Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan

Transcription

1 Journal of Applied Microbiology ISSN ORIGINAL ARTICLE Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan A.M. Ahmed 1,2, Y. Ishida 1 and T. Shimamoto 1 1 Laboratory of Food Microbiology and Hygiene, Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima, Japan 2 Department of Bacteriology, Faculty of Veterinary Medicine, Kafr El-Sheikh University, Kafr El-Sheikh, Egypt Keywords animals, b-lactamase, integron, multidrug resistance, qnr, Salmonella. Correspondence Tadashi Shimamoto, Laboratory of Food Microbiology and Hygiene, Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima , Japan. tadashis@hiroshima-u.ac.jp : received 05 March 2008, revised 12 June 2008 and accepted 24 June 2008 doi: /j x Abstract Aims: To investigate the prevalence of integrons and antimicrobial resistance genes in Salmonella recovered from animals in Japan. Methods and Results: Forty-eight out of ninety-four (51Æ1%) Salmonella isolates showed multidrug resistance phenotypes and harboured at least one antimicrobial resistance gene. Twenty-two out of forty-seven (46Æ8%) Salmonella enterica serovar Typhimurium that were multidrug-resistant were of definitive phage type DT104. Class 1 integrons were identified in isolates (36Æ2%): 21 isolates containing two gene cassettes, aada2 and bla PSE 1, and 13 containing one gene cassette, aada1, aada2 or bla PSE 1. Class 2 integrons containing estx-sat2-aada1 gene cassettes were only identified in Salmonella Enteritidis. The b-lactamase-encoding gene, bla TEM, was only detected in S. Typhimurium. The plasmid-mediated quinolone resistance gene, qnrs1, was identified in S. Typhimurium and Salmonella Thompson. Conclusions: Our results characterized integrons and antimicrobial resistance genes in Salmonella of animal origin. To the best of our knowledge, this is the first report of qnrs in Salmonella from Japan and also the first report of qnrs in S. Thompson. Significance and Impact of the Study: Little is known about the molecular basis of antimicrobial resistance in Salmonella isolated from animals. This study provides useful data on the incidence of integrons and resistance genes in Salmonella of animal origin. Introduction Resistance to antimicrobial agents within nontyphoidal Salmonella serotypes is considered a serious problem worldwide. Surveillance data demonstrates an obvious increase in overall antimicrobial resistance among salmonellae from 20% to 30% in the early 1990s to as high as 70% in some countries in the 2000s (Su et al. 2004). In the United States, epidemiologic investigations demonstrate that the use of antimicrobial agents in livestock production is the principal cause of the emergence and dissemination of resistance to antimicrobial agents in strains of nontyphoidal Salmonella (Van den Bogaard and Stobberingh 1999). Salmonella is an important cause of food-borne gastroenteritis in humans, and diarrhoea and sometimes septicaemia in animals. One of the most common strains isolated from both animals and humans is multidrug-resistant Salmonella Typhimurium of definitive phage type 104 (DT104). Most of the DT104 isolates have a multidrug resistance phenotype with resistance to ampicillin (AMP), chloramphenicol (CHL), streptomycin (STR), sulfonamides (S) and tetracycline (TET) (R-type ACSSuT; Threlfall et al. 1994). Within only a few years, this Salmonella type has emerged as one of the most common causes of human salmonellosis in several countries (Threlfall et al. 1994; Glynn et al. 1998; Izumiya et al. 1999). Food animals, such as cattle, swine and poultry, and the food supply, including meat and meat products, are reservoirs for food-borne pathogens (Swartz 2002). Of particular concern is the potential transmission of multidrug-resistant food-borne pathogens to humans via the food supply. Antibiotics of similar structure are being used in both 402 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

2 A.M. Ahmed et al. Integrons and resistance genes in Salmonella medical and veterinary practice. The link between the use of antimicrobial drugs for food animals and the emergence of antimicrobial drug resistance in human pathogenic bacteria has been well demonstrated (Linton 1986; Phillips et al. 2004). It is therefore important to monitor resistance among bacteria from animals and food, because these bacteria, or their mobile elements carrying resistance genes such as transposons, plasmids, etc., are able to spread from food products directly to humans. To date, many researchers have focused on the antimicrobial resistance phenotypes among Salmonella serovars of animal origin (Esaki et al. 2004a,b; Asai et al. 2006; Shahada et al. 2006, 2007; Zhao et al. 2007). However, little has been published on the molecular basis of this resistance. Therefore, our aims were to: (i) investigate the prevalence and characterization of class 1 and 2 integrons among nontyphoidal Salmonella serovars from different animals in the Hiroshima prefecture, Japan, and (ii) further investigate the incidence of multidrug-resistant S. Typhimurium DT104 strains. Materials and methods Salmonella isolates A total of 94 identified Salmonella isolates were obtained from Hiroshima Prefectural Higashi-Hiroshima Livestock Hygiene Service Center. These isolates represented all nonrepetitive isolates collected from healthy and diseased animals between 2002 and In general, six samples per animal species were collected from different farms in Hiroshima prefecture. Fresh faecal samples were inoculated into Hajna tetrathionate broth for enrichment at a ratio of 1 g faeces to 10 ml of broth. After incubation at 42 C for 18 h or an additional 5 7 days at room temperature as secondary enrichment, the broth was inoculated onto desoxycholate hydrogen sulfide lactose and brilliant green agar plates, each supplemented with 20 mg l )1 of novobiocin sodium, and incubated at 37 C for 18 h. Suspect colonies were isolated and grown on nutrient agar (Oxoid, Cambridge, UK), and then identified by transfer to tubes with triple sugar iron agar, lysin indole motility semisolid agar, Voges Proskauer semisolid media, urease test broth and Simmons citrate agar. Salmonella isolates were serotyped by the method based on slide agglutination for O and H antigens according to the last version of the Kauffmann White scheme. The animal sources and most common serovars for Salmonella isolates are summarized in Table 1. Antimicrobial susceptibility testing The antimicrobial susceptibility phenotypes of the recovered Salmonella isolates were determined using a Kirby Table 1 Source and serovars of Salmonella isolates used in this study Serovar Beef Dairy Pig Poultry Total Typhimurium Infantis Thompson 7 7 Agona 5 5 Enteritidis 5 5 Montevideo Oranienburg O Other serovars (including untypable) Total Bauer disc diffusion assay according to the standards and interpretive criteria described by the Clinical and Laboratory Standards Institute (CLSI 2003a,b). The following antibiotics were used: AMP, 10 lg; amoxicillin-clavulanic acid (AMC), 20 (10 lg) )1 ; oxacillin (OXA), 10 lg; cefoxitin (FOX), 30 lg; cefotetan (CTT), 30 lg; cefoperazone (CFP), 30 lg; cefotaxime (CTX), 30 lg; ceftazidime (CAZ), 30 lg; cefpodoxime (CPD), 10 lg; ceftriaxone (CRO), 30 lg; aztreonam (ATM), 30 lg; nalidixic acid (NAL), 30 lg; ciprofloxacin (CIP), 5 lg; norfloxacin (NOR), 10 lg; CHL, 30 lg; gentamicin (GEN), 10 lg; kanamycin (KAN), 30 lg; STR, 10 lg; spectinomycin (SPX), 30 lg; TET, 30 lg and sulfamethoxazole trimethoprim (SXT), 23Æ75 1Æ25 lg. Bacterial DNA preparation, polymerase chain reaction (PCR) and DNA sequencing of class 1 and 2 integrons An overnight bacterial culture (200 ll) was mixed with 800 ll of distilled water and boiled for 10 min. The resulting solution was centrifuged and the supernatant was used as the DNA template. Amplification reactions were carried out with 10 ll of boiled bacterial suspensions, 250 mmol l )1 of deoxynucleoside triphosphate, 2Æ5 mmol l )1 of MgCl 2, 50 pmol of primers and 1 U of AmpliTaq Gold DNA Polymerase (Applied Biosystems, Foster City, CA, USA). Distilled water was added to bring the final volume to 50 ll. The class 1 integron primers, 5 -conserved segment (CS) and 3 -CS, which amplify the region between the 5 -CS and 3 -CS of class 1 integrons, were used as previously described (Table 2; Lévesque et al. 1995). For the detection of class 2 integrons, PCR was performed with the primer pair, hep74 and hep51, specific to the conserved regions of class 2 integrons, as described previously (Table 2; White et al. 2001). Two other primers, IntI2-F2 and IntI2-R2, were designed according to the preliminary DNA sequencing results for class 2 integrons as described previously (Table 2; Ahmed et al. 2005). These primers were located within the PCR Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

3 Integrons and resistance genes in Salmonella A.M. Ahmed et al. Primer Sequence (5 to 3 ) Target Reference Table 2 Primers used in this study Integrons 5 -CS 3 -CS hep74 hep51 IntI2-F2 IntI2-R2 b-lactamases TEM-F TEM-R SHV-F SHV-R OXA-F OXA-R CTX-M-F CTX-M-R CMY-F CMY-R GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA CGGGATCCCGGACGGCATGCACGATTTGTA GATGCCATCGCAAGTACGAG GATCCTGCCATCATTGAGTA AGGGGAAGCCGAAGTTTCC ATAAAATTCTTGAAGACGAAA GACAGTTACCAATGCTTAATC TT ATCTCCCTGTTAGCCACC GATTTGCTGATTTCGCTCGG TCAACTTTCAAGATCGCA GTGTGTTTAGAATGGTGA CGCTTTGCGATGTGCAG ACCGCGATATCGTTGGT GACAGCCTCTTTCTCCACA TGGAACGAAGGCTACGTA Plasmid-mediated quiniolone resistance qnra-f qnra-r qnrb-f qnrb-r qnrs-f qnrs-r ATTTCTCACGCCAGGATTTG GATCGGCAAAGGTTAGGTCA GATCGTGAAAGCCAGAAAGG ACGATGCCTGGTAGTTGTCC ACGACATTCGTCAACTGCAA TAAATTGGCACCCTGTAGGC Class 1 integron Class 2 integron Within class 2 integron Lévesque et al White et al Ahmed et al bla TEM Ahmed et al bla SHV Ahmed et al bla OXA Ahmed et al bla CTX-M Ahmed et al bla CMY Zhao et al qnra qnrb qnrs Robicsek et al. 2006b Robicsek et al. 2006b Robicsek et al. 2006b fragment and were used for complete sequencing of both DNA strands of the whole class 2 integron segment. The PCR products were subjected to electrophoresis in a 1Æ0% agarose gel, stained with ethidium bromide and visualized under ultraviolet light. PCR fragments were then purified from the agarose gel using a QIAquick Gel Extraction Kit (Qiagen, Tokyo, Japan). Both DNA strands of the PCR products were sequenced using an ABI automatic DNA sequencer (model 373; Applied Biosystems, Foster City, CA). Screening for antimicrobial resistance genes The bacterial isolates were tested for TEM, SHV, CTX-M, OXA and CMY b-lactamase-encoding genes by PCR using universal primers for the TEM, SHV, OXA, CTX-M and CMY families, as described previously (Table 2; Zhao et al. 2003; Ahmed et al. 2007). Multiplex PCR amplification was used for screening plasmid-mediated quinolone resistance genes, qnra, qnrb and qnrs, with primers, as described previously (Table 2; Robicsek et al. 2006b). Identification of Salmonella Typhimurium DT104 by PCR The PCR amplification of an internal segment of 16Sto-23S spacer region of bacterial rrna genes was used to identify Salmonella enterica serovar Typhimurium DT104 as previously described (Pritchett et al. 2000). Results Antimicrobial resistance phenotypes and the incidence of the multidrug-resistant Salmonella Typhimurium DT104 A total of 94 nonrepetitive Salmonella isolates were investigated for antimicrobial resistance. The disc diffusion tests showed that 48 isolates (51Æ1%) showed resistance phenotypes to two or more antimicrobial agents (Table 3). Thirty-seven out of forty-eight resistant isolates were S. Typhimurium, four isolates for each of S. Enteritidis and Salmonella Infantis, and one isolate for each of Salmonella Thompson, Salmonella O4 and a nontypable Salmonella spp. The most commonly reported resistance phenotypes were against STR (51Æ1%), TET (43Æ6%), AMP (40Æ4%), CHL (30Æ9%), KAN (30Æ9%), SXT (27Æ7%), OXA (19Æ1%) and NAL (12Æ8%) (Table 3). Twenty-two out of forty-seven (46Æ8%) isolates of S. Typhimurium showed the multidrug resistance phenotype of S. Typhimurium DT104 as they were resistant to AMP, CHL, STR and SXT, TET (ACSSuT resistance type) and sometimes to NAL and CIP (Table 3). All these isolates are of bovine origin (Table 3) and were confirmed as DT104 type by PCR. 404 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

4 A.M. Ahmed et al. Integrons and resistance genes in Salmonella Table 3 Resistance phenotype and prevalence of integrons and resistance genes in Salmonella serovars Isolate Serovar Source Year Resistance phenotype Integrons resistance gene(s) Sal Typhimurium Dairy (diseased) 2002 AMP, CFP, CHL, OXA, SPX, STR, TET Class 1 integrons (aada2, bla PSE 1 ) Sal O4 Dairy (healthy) 2002 AMP, CHL, OXA, SPX, STR,TET Class 1 integrons (aada2, bla PSE 1 ) Sal Typhimurium Dairy (healthy) 2002 AMP, CHL, KAN, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal Typhimurium Dairy (healthy) 2002 AMP, CHL, KAN, NAL, SPX, STR, SXT, TET Class 1 integrons (aada2, blapse 1) Sal Typhimurium Dairy (healthy) 2002 AMP, CFP, OXA, SPX, STR Class 1 integron (bla PSE 1 ) Sal Typhimurium Dairy (healthy) 2002 AMP, CHL, KAN, SPX, STR, SXT, TET Class 1 integrons (aada2, blapse 1) Sal Typhimurium Dairy (healthy) 2002 AMP, CHL, KAN, STR, SPX, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal02-75 Typhimurium Beef (healthy) 2002 OXA, STR Class 1 integron (aada2) Sal Typhimurium Beef (healthy) 2002 AMP, CHL, OXA, SPX, STR, TET Class 1 integrons (aada2, bla PSE 1 ) Sal02-5 Infantis Chicken (healthy) 2002 OXA, STR, SXT, TET Class 1 integron (aada1) Sal02-6 Infantis Chicken (healthy) 2002 AMP, CHL, KAN, SPX, STR, SXT, TET Class 1 integron (aada1) Sal02-7 Infantis Chicken (healthy) 2002 AMP, CHL, CIP, KAN, NAL, SPX, STR, SXT, TET Class 1 integron (aada1) Sal Typhimurium Dairy (healthy) 2003 AMP, CHL, SPX, STR, TET Class 1 integrons (aada2, bla PSE 1 ) Sal03-15 Typhimurium Beef (diseased) 2003 AMP, ATM, CHL, SPX, STR, TET Class 1 integrons (aada2, bla PSE 1 ) Sal03-43 Typhimurium Beef (diseased) 2003 AMP, CHL, KAN, STR, SXT, SPX, TET Class 1 integrons (aada2, bla PSE 1 ) Sal03-54 Typhimurium Beef (diseased) 2003 AMP, CHL, KAN, NAL, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal Typhimurium Pig (diseased) 2003 AMP, ATM, CFP, SPX, STR, SXT, TET bla TEM Sal03-78 Typhimurium Pig (healthy) 2003 AMP, CHL, KAN, SPX, STR, SXT, TET bla TEM Sal Enteritidis Chicken (healthy) 2003 SPX, STR Class 2 integrons (estx- sat2- aada1) Sal04-9 Enteritidis Chicken (healthy) 2004 SPX, STR Class 2 integrons (estx- sat2- aada1) Sal04-15 Typhimurium Pig (diseased) 2004 AMP, KAN, SPX, STR, TET bla TEM Sal04-33 Typhimurium Pig (healthy) 2004 AMP, CHL, KAN, SPX, STR, TET bla TEM Sal Typhimurium Pig (healthy) 2004 AMP, KAN, SPX, STR bla TEM Sal Typhimurium Pig (healthy) 2004 AMP, CHL, KAN, SPX, STR, TET bla TEM Sal04-57 Thompson Chicken (healthy) 2004 NAL, SPX, STR,TET qnrs1 Sal04-42 Typhimurium Beef (diseased) 2004 CIP, NAL, SPX, STR, TET qnrs1 Sal04-56 Non-typable Beef (diseased) 2004 AMP, CFP, KAN, SPX, STR, TET Class 1 integron (aada1), bla TEM Sal04-58 Typhimurium Beef (diseased) 2004 AMP, CFP, CHL, KAN, OXA, SPX, STR, SXT, TET Class 1 integron (aada1), bla TEM Sal04-60 Typhimurium Beef (diseased) 2004 AMP, CHL, KAN, NAL, SPX, STR, SXT, TET Class 1 integron (aada1), bla TEM Sal05-9 Enteritidis Chicken (healthy) 2005 ATM, CAZ, CFX, CTT, CTX, KAN,SPX, STR Class 2 integrons (estx- sat2- aada1) Sal05-D44 Typhimurium Dairy (diseased) 2005 AMP, CFP, CHL, OXA, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal05-50 Typhimurium Dairy (diseased) 2005 AMP, CHL, KAN, NAL, STR, SPX, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal Typhimurium Dairy (diseased) 2005 AMP, CHL, KAN, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal05-41 Typhimurium Dairy (diseased) 2005 AMP, CFP, KAN, OXA, SPX, STR, SXT, TET Class 1 integron (aada1), bla TEM 1 Sal05-69 Typhimurium Dairy (diseased) 2005 AMP, CHL, CIP, KAN, NAL, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal05-47 Typhimurium Pig (diseased) 2005 AMP, CFP, CHL, NAL, OXA, SPX, STR, SXT, TET bla TEM Sal05-97 Typhimurium Dairy (diseased) 2005 AMP, CHL, KAN, SPX, STR, SXT, TET Class 1 integrons (aada2, blapse 1) Sal05-58 Typhimurium Beef (diseased) 2005 AMP, CHL, KAN, NAL, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal05-C44 Enteritidis Chicken (healthy) 2005 OXA, SPX, STR Class 2 integrons (estx- sat2- aada1) Sal Typhimurium Beef (diseased) 2005 AMP, CFP, KAN, OXA, SPX, STR, SXT, TET Class 1 integron (aada1), bla TEM 1 Sal05-D115 Typhimurium Dairy (diseased) 2005 AMP, CHL, OXA, SPX, STR, TET Class 1 integrons (aada2, bla PSE 1 ) Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

5 Integrons and resistance genes in Salmonella A.M. Ahmed et al. Table 3 (Continued) Isolate Serovar Source Year Resistance phenotype Integrons resistance gene(s) Sal05-96 Typhimurium Beef (healthy) 2005 AMP, CHL, KAN, NAL, SPX, STR, SXT Class 1 integrons (aada2, bla PSE 1 ) Sal05-99 Typhimurium Pig (healthy) 2005 AMP, CFP, KAN, OXA, SPX, STR, SXT, TET Class 1 integrons (aada1), bla TEM Sal05-B115 Typhimurium Beef (healthy) 2005 AMP, KAN, OXA, STR, TET bla TEM, flor Sal06-12 Typhimurium Beef (healthy) 2006 AMP, CFP, CHL, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ) Sal06-33 Infantis Chicken (diseased) 2006 KAN, OXA, SPX, STR, SXT, TET Class 1 integrons (aada1) Sal Typhimurium Dairy (diseased) 2006 AMP, CHL, CIP, OXA, NAL, SPX, STR, SXT, TET Class 1 integrons (aada2, bla PSE 1 ), qnrs1 Sal Typhimurium Pig (diseased) 2006 KAN, OXA, SPX, STR, SXT, TET Class 1 integron (aada1) AMP, ampicillin; ATM, aztreonam; CAZ, ceftazidime; CFP, cefoperazone; CHL, chloramphenicol; CIP, ciprofloxacin; CTT, cefotetan; CTX, cefotaxime; KAN, kanamycin; NAL, nalidixic acid; OXA, oxacillin; SPX, spectinomycin; STR, streptomycin; SXT, sulfamethoxazole-trimethoprim; TET, tetracycline. Underlined terms indictae intermediate resistance. Incidence of class 1 and 2 integrons PCR and DNA sequencing results identified class 1 integrons in 34 isolates (36Æ2%) (Table 3). Twenty-one isolates (twenty isolates of S. Typhimurium and one Salmonella sp. O4) had two different sized integrons. The integrons were 1Æ2 and 1 kb in size and each carried a resistance gene cassette: b-lactamase encoding gene bla PSE 1, which confers resistance to b-lactam antibiotics, and aminoglycoside adenyltransferase gene type aada2, which confers resistance to STR SPX, respectively (Table 3). Furthermore, thirteen isolates had a class 1 integron containing one gene cassette: eleven isolates (seven isolates of S. Typhimurium and four isolates of S. infantis) carrying aada1, one S. Typhimurium isolate carrying aada2 and one S. Typhimurium isolate carrying bla PSE 1. PCR screening results detected class 2 integron of 2Æ5 kb in size in only four (4Æ3%) isolates of S. Enteritidis isolated from poultry (Table 3). DNA sequencing results for the class 2 integron identified three gene cassettes: a putative esterase estx, streptothricin acetyltransferase sat2, which confers resistance to streptothricin, and aminoglycoside adenyltransferase aada1, which confers resistance to STR SPX. The resistance phenotypes were expressed for the class 1 and 2 integron gene cassettes (Table 3). Incidence of b-lactamase-encoding gene, bla TEM PCR and DNA sequencing identified bla TEM, a narrowspectrum b-lactamase gene, which confers resistance to penicillins and first-generation cephalosporins, in 13 (13Æ8%) isolates of S. Typhimurium and one untypable isolate. All these isolates showed resistance to b-lactam antibiotics (Table 3). All Salmonella isolates were negative for SHV-, OXA-, CMY- and CTX-M-b-lactamase-encoding genes. Incidence of plasmid-mediated quinolone resistance gene, qnrs1 Multiplex PCR screening and DNA sequencing results identified qnrs1 genes in three (3Æ2%) of the tested Salmonella isolates; two isolates were S. Typhimurium and one isolate was S. Thompson (Table 3). Interestingly, one of these S. Typhimurium is of the DT104 type. Discussion Increasing antimicrobial resistance is an important public health concern, and the emergence and spread of antimicrobial resistance is a complex problem driven by numerous interconnected factors. Antibiotics are used for therapeutic and prophylactic purposes in animals and 406 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

6 A.M. Ahmed et al. Integrons and resistance genes in Salmonella humans, and some have also been used as growth promoters in animal production. These antibiotics generate reservoirs of antibiotic-resistant bacteria that contaminate food products of animal origin (Smith et al. 2002). We found that 51Æ1% of the tested Salmonella isolates were resistant to more than one antimicrobial agent. Resistance was most often observed for STR, TET, AMP, CHL, KAN and SXT. Similar resistance phenotypes have been previously recorded for different Salmonella serovars isolated from animals in Japan and the United States (Esaki et al. 2004a; b; Asai et al. 2006; Zhao et al. 2007). Salmonella Typhimurium DT104 is a major cause of illness in humans and animals throughout the world. The epidemic strain of DT104 is mostly resistant to at least five antimicrobial drugs, AMP, CHL, STR, Su and oxytetracycline (T) (R-type ACSSuT). The first epidemic outbreak due to S. Typhimurium DT104 occurred in 1994 in Europe (Threlfall et al. 1994), then in the United States in 1998 (Glynn et al. 1998) and in Japan in 1999 (Izumiya et al. 1999). Our incidence ratio of S. Typhimurium DT104 (46Æ8%) is significantly lower than that reported during by the Japanese Veterinary Antimicrobial Resistance Monitoring Program (JVARM), which detected S. Typhimurium DT104 of bovine origin in 46 out of 64 (71Æ9%) isolates of S. Typhimurium (Esaki et al. 2004b). Integrons play a major role in the spread of antibiotic resistance genes in gram-negative bacteria. Of the many classes of multiresistant integrons identified to date, integron classes 1 and 2 are most frequent in gram-negative bacteria (White et al. 2001). Here, class 1 integrons were detected in 36Æ2% of the Salmonella isolates. Class 1 integrons carrying bla PSE 1 and or aada2 gene cassettes were identified in 22 isolates of S. Typhimurium and in one isolate of Salmonella O4 (Table 3). These two integrons when together are characteristic of S. Typhimurium DT104 with ACSSuT phenotype. It is well known that the ACSSuT phenotype of this strain is encoded by a Salmonella genomic island (SGI1; Mulvey et al. 2006). SGI1-A, the classic type, harbouring complex class 1 integrons containing aada2 and bla PSE 1 gene cassettes, SGI1-B containing only the bla PSE 1 gene cassette and SGI1-D containing only the aada2 gene cassette (Mulvey et al. 2006). However, a class 1 integron containing an aada1 gene cassette was identified in S. Typhimurium isolated from bovine and aada1 in S. Infantis isolated from poultry. Similar results have been reported in S. Typhimurium and S. Infantis isolated from animals in southern Japan (Shahada et al. 2006, 2007). Class 2 integrons have an organization similar to that of class 1 but are associated with transposon Tn7 (Hansson et al. 2002). They are also known to carry three classic gene cassettes: dihydrofolate reductase dfra1, streptothricin acetyltransferase sat2 and aminoglycoside adenyltransferase aada1, which confer resistance to trimethoprim, streptothricin and STR SPX, respectively (Ahmed et al. 2005). However, our group previously characterized a new type of class 2 integron with unusually three gene cassettes, estx-sat2-aada1, from three S. Enteritidis isolates from diarrhoeic patients and river water at Hiroshima prefecture (Ahmed et al. 2005). In this study we also identified the same class 2 integron with typical gene cassettes, estx-sat2-aada1, in four strains of S. Enteritidis isolated from poultry. Therefore, poultry may act as a potential source of S. Enteritidis that may spread to humans. Further molecular analyses are needed to confirm this hypothesis. Resistance to b-lactam antibiotics in gram-negative bacteria is primarily mediated by b-lactamases, which hydrolyse the b-lactam ring and inactivate the antibiotic. Many different b-lactamases have been described; however, TEM-, SHV- OXA-, CMY- and CTX-M-b-lactamases are the most predominant in gram-negative bacteria (Bradford 2001). We identified bla TEM in 14Æ9% of the Salmonella isolates and all were S. Typhimurium except one was that of an untypable type. TEM b-lactamase has been previously detected in S. Typhimurium and S. Infantis isolated from animals in Japan (Shahada et al. 2006, 2007) and in S. Typhimurium isolated from animals in Korea (Yang et al. 2002). The gene responsible for quinolone resistance, qnr, was first identified on a transferable plasmid in a Klebsiella pneumoniae clinical strain isolated in Alabama, USA (Martínez-Martínez et al. 1998). The qnr gene confers NAL and low-level fluoroquinolone (e.g. CIP) resistance, and its presence has been shown to facilitate selection of chromosomal mutations that confer higher levels of resistance (Robicsek et al. 2006a). Plasmid-mediated quinolone resistance is of great concern as these resistance determinants are potentially disseminated among bacteria owing to plasmid mobility. To date, three main types of qnr genes, qnra, qnrb and qnrs, have been identified (Robicsek et al. 2006a). Here, PCR and DNA sequencing results identified qnrs1 in S. Typhimurium (two isolates) and S. Thompson (one isolate). One of these S. Typhimurium-positive isolates was of DT104 (Table 3). To the best of our knowledge, this is the first report of qnrs1 in Salmonella from Japan and also the first report of qnrs1 in S. Thompson. qnrs1 was first identified in a Shigella flexneri isolate from a patient in Japan (Hata et al. 2005), then in Salmonella Bovismorbificans isolated from humans in the United States (Gay et al. 2006) and more recently, in Typhimurium DT193 and other serovars such as Stanley, Virchow and Virginia isolated from patients in the United Kingdom (Hopkins et al. 2007). In Germany, qnrs1 was detected in a S. Infantis isolate of avian origin Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

7 Integrons and resistance genes in Salmonella A.M. Ahmed et al. (Kehrenberg et al. 2006). In Japan, we recently identified qnrs in Esherichia coli and Enterobacter cloacae isolated from wild animals (Ahmed et al. 2007). In conclusion, continued monitoring and characterization of antimicrobial resistance genes in food animals is vital for identifying emergence of these genes in zoonotic bacteria and for evaluating public health interventions for their containment. Acknowledgements The authors are grateful to the staffs of Hiroshima Prefectural Higashi-Hiroshima Livestock Hygiene Service Center for providing the identified Salmonella isolates used in this study. A.M. Ahmed was supported by a postdoctoral fellowship from the Japan Society for the Promotion of Science. This work was supported by a grant-in-aid for scientific research to T. Shimamoto from the Ministry of Education, Culture, Sports, Science and Technology of Japan. References Ahmed, A.M., Nakano, H. and Shimamoto, T. (2005) Molecular characterization of integrons in non-typhoid Salmonella serovars isolated in Japan: description of an unusual class 2 integron. J Antimicrob Chemother 55, Ahmed, A.M., Motoi, Y., Sato, M., Maruyama, A., Watanabe, H., Fukumoto, Y. and Shimamoto, T. (2007) Zoo animals as reservoirs of gram-negative bacteria harboring integrons and antimicrobial resistance genes. Appl Environ Microbiol 73, Asai, T., Esaki, H., Kojima, A., Ishihara, K., Tamura, Y. and Takahashi, T. (2006) Antimicrobial resistance in Salmonella isolates from apparently healthy food-producing animal from 2000 to 2003: the first stage of Japanese Veterinary Antimicrobial Resistance Monitoring (JVARM). J Vet Med Sci 68, Bradford, P.A. (2001) Extended-spectrum b-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev 14, Clinical and Laboratory Standards Institute (2003a) National Committee for Clinical Laboratory Standards, Approved Standard M2-A8. Performance Standards for Antimicrobial Disk Susceptibility Tests, 8th edn. Wayne, PA: CLSI. Clinical and Laboratory Standards Institute (2003b) National Committee for Clinical Laboratory Standards, M100-S13 (M2). Disk Diffusion Supplemental Tables. Wayne, PA: CLSI. Esaki, H., Morioka, A., Ishihara, K., Kojima, A., Shiroki, S., Tamura, Y. and Takahashi, T. (2004a) Antimicrobial susceptibility of Salmonella isolated from cattle, swine and poultry ( ): report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. J Antimicrob Chemother 53, Esaki, H., Morioka, A., Kojima, A., Ishihara, K., Asai, T., Tamura, Y., Izumiya, H., Terajima, J. et al. (2004b) Epidemiological characterization of Salmonella Typhimurium DT104 prevalent among food-producing animals in the Japanese veterinary antimicrobial resistance monitoring program ( ). Microbiol Immunol 48, Gay, K., Robicsek, A., Strahilevitz, J., Park, C.H., Jacoby, G., Barrett, T.J., Medalla, F., Chiller, T.M. et al. (2006) Plasmid-mediated quinolone resistance in non-typhi serotypes of Salmonella enterica. Clin Infect Dis 43, Glynn, M.K., Bopp, C., Dewitt, W., Dabney, P., Mokhtar, M. and Angulo, F.J. (1998) Emergence of multidrug resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N Engl J Med 338, Hansson, K., Sundström, L., Pelletier, A. and Roy, P.H. (2002) IntI2 integron integrase in Tn7. J Bacteriol 184, Hata, M., Suzuki, M., Matsumoto, M., Takahashi, M., Sato, K., Ibe, S. and Sakae, K. (2005) Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob Agents Chemother 49, Hopkins, K.L., Wootton, L., Day, M.R. and Threlfall, E.J. (2007) Plasmid-mediated quinolone resistance determinant qnrs1 found in Salmonella enterica strains isolated in the UK. J Antimicrob Chemother 59, Izumiya, H., Tamura, K., Terajima, J. and Watanabe, H. (1999) Salmonella enterica serovar Typhimurium phage type DT104 and other multidrug resistant strains in Japan. Jpn J Infect Dis 52, 133. Kehrenberg, C., Friederichs, S., de Jong, A., Michael, G.B. and Schwarz, S. (2006) Identification of the plasmid-borne quinolone resistance gene qnrs in Salmonella enterica serovar Infantis. J Antimicrob Chemother 58, Lévesque, C., Piché, L., Larose, C. and Roy, P.H. (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 39, Linton, A.H. (1986) Flow of resistance genes in the environment and from animals to man. J Antimicrob Chemother 18(Suppl. C), Martínez-Martínez, L., Pascual, A. and Jacoby, G.A. (1998) Quinolone resistance from a transferable plasmid. Lancet 351, Mulvey, M.R., Boyd, D.A., Olson, A.B., Doublet, B. and Cloeckaert, A. (2006) The genetics of Salmonella genomic island 1. Microbes Infect 8, Phillips, I., Casewell, M., Cox, T., De Groot, B., Friis, C., Jones, R., Nightingale, C., Preston, R. et al. (2004) Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J Antimicrob Chemother 53, Pritchett, L.C., Konkel, M.E., Gay, J.M. and Besser, T.E. (2000) Identification of DT104 and U302 phage types among 408 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)

8 A.M. Ahmed et al. Integrons and resistance genes in Salmonella Salmonella enterica serotype Typhimurium isolates by PCR. J Clin Microbiol 38, Robicsek, A., Jacoby, G.A. and Hooper, D.C. (2006a) The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect Dis 6, Robicsek, A., Strahilevitz, J., Sahm, D.F., Jacoby, G.A. and Hooper, D.C. (2006b) qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother 50, Shahada, F., Chuma, T., Tobata, T., Okamoto, K., Sueyoshi, M. and Takase, K. (2006) Molecular epidemiology of antimicrobial resistance among Salmonella enterica serovar Infantis from poultry in Kagoshima, Japan. Int J Antimicrob Agents 28, Shahada, F., Amamoto, A., Chuma, T., Shirai, A. and Okamoto, K. (2007) Antimicrobial susceptibility phenotypes, resistance determinants and DNA fingerprints of Salmonella enterica serotype Typhimurium isolated from bovine in southern Japan. Int J Antimicrob Agents 30, Smith, D.L., Harris, A.D., Johnson, J.A., Silbergeld, E.K. and Morris, J.G. Jr (2002) Animal antibiotic use has an early but important impact on the emergence of antibiotic resistance in human commensal bacteria. Proc Natl Acad Sci USA 99, Su, L.H., Chiu, C.H., Chu, C. and Ou, J.T. (2004) Antimicrobial resistance in nontyphoid Salmonella serotypes: a global challenge. Clin Infect Dis 39, Swartz, M.N. (2002) Human diseases caused by foodborne pathogens of animal origin. Clin Infect Dis 34(Suppl. 3), S111 S122. Threlfall, E.J., Frost, J.A., Ward, L.R. and Rowe, B. (1994) Epidemic in cattle and humans of Salmonella typhimurium DT104 with chromosomally integrated drug resistance. Vet Rec 134, 577. Van den Bogaard, A.E. and Stobberingh, E.E. (1999) Antibiotic usage in animals: impact on bacterial resistance and public health. Drugs 58, White, P.A., McIver, C.J. and Rawlinson, W.D. (2001) Integrons and gene cassettes in the Enterobacteriaceae. Antmicrob Agents Chemother 45, Yang, S.J., Park, K.Y., Kim, S.H., No, K.M., Besser, T.E., Yoo, H.S., Kim, S.H., Lee, B.K. et al. (2002) Antimicrobial resistance in Salmonella enterica serovars Enteritidis and Typhimurium isolated from animals in Korea: comparison of phenotypic and genotypic resistance characterization. Vet Microbiol 86, Zhao, S., Qaiyumi, S., Friedman, S., Singh, R., Foley, S.L., White, D.G., McDermott, P.F., Donkar, T. et al. (2003) Characterization of Salmonella enterica serotype Newport isolated from humans and food animals. J Clin Microbiol 41, Zhao, S., McDermott, P.F., White, D.G., Qaiyumi, S., Friedman, S.L., Abbott, J.W., Glenn, A., Ayers, S.L. et al. (2007) Characterization of multidrug resistant Salmonella recovered from diseased animals. Vet Microbiol 123, Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009)