PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE

Size: px
Start display at page:

Download "PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE"

Transcription

1 PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1

2 Nucleic Acids are important for their roles in the storage, transfer and expression of genecc informacon. HOW DO YOU TRANSFER INFORMATION TO THE NEXT GENERATION? HOW DO YOU DECODE THE INFORMATION AND MAINTAIN THE CELL S STRUCTURE AND FUNCTION? 2

3 Transfer and interpretacon of genecc informacon is described in the central dogma of molecular biology. Transla<on is required to convert the language of nucleic acids to the language of proteins. 3

4 TRANSLATION PROCESS 4

5 TranslaCon occurs in the ribosomes. Ribosomes are composed of two (2) major subunits. Each subunit is a complex structure of rrna and several proteins. 5

6 TranslaCon occurs in the ribosomes. Ribosomes are composed of two (2) major subunits. Each subunit is a complex structure of rrna and several proteins. 6

7 Ribosomes move along mrna templates deciphering the code, bring along adaptor molecules carrying amino acids capable of specific binding to mrna to decode informacon, and can catalyze the formacon of the pepcde bond. 7

8 Protein synthesis begins at the amino terminus. 8

9 Amino acids are carried by t RNA 9

10 Aminoacyl trna synthetase a[aches the amino acid to the t RNA (very specific) Mechanism and specificity Deacylase accvity "edits" and hydrolyzes misacylated aminoacyl trnas Despite common funccon, the synthetases are a diverse colleccon of enzymes Four different quaternary structures: α, α 2, α 4 and α 2 β 2 Subunits from 334 to more than 1000 residues 10

11 Amino acids are carried by trna. Each unique amino acid is carried by a specific trna Specificity is determined by a 3 nucleocde sequence in mrna called codons and the corresponding complementary sequence in trna called an<codons 11

12 This specific interaccon between the codon and a corresponding translacon to an amino acid is determined by the gene<c code. 3 nucleocdes (codon) encode an amino acid The code is nonoverlapping The code has no punctua6on The code is degenerate and universal 12

13 This specific interaccon between the codon and a corresponding translacon to an amino acid is determined by the gene<c code. GENOME ENGLISH analogy Nitrogenous Bases (ATCG) Letters (a,s,f,t,r,e, ) Codons Words Gene Sentences Chromosome Chapters Genome Book 13

14 14

15 Problem 1 What is the pepcde encoded by the following mrna? 3 AGAAUAUCGAAGCAGGGGUAGUGA 5 15

16 Problem 2 The following is the parent DNA strand. Assuming that splicing does not occur anymore ader transcripcon, give the pepcde it expresses. 5 -CTATAGAATCCCCCAATGACCACGCAT-3 16

17 TranslaCon is started by recognicon of start codon of the smaller ribosomal unit, start trna, inicacon factors (IF) and GTP. 17

18 NOTE: Prokaryote start is different from the eukaryote start. Prokaryote START fmet (formylmethionine) bound to inicator trna Recognizes AUG and somecmes GUG (but they also code for Met and Val respeccvely) AUG (or GUG) only part of the inicacon signal; preceded by a purine rich sequence Shine Dalgarno sequence 18

19 NOTE: Prokaryote start is different from the eukaryote start. 19

20 NOTE: Prokaryote start is different from the eukaryote start. Eukaryote START AUG nearest the 5 end is usually the start signal 20

21 When translacon is inicated, the large ribosomal subunit engages to complete the ribosomal catalycc sites 21

22 When translacon is inicated, the large ribosomal subunit engages to complete the ribosomal catalycc sites 22

23 When translacon is inicated, the large ribosomal subunit engages to complete the ribosomal catalycc sites 23

24 A second Aminoacyl trna molecule comes into the Asite and pep<dyl transferase creates the pepcde bond 24

25 A second Aminoacyl trna molecule comes into the Asite and pep<dyl transferase creates the pepcde bond 25

26 A second Aminoacyl trna molecule comes into the Asite and pep<dyl transferase creates the pepcde bond 26

27 A second Aminoacyl trna molecule comes into the Asite and pep<dyl transferase creates the pepcde bond 27

28 28

29 29

30 30

31 mrna is translated by lots of ribosomes, one ader the other. 31

32 Some ancbioccs inhibit translacon to kill off bacteria. Streptomyces venezuelae produces puromuycin 32

33 RECAP: 1. TranslaCon occurs at the ribosomes (large subunit and small subunit) 2. t RNAs carry specific amino acids to ribosomes. 3. Specific interaccons between mrna and trna allow for the decoding and translacon of nucleic acid to proteins 4. Ribosomes catalyze reaccon of pepcde bond formacon

34 POST TRANSLATIONAL MODIFICATIONS AND PROCESSING 34

35 Ader translacon, proteins fold due to intermolecular interaccons with water and itself. Chaperones facilitate and guide protein folding 35

36 Proteins are also biologically modified by a[aching different groups ProteolyCc cleavage (Zymogens) AddiCon of prosthecc groups (heme, etc.) PROTEIN Amino acid modificacon A[achment of Carbohydrates 36

37 Proteins are then transported to different parts of the cell by means of protein targekng. Protein that need to pass thru membranes have an extra amino acid sequence (cealled signal sequence) to tell the cell that they need to be transported. 37

38 Proteins also need to be concnuously degraded for funccon regulacon and removal of damaged or misfolded proteins. The protein s kiss of death marker is Ubiqui<n. 38

39 Proteins also need to be concnuously degraded for funccon regulacon and removal of damaged or misfolded proteins. The protein s kiss of death marker is Ubiqui<n. 39

40 REGULATION OF PROTEIN SYNTHESIS AND GENE EXPRESSION 40

41 Humans have about genes. Some are needed at all Cmes (cons<tu<ve genes). Some are needed only at specific points in a cell s life (inducible genes or repressible genes) 41

42 A gene cluster containing genes coding for different proteins of related funccons are called operons. 42

43 The RNA Polymerase DNA interaccon is Cghtly regulated by ac<vators and deac<vators. 43

44 The RNA Polymerase DNA interaccon is Cghtly regulated by ac<vators and deac<vators. 44

45 Regulatory proteins have discrete binding domains that allow them to recognize and bind to specific DNA. They parccipate via H bonding to DNA sequences. 45

46 About 80% of known regulatory proteins can be classified as : 1. Helix turn helix mo<f 46

47 About 80% of known regulatory proteins can be classified as : 1. Helix turn helix mocf; 2. Zinc finger mo<f 47

48 About 80% of known regulatory proteins can be classified as : 1. Helix turn helix mocf; 2. Zinc finger mo<f 48

49 About 80% of known regulatory proteins can be classified as : 1. Helix turn helix mocf; 2. Zinc finger mocf; 3. Leucine Zipper mo<f 49

50 About 80% of known regulatory proteins can be classified as : 1. Helix turn helix mocf; 2. Zinc finger mocf; 3. Leucine Zipper mo<f 50

51 Genes may also be silenced ader transcripcon (Post transcrip<onal gene silencing, PTGS) by use of RNAinduced silencing complexes (RISCs) or riboswitches. 51

52 Genes may also be silenced ader transcripcon (Post transcrip<onal gene silencing, PTGS) by use of RNAinduced silencing complexes (RISCs) or riboswitches. 52

53 Genes may also be silenced ader transcripcon (Post transcrip<onal gene silencing, PTGS) by use of RNAinduced silencing complexes (RISCs) or riboswitches. 53

54 Genes may also be silenced ader transcripcon (Post transcrip<onal gene silencing, PTGS) by use of RNAinduced silencing complexes (RISCs) or riboswitches. 54

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

Chapter

Chapter Chapter 17 17.4-17.6 Molecular Components of Translation A cell interprets a genetic message and builds a polypeptide The message is a series of codons on mrna The interpreter is called transfer (trna)

More information

GCD3033:Cell Biology. Transcription

GCD3033:Cell Biology. Transcription Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors

More information

Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype

Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Molecular Biology (9)

Molecular Biology (9) Molecular Biology (9) Translation Mamoun Ahram, PhD Second semester, 2017-2018 1 Resources This lecture Cooper, Ch. 8 (297-319) 2 General information Protein synthesis involves interactions between three

More information

Molecular Biology - Translation of RNA to make Protein *

Molecular Biology - Translation of RNA to make Protein * OpenStax-CNX module: m49485 1 Molecular Biology - Translation of RNA to make Protein * Jerey Mahr Based on Translation by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative

More information

Name: SBI 4U. Gene Expression Quiz. Overall Expectation:

Name: SBI 4U. Gene Expression Quiz. Overall Expectation: Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):

More information

Translation Part 2 of Protein Synthesis

Translation Part 2 of Protein Synthesis Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation

More information

Laith AL-Mustafa. Protein synthesis. Nabil Bashir 10\28\ First

Laith AL-Mustafa. Protein synthesis. Nabil Bashir 10\28\ First Laith AL-Mustafa Protein synthesis Nabil Bashir 10\28\2015 http://1drv.ms/1gigdnv 01 First 0 Protein synthesis In previous lectures we started talking about DNA Replication (DNA synthesis) and we covered

More information

-14. -Abdulrahman Al-Hanbali. -Shahd Alqudah. -Dr Ma mon Ahram. 1 P a g e

-14. -Abdulrahman Al-Hanbali. -Shahd Alqudah. -Dr Ma mon Ahram. 1 P a g e -14 -Abdulrahman Al-Hanbali -Shahd Alqudah -Dr Ma mon Ahram 1 P a g e In this lecture we will talk about the last stage in the synthesis of proteins from DNA which is translation. Translation is the process

More information

From gene to protein. Premedical biology

From gene to protein. Premedical biology From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,

More information

Lesson Overview. Ribosomes and Protein Synthesis 13.2

Lesson Overview. Ribosomes and Protein Synthesis 13.2 13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic

More information

BME 5742 Biosystems Modeling and Control

BME 5742 Biosystems Modeling and Control BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various

More information

BCH 4054 Spring 2001 Chapter 33 Lecture Notes

BCH 4054 Spring 2001 Chapter 33 Lecture Notes BCH 4054 Spring 2001 Chapter 33 Lecture Notes Slide 1 The chapter covers degradation of proteins as well. We will not have time to get into that subject. Chapter 33 Protein Synthesis Slide 2 Prokaryotic

More information

GENETICS - CLUTCH CH.11 TRANSLATION.

GENETICS - CLUTCH CH.11 TRANSLATION. !! www.clutchprep.com CONCEPT: GENETIC CODE Nucleotides and amino acids are translated in a 1 to 1 method The triplet code states that three nucleotides codes for one amino acid - A codon is a term for

More information

CHAPTER4 Translation

CHAPTER4 Translation CHAPTER4 Translation 4.1 Outline of Translation 4.2 Genetic Code 4.3 trna and Anticodon 4.4 Ribosome 4.5 Protein Synthesis 4.6 Posttranslational Events 4.1 Outline of Translation From mrna to protein

More information

From Gene to Protein

From Gene to Protein From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed

More information

Chapter 17. From Gene to Protein. Biology Kevin Dees

Chapter 17. From Gene to Protein. Biology Kevin Dees Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting

More information

Translation and Operons

Translation and Operons Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different

More information

Prokaryotic Regulation

Prokaryotic Regulation Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory

More information

9 The Process of Translation

9 The Process of Translation 9 The Process of Translation 9.1 Stages of Translation Process We are familiar with the genetic code, we can begin to study the mechanism by which amino acids are assembled into proteins. Because more

More information

1. In most cases, genes code for and it is that

1. In most cases, genes code for and it is that Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod

More information

RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA

RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order

More information

Translation. Genetic code

Translation. Genetic code Translation Genetic code If genes are segments of DNA and if DNA is just a string of nucleotide pairs, then how does the sequence of nucleotide pairs dictate the sequence of amino acids in proteins? Simple

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

UNIT 5. Protein Synthesis 11/22/16

UNIT 5. Protein Synthesis 11/22/16 UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA

More information

Advanced Topics in RNA and DNA. DNA Microarrays Aptamers

Advanced Topics in RNA and DNA. DNA Microarrays Aptamers Quiz 1 Advanced Topics in RNA and DNA DNA Microarrays Aptamers 2 Quantifying mrna levels to asses protein expression 3 The DNA Microarray Experiment 4 Application of DNA Microarrays 5 Some applications

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,

More information

ومن أحياها Translation 2. Translation 2. DONE BY :Nisreen Obeidat

ومن أحياها Translation 2. Translation 2. DONE BY :Nisreen Obeidat Translation 2 DONE BY :Nisreen Obeidat Page 0 Prokaryotes - Shine-Dalgarno Sequence (2:18) What we're seeing here are different portions of sequences of mrna of different promoters from different bacterial

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11

UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of

More information

Types of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.

Types of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell. RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic

More information

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,

More information

Protein synthesis I Biochemistry 302. February 17, 2006

Protein synthesis I Biochemistry 302. February 17, 2006 Protein synthesis I Biochemistry 302 February 17, 2006 Key features and components involved in protein biosynthesis High energy cost (essential metabolic activity of cell Consumes 90% of the chemical energy

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps

More information

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA

More information

Biochemistry Prokaryotic translation

Biochemistry Prokaryotic translation 1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 2. Understand the concept of genetic code 3. Understand the concept of wobble hypothesis

More information

Section 7. Junaid Malek, M.D.

Section 7. Junaid Malek, M.D. Section 7 Junaid Malek, M.D. RNA Processing and Nomenclature For the purposes of this class, please do not refer to anything as mrna that has not been completely processed (spliced, capped, tailed) RNAs

More information

Information Content in Genetics:

Information Content in Genetics: Information Content in Genetics: DNA, RNA and protein mrna translation into protein (protein synthesis) Francis Crick, 1958 [Crick, F. H. C. in Symp. Soc. Exp. Biol., The Biological Replication of Macromolecules,

More information

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid. 1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

More information

Translation and the Genetic Code

Translation and the Genetic Code Chapter 11. Translation and the Genetic Code 1. Protein Structure 2. Components required for Protein Synthesis 3. Properties of the Genetic Code: An Overview 4. A Degenerate and Ordered Code 1 Sickle-Cell

More information

2015 FALL FINAL REVIEW

2015 FALL FINAL REVIEW 2015 FALL FINAL REVIEW Biomolecules & Enzymes Illustrate table and fill in parts missing 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how

More information

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,

More information

Gene Expression: Translation. transmission of information from mrna to proteins Chapter 5 slide 1

Gene Expression: Translation. transmission of information from mrna to proteins Chapter 5 slide 1 Gene Expression: Translation transmission of information from mrna to proteins 601 20000 Chapter 5 slide 1 Fig. 6.1 General structural formula for an amino acid Peter J. Russell, igenetics: Copyright Pearson

More information

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu. Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The

More information

Biology I Fall Semester Exam Review 2014

Biology I Fall Semester Exam Review 2014 Biology I Fall Semester Exam Review 2014 Biomolecules and Enzymes (Chapter 2) 8 questions Macromolecules, Biomolecules, Organic Compunds Elements *From the Periodic Table of Elements Subunits Monomers,

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

Number of questions TEK (Learning Target) Biomolecules & Enzymes

Number of questions TEK (Learning Target) Biomolecules & Enzymes Unit Biomolecules & Enzymes Number of questions TEK (Learning Target) on Exam 8 questions 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how

More information

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=

More information

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11 The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

More information

Degeneracy. Two types of degeneracy:

Degeneracy. Two types of degeneracy: Degeneracy The occurrence of more than one codon for an amino acid (AA). Most differ in only the 3 rd (3 ) base, with the 1 st and 2 nd being most important for distinguishing the AA. Two types of degeneracy:

More information

Chapter 12. Genes: Expression and Regulation

Chapter 12. Genes: Expression and Regulation Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein

More information

What is the central dogma of biology?

What is the central dogma of biology? Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)

More information

ENZYMES 1: OVERVIEW AND MECHANISM OF ACTION

ENZYMES 1: OVERVIEW AND MECHANISM OF ACTION ENZYMES 1: OVERVIEW AND MECHANISM OF ACTION HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 WHAT ARE ENZYMES? 2 Enzymes are molecular devices

More information

Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and

Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and protein subunits they contain. Understand the main functions

More information

9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes

9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin

More information

Computational Cell Biology Lecture 4

Computational Cell Biology Lecture 4 Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.

More information

Protein synthesis I Biochemistry 302. Bob Kelm February 23, 2004

Protein synthesis I Biochemistry 302. Bob Kelm February 23, 2004 Protein synthesis I Biochemistry 302 Bob Kelm February 23, 2004 Key features of protein synthesis Energy glutton Essential metabolic activity of the cell. Consumes 90% of the chemical energy (ATP,GTP).

More information

ومن أحياها Translation 1. Translation 1. DONE BY :Maen Faoury

ومن أحياها Translation 1. Translation 1. DONE BY :Maen Faoury Translation 1 DONE BY :Maen Faoury 0 1 ومن أحياها Translation 1 2 ومن أحياها Translation 1 In this lecture and the coming lectures you are going to see how the genetic information is transferred into proteins

More information

Prokaryo'c Operon Model Ac'vity

Prokaryo'c Operon Model Ac'vity Prokaryo'c Operon Model Ac'vity Differen'al Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental condi6ons In mul6cellular eukaryotes, gene expression

More information

Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes

Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2

More information

Conceptofcolinearity: a continuous sequence of nucleotides in DNA encodes a continuous sequence of amino acids in a protein

Conceptofcolinearity: a continuous sequence of nucleotides in DNA encodes a continuous sequence of amino acids in a protein Translation Conceptofcolinearity: a continuous sequence of nucleotides in DNA encodes a continuous sequence of amino acids in a protein Para além do fenómeno do wobble, há que considerar Desvios ao código

More information

9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes

9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin

More information

Chapter 17 The Mechanism of Translation I: Initiation

Chapter 17 The Mechanism of Translation I: Initiation Chapter 17 The Mechanism of Translation I: Initiation Focus only on experiments discussed in class. Completely skip Figure 17.36 Read pg 521-527 up to the sentence that begins "In 1969, Joan Steitz..."

More information

Organic Chemistry Option II: Chemical Biology

Organic Chemistry Option II: Chemical Biology Organic Chemistry Option II: Chemical Biology Recommended books: Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: stuart.conway@chem.ox.ac.uk Teaching

More information

Lecture 9 Translation.

Lecture 9 Translation. 1 Translation Summary of important events in translation. 2 Translation Reactions involved in peptide bond formation. Lecture 9 3 Genetic code Three types of RNA molecules perform different but complementary

More information

Introduction to molecular biology. Mitesh Shrestha

Introduction to molecular biology. Mitesh Shrestha Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of

More information

BCMB Chapters 39 & 40 Translation (protein synthesis)

BCMB Chapters 39 & 40 Translation (protein synthesis) BCMB 3100 - Chapters 39 & 40 Translation (protein synthesis) Translation Genetic code trna Amino acyl trna Ribosomes Initiation Elongation Termination How is the nucleotide code translated into a protein

More information

BCMB Chapters 39 & 40 Translation (protein synthesis)

BCMB Chapters 39 & 40 Translation (protein synthesis) BCMB 3100 - Chapters 39 & 40 Translation (protein synthesis) Translation Genetic code trna Amino acyl trna Ribosomes Initiation Elongation Termination How is the nucleotide code translated into a protein

More information

Controlling Gene Expression

Controlling Gene Expression Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription

More information

Eukaryotic vs. Prokaryotic genes

Eukaryotic vs. Prokaryotic genes BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,

More information

NO!!!!! BCMB Chapters 39 & 40 Translation (protein synthesis) BCMB Chapters 39 & 40 Translation (protein synthesis)

NO!!!!! BCMB Chapters 39 & 40 Translation (protein synthesis) BCMB Chapters 39 & 40 Translation (protein synthesis) BCMB 3100 - Chapters 39 & 40 Translation How is the nucleotide code translated into a protein code? translation DNA RNA protein transcription 5 UCA 3 NH 2 Ser COO -????? Adapter Molecule Hypothesis (Crick,

More information

RNA Synthesis and Processing

RNA Synthesis and Processing RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that

More information

Flow of Genetic Information

Flow of Genetic Information presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid

More information

Regulation of Transcription in Eukaryotes. Nelson Saibo

Regulation of Transcription in Eukaryotes. Nelson Saibo Regulation of Transcription in Eukaryotes Nelson Saibo saibo@itqb.unl.pt In eukaryotes gene expression is regulated at different levels 1 - Transcription 2 Post-transcriptional modifications 3 RNA transport

More information

Introduction. Gene expression is the combined process of :

Introduction. Gene expression is the combined process of : 1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression

More information

Bi 8 Midterm Review. TAs: Sarah Cohen, Doo Young Lee, Erin Isaza, and Courtney Chen

Bi 8 Midterm Review. TAs: Sarah Cohen, Doo Young Lee, Erin Isaza, and Courtney Chen Bi 8 Midterm Review TAs: Sarah Cohen, Doo Young Lee, Erin Isaza, and Courtney Chen The Central Dogma Biology Fundamental! Prokaryotes and Eukaryotes Nucleic Acid Components Nucleic Acid Structure DNA Base

More information

Bioinformatics Chapter 1. Introduction

Bioinformatics Chapter 1. Introduction Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!

More information

Chapter 19 Overview. Protein Synthesis. for amino acid. n Protein Synthesis genetic info encoded in nucleic acids translated into standard amino acids

Chapter 19 Overview. Protein Synthesis. for amino acid. n Protein Synthesis genetic info encoded in nucleic acids translated into standard amino acids Chapter 19 Overview Protein Synthesis n Protein Synthesis genetic info encoded in nucleic acids translated into standard amino acids n Genetic code dictionary defining meaning for base sequence n Codon

More information

GENE REGULATION AND PROBLEMS OF DEVELOPMENT

GENE REGULATION AND PROBLEMS OF DEVELOPMENT GENE REGULATION AND PROBLEMS OF DEVELOPMENT By Surinder Kaur DIET Ropar Surinder_1998@ yahoo.in Mob No 9988530775 GENE REGULATION Gene is a segment of DNA that codes for a unit of function (polypeptide,

More information

Regulation of Transcription in Eukaryotes

Regulation of Transcription in Eukaryotes Regulation of Transcription in Eukaryotes Leucine zipper and helix-loop-helix proteins contain DNA-binding domains formed by dimerization of two polypeptide chains. Different members of each family can

More information

From DNA to protein, i.e. the central dogma

From DNA to protein, i.e. the central dogma From DNA to protein, i.e. the central dogma DNA RNA Protein Biochemistry, chapters1 5 and Chapters 29 31. Chapters 2 5 and 29 31 will be covered more in detail in other lectures. ph, chapter 1, will be

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

Name Period The Control of Gene Expression in Prokaryotes Notes

Name Period The Control of Gene Expression in Prokaryotes Notes Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression

More information

Translation. A ribosome, mrna, and trna.

Translation. A ribosome, mrna, and trna. Translation The basic processes of translation are conserved among prokaryotes and eukaryotes. Prokaryotic Translation A ribosome, mrna, and trna. In the initiation of translation in prokaryotes, the Shine-Dalgarno

More information

Gene Expression. Molecular Genetics, March, 2018

Gene Expression. Molecular Genetics, March, 2018 Gene Expression Molecular Genetics, March, 2018 Gene Expression Control of Protein Levels Bacteria Lac Operon Promoter mrna Inducer CAP Control Trp Operon RepressorOperator Control Attenuation Riboswitches

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Honors Biology Reading Guide Chapter 11

Honors Biology Reading Guide Chapter 11 Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins

More information

15.2 Prokaryotic Transcription *

15.2 Prokaryotic Transcription * OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons

More information

Gene Control Mechanisms at Transcription and Translation Levels

Gene Control Mechanisms at Transcription and Translation Levels Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9

More information

CHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline

CHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline CHAPTER 3 Cell Structure and Genetic Control Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell Nucleus and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division

More information

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization. 3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of

More information

Molecular Biology of the Cell

Molecular Biology of the Cell Alberts Johnson Lewis Morgan Raff Roberts Walter Molecular Biology of the Cell Sixth Edition Chapter 6 (pp. 333-368) How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2015 Genetic

More information

Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)

Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme

More information

Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.

Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper. Old FINAL EXAM BIO409/509 NAME Please number your answers and write them on the attached, lined paper. Gene expression can be regulated at several steps. Describe one example for each of the following:

More information

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant? Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was

More information