackages 1 (contract no. FOOD-CT-00-01). Downloaded from on October 1, 01 by guest 1

14 References Arlet, G., M. Rouveau, and A. Philippon. 1. Substitution of alanine for aspartate at position 1 in the SHV- extended-spectrum beta-lactamase. FEMS Microbiol Lett 1:1-.. Baggesen, D. L., D. Sandvang, and F. M. Aarestrup Characterization of Salmonella enterica serovar typhimurium DT isolated from Denmark and comparison with isolates from Europe and the United States. J Clin Microbiol :11-.. Best, E. L., M. D. Hampton, S. Ethelberg, E. Liebana, F. A. Clifton-Hadley, and E. J. Threlfall. 00. Drug-Resistant Salmonella Typhimurium DT : Use of PFGE and MLVA in a Putative International Outbreak Investigation. Microb Drug Resist.. Briggs, C. E., and P. M. Fratamico. 1. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT. Antimicrob Agents Chemother :-.. Busani, L., C. Graziani, A. Battisti, A. Franco, A. Ricci, D. Vio, E. Digiannatale, F. Paterlini, M. D'Incau, S. Owczarek, A. Caprioli, and I. Luzzi. 00. Antibiotic resistance in Salmonella enterica serotypes Typhimurium, Enteritidis and Infantis from human infections, foodstuffs and farm animals in Italy. Epidemiol Infect 1:-1.. Carattoli, A., E. Filetici, L. Villa, A. M. Dionisi, A. Ricci, and I. Luzzi. 00. Antibiotic resistance genes and Salmonella genomic island 1 in Salmonella enterica serovar Downloaded from on October 1, 01 by guest Typhimurium isolated in Italy. Antimicrob Agents Chemother :1-. 1

15 Casin, I., J. Breuil, A. Brisabois, F. Moury, F. Grimont, and E. Collatz. 1. Multidrug-resistant human and animal Salmonella typhimurium isolates in France belong predominantly to a DT clone with the chromosome- and integron-encoded betalactamase PSE-1. J Infect Dis 1:-.. Chen, C. Y., G. W. Nace, B. Solow, and P. Fratamico. 00. Complete nucleotide sequences of.- and.-kb plasmids in the multi-antibiotic resistant Salmonella enterica serovar Typhimurium U0 strain G0. Plasmid :-.. Clinical and Laboratory Standards. 00. Institute Performance Standards for Antimicrobial Performance Standard for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Approved Standard. CLSI/NCCLS document M1-A. Clinical and Laboratory Standards Institute,Wayne, PA.. Clinical and Laboratory Standards. 00. Institute Performance Standards for Antimicrobial Susceptibility Testing; Sixteenth Informational Supplement. CLSI/NCCLS document M0-S1. Clinical and Laboratory Standards Institute, Wayne, PA.. Coque, T. M., A. Oliver, J. C. Perez-Diaz, F. Baquero, and R. Canton. 00. Genes encoding TEM-, SHV-, and CTX-M- extended-spectrum beta-lactamases are carried by multiple Klebsiella pneumoniae clones in a single hospital (Madrid, 1 to 000). Antimicrob Agents Chemother :00-. Downloaded from on October 1, 01 by guest 1

16 1. Daly, M., L. Villa, C. Pezzella, S. Fanning, and A. Carattoli. 00. Comparison of multidrug resistance gene regions between two geographically unrelated Salmonella serotypes. J Antimicrob Chemother : Dionisi, A. M., C. Graziani, C. Lucarelli, E. Filetici, L. Villa, S. Owczarek, A. Caprioli, and I. Luzzi. 00. Molecular characterization of multidrug-resistant strains of Salmonella enterica serotype Typhimurium and Monophasic variant (S.,[],1:i:-) isolated from human infections in Italy. Foodborne Pathog Dis :-. 1. Echeita, M. A., S. Herrera, J. Garaizar, and M. A. Usera. 00. Multiplex PCR-based detection and identification of the most common Salmonella second-phase flagellar antigens. Res Microbiol 1: Emborg, H. D., D. L. Baggesen, and F. M. Aarestrup. 00. Ten years of antimicrobial susceptibility testing of Salmonella from Danish pig farms. J Antimicrob Chemother : Ethelberg, S., M. Lisby, M. Torpdahl, G. Sorensen, J. Neimann, P. Rasmussen, S. Bang, U. Stamer, H. B. Hansson, K. Nygard, D. L. Baggesen, E. M. Nielsen, K. Molbak, and M. Helms. 00. Prolonged restaurant-associated outbreak of multidrug-resistant Salmonella Typhimurium among patients from several European countries. Clin Microbiol Infect : Frech, G., and S. Schwarz Molecular analysis of tetracycline resistance in Salmonella enterica subsp. enterica serovars Typhimurium, enteritidis, Dublin, Downloaded from on October 1, 01 by guest 1

17 Choleraesuis, Hadar and Saintpaul: construction and application of specific gene probes. J Appl Microbiol : Frost, J.A. 1. Testing for resistance to antibacterial drugs. p-. In H.Chart (ed.), Methods in Practical Laboratory Bacteriology. CRC Press, New York. 1. Gebreyes, W. A., and C. Altier. 00. Molecular characterization of multidrug-resistant Salmonella enterica subsp. enterica serovar Typhimurium isolates from swine. J Clin Microbiol 0: Graziani, C., L. Busani, A. M. Dionisi, C. Lucarelli, S. Owczarek, A. Ricci, M. Mancin, A. Caprioli, and I. Luzzi. 00. Antimicrobial resistance in Salmonella enterica serovar Typhimurium from human and animal sources in Italy. Vet Microbiol 1: Guerra, B., I. Laconcha, S. M. Soto, M. A. Gonzalez-Hevia, and M. C. Mendoza Molecular characterisation of emergent multiresistant Salmonella enterica serotype [,,1:i:-] organisms causing human salmonellosis. FEMS Microbiol Lett 10:1-.. Guerra, B., S. M. Soto, J. M. Arguelles, and M. C. Mendoza Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [,,1:i:-]. Antimicrob Agents Chemother :-.. Guerra, B., E. Junker, A. Miko, R. Helmuth, and M. C. Mendoza. 00. Characterization and localization of drug resistance determinants in multidrug-resistant, integron-carrying Salmonella enterica serotype Typhimurium strains. Microb Drug Resist Downloaded from on October 1, 01 by guest :-1. 1

18 Havlickova, H., H. Hradecka, I. Bernardyova, and I. Rychlik. 00. Distribution of integrons and SGI1 among antibiotic-resistant Salmonella enterica isolates of animal origin. Vet Microbiol 1:1-.. Heir, E., B. A. Lindstedt, I. Nygard, T. Vardund, V. Hasseltvedt, and G. Kapperud. 00. Molecular epidemiology of Salmonella typhimurium isolates from human sporadic and outbreak cases. Epidemiol Infect 1:-.. Liu, S. L., A. Hessel, and K. E. Sanderson. 1. Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc Natl Acad Sci U S A 0:-.. Lukinmaa, S., U. M. Nakari, A. Liimatainen, and A. Siitonen. 00. Genomic diversity within phage types of Salmonella enterica ssp. enterica serotypes Enteritidis and Typhimurium. Foodborne Pathog Dis :-.. Maimone, F., B. Colonna, P. Bazzicalupo, B. Oliva, M. Nicoletti, and M. Casalino. 1. Plasmids and transposable elements in Salmonella wien. J Bacteriol 1:-.. Meakins, S., I. S. Fisher, C. Berghold, P. Gerner-Smidt, H. Tschape, M. Cormican, I. Luzzi, F. Schneider, W. Wannett, J. Coia, A. Echeita, and E. J. Threlfall. 00. Antimicrobial drug resistance in human nontyphoidal Salmonella isolates in Europe : a report from the Enter-net International Surveillance Network. Microb Drug Resist 1:1-. 1 Downloaded from on October 1, 01 by guest

19 Parkhill, J., G. Dougan, K. D. James, N. R. Thomson, D. Pickard, J. Wain, C. Churcher, K. L. Mungall, S. D. Bentley, M. T. Holden, M. Sebaihia, S. Baker, D. Basham, K. Brooks, T. Chillingworth, P. Connerton, A. Cronin, P. Davis, R. M. Davies, L. Dowd, N. White, J. Farrar, T. Feltwell, N. Hamlin, A. Haque, T. T. Hien, S. Holroyd, K. Jagels, A. Krogh, T. S. Larsen, S. Leather, S. Moule, P. O'Gaora, C. Parry, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT1. Nature 1:-. 1. Pasquali, F., A. De Cesare, A. Ricci, C. Kehrenberg, S. Schwarz, and G. Manfreda. 00. Phage types, ribotypes and tetracycline resistance genes of Salmonella enterica subsp. enterica serovar Typhimurium strains isolated from different origins in Italy. Vet Microbiol :1-.. Peters, T. M., C. Maguire, E. J. Threlfall, I. S. Fisher, N. Gill, and A. J. Gatto. 00. The Salm-gene project - a European collaboration for DNA fingerprinting for. Euro Surveill :-0.. Poppe, C., K. Ziebell, L. Martin, and K. Allen. 00. Diversity in antimicrobial resistance and other characteristics among Salmonella typhimurium DT isolates. Microb Drug Resist :-.. Rabatsky-Ehr, T., J. Whichard, S. Rossiter, B. Holland, K. Stamey, M. Headrick, T. Barrett, F. Angulo, and NARMS Working Group. 00. Multidrug-resistant strains of Salmonella enterica Typhimurium, United States, 1-1. Emerg Infect Dis : Downloaded from on October 1, 01 by guest

20 Randall, L. P., S. W. Cooles, M. K. Osborn, L. J. Piddock, and M. J. Woodward. 00. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemother :0-1.. Sambrook, J.E., and D.W. Russel Molecular Cloning: a laboratory manual. Cold Spring Harbour Laboratory Press. rd edition.. Soler, P., R. Gonzalez-Sanz, M. J. Bleda, G. Hernandez, A. Echeita, and M. A. Usera. 00. Antimicrobial resistance in non-typhoidal Salmonella from human sources, Spain, J Antimicrob Chemother :-.. Southern, E. M. 1. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol :0-1.. Threlfall, E. J., B. Rowe, and L. R. Ward. 1. A comparison of multiple drug resistance in salmonellas from humans and food animals in England and Wales, 11 and 10. Epidemiol Infect 1: Threlfall, E. J., L. R. Ward, J. A. Skinner, and A. Graham Antimicrobial drug resistance in non-typhoidal salmonellas from humans in England and Wales in 1: decrease in multiple resistance in Salmonella enterica serotypes Typhimurium, Virchow, and Hadar. Microb Drug Resist : Threlfall, E. J. 00. Antimicrobial drug resistance in Salmonella: problems and Downloaded from on October 1, 01 by guest perspectives in food- and water-borne infections. FEMS Microbiol Rev :-. 0

21 1. Threlfall, E. J., I. S. Fisher, C. Berghold, P. Gerner-Smidt, H. Tschape, M. Cormican, I. Luzzi, F. Schnieder, W. Wannet, J. Machado, and G. Edwards. 00. Antimicrobial drug resistance in isolates of Salmonella enterica from cases of salmonellosis in humans in Europe in 000: results of international multi-centre surveillance. Euro Surveill :1-.. Weill, F. X., F. Guesnier, V. Guibert, M. Timinouni, M. Demartin, L. Polomack, and P. A. Grimont. 00. Multidrug resistance in Salmonella enterica serotype Typhimurium from humans in France (1 to 00). J Clin Microbiol :00-.. Ziemer, C. J., and S. R. Steadham. 00. Evaluation of the specificity of Salmonella PCR primers using various intestinal bacterial species. Lett Appl Microbiol :-.-. Downloaded from on October 1, 01 by guest 1

22 Figure 1. Dendrogram showing the pattern relatedness among the Salmonella Typhimurium (STM) and its monophasic variant strains included in this study. Dendrogram was generated by BioNumerics software. Similarity analysis was performed using the Dice coefficient (Opt: 1.00%-Tol: 1.00%), and clustering was by UPGMA. Footnote Figure 1 PFGE, pulsed-field gel electrophoresis; IT, Italy; UK, United Kingdom; DEN, Denmark; Antibiogram designations: A, ampicillin; S, streptomycin; Su, sulphonamides; T, tetracycline. Table 1: Primers used in PCR amplification Footnote Table 1: a= primers used together with primer TetBF and TemA, respectively, only to produces probes Table : Antimicrobial resistance genes identified among Salmonella Typhimurium and its monophasic variant strains. Footnote Table : a: 1 of these strains belong to monophasic variant b: of these strains belong to monophasic variant c: of these strains belong to monophasic variant d: all the strains belong to monophasic variant e: 1 of these strains belong to monophasic variant f: 1 of these strains belong to monophasic variant g: strain belong to monophasic variant Downloaded from on October 1, 01 by guest

23 Figure : (A) Pulsed field gel electrophoresis with I-CeuI on a subset of strains with the following features. Lane 1, ASSuT STYMXB.00; Lane, ASSuT STYMXB.0; Lane, ASSuT STYMXB.00; Lane, ASSuT STYMXB.00; Lane, ASSuT STYMXB.0; Lane, ASSu STYMXB.00; Lane, ASSu STYMXB.00; Lane, T STYMXB.00; Lane, T STYMXB.0; Lane, ASSuT STYMXB.00; Lane, SSuT STYMXB.00. Molecular weight marker (Lambda ladder concatamers) is in lane M. (B to F) Southern blot hybridization was performed with tet(b), stra-strb, sul, bla TEM and r- DNA1S probes. Figure : Total DNA digestion with KpnI enzyme on strains with the following features: Lane 1, ASSuT STYMXB.00; Lane, ASSuT STYMXB.00; Lane, ASSuT STYMXB.0; Lane, ASSuT STYMXB.00; Lane, ASSuT STYMXB.00 Lane, ASSuT STYMXB.0; Lane, SSuT STYMXB.00; Lane, ASSu STYMXB.00; Lane, ASSu STYMXB.00; Lane, T STYMXB.00; Lane, T STYMXB.0. M 1 : 1 kb Plus DNA ladder, M : 1 kb DNA extension Ladder (Invitrogen, Milan, Italy). (B to E) Southern blot hybridization was performed with bla TEM,, stra-strb, sul, and tet(b)probes. Downloaded from on October 1, 01 by guest

24 Table 1. Target gene(s) Name DNA sequence ( to ) Tm Expected amplicon Genebank Accession. No. Reference bla SHV OS TTATCTCCCTGTTAGCCACC OS GATTTGCTGATTTCGCTCGG 0 C bp GQ1 1 bla OXA OO-1 ACCAGATTCAACTTTCAA OO- TCTTGGCTTTTATGCTTG C bp GQ0 bla TEM TemA ATAAAATTCTTGAAGAC TemB TTACCAATGCTTAATCA 0 C bp AY bla PSE pse1-f CGCTTCCCGTTAACAAGTAC pse1-r CTGGTTCATTTCAGATAGCG 0 C 1 bp M0 stra-strb SAF AGCAGAGCGCGCCTTCGCTG SBR CCAAAGCCCACTTCACCGAC C 0 bp NC_ aada aadaf aadar TGTTGGTTACTGTGGCCGTA GATCTCGCCTTTCACAAAGC 0 C bp AF01 sul1 sul1b GCAAGGCGGAAACCCGCGCC sul1f CTTCGATGAGAGCCGGCGGC C bp X1 sul sulr GATGAAGTCAGCTCCACCT sulf TCAACATAACCTCGGACAGT 0 C 0 bp M tet(a) TetAR CTGCCTGGACAACATTGCTT TetAF GTAATTCTGAGCACTGTCGC 0 C bp X1 1 tet(b) TetBF ACGTTACTCGATGCCAT TetBR AGCACTTGTCTCCTGTT 0 C bp AM1 1 tet(c) TetCF AACAATGCGCTCATCGT TetCR GGAGGCAGACAAGGTAT C bp Y1 1 tet(g) TetGF CCGGTCTTATGGGTGCTCTA TetGR CCAGAAGAACGAAGCCAGTC C 0 bp F01 Integron variable region CS GGCATCCAAGCAGCAAG CS AAGCAGACTTGACCTGA C variable M1 1 Integrase Int1F GCCTTGCTGTTCTTCTAC Int1B GATGCCTGCTTGTTCTAC C bp X10 1S rdna gene 1SF TGTTGTGGTTAATAACCGCA 1SR CACAAATCCATCTCTGGA C 1 bp EU00 tet (B) a TetB CCAGTAGCTCCTGTGAT 0 C bp AM1 This study a bla TEM temc AGCATCTTTTACTTTCA C 00 bp AY This study Downloaded from on October 1, 01 by guest

25 Table : N of strains R-type PFGE-type tet(a) tet(b) tet(c) strastrb sul tem -1 a ASSuT STYMXB b ASSuT STYMXB c ASSuT STYMXB ASSuT STYMXB ASSuT STYMXB d ASSuT STYMXB e SSuT STYMXB f ASSu STYMXB ASSu STYMXB T STYMXB g T STYMXB T STYMXB T STYMXB SSuT STYMXB Downloaded from on October 1, 01 by guest

26 Figure 1. (%) pattern relatedness PFGE profile STYMXB.00 STYMXB.0 STYMXB.0 STYMXB.00 STYMXB.00 STYMXB.0 STYMXB.00 STYMXB.00 STYMXB.0 No. of strains from IT UK DEN STM Monophasic variant R-type (No. of strains) T (1) T (1) SSuT (1) ASSuT () ASSuT (1), ASSu (1) ASSuT (), T (1) ASSuT (), SSuT (), T (), ASSu () ASSuT () ASSuT () Downloaded from on October 1, 01 by guest

27 Figure. A M 1 B 1 C 1 kb D 1 tet(b) E 1 stra-strb F 1 Downloaded from sul bla TEM r-dna 1S on October 1, 01 by guest

28 Figure. M 1 1 M 0 kb kb 1 kb B) bla TEM D) sul 1 1 A) C) stra-strb E) tet(b) Downloaded from on October 1, 01 by guest