DETERMINANTS THAT CONFER STOP CODON SPECIFICITY TO TETRAHYMENA THERMOPHILA ERF1. Cara Hope Heath. David Bedwell, CHAIR Asim Bej Kim Keeling

Transcription

1 DETERMINANTS THAT CONFER STOP CODON SPECIFICITY TO TETRAHYMENA THERMOPHILA ERF1 by Cara Hope Heath David Bedwell, CHAIR Asim Bej Kim Keeling A THESIS Submitted to the graduate faculty of The University of Alabama at Birmingham, in partial fulfillment of the requirements for the degree of Master of Science BIRMINGHAM, ALABAMA 2007

2 DETERMINANTS THAT CONFER STOP CODON SPECIFICITY TO TETRAHYMENA THERMOPHILA ERF1 Cara Hope Heath BIOLOGY ABSTRACT In eukaryotes, translation termination is a process which is initiated by the presence of a stop codon in the A site of the ribosome and mediated by the binding of a release factor (erf1). In most eukaryotes, any one of three stop codons UGA, UAG, or UAA, is required for the binding of erf1. However some organisms, such as the ciliates, have diverged from this universal coding. In one type of ciliate species, Tetrahymena thermophila, UAA and UAG are no longer recognized as stop codons and now both encode a glutamine residue. It was previously thought that domain 1 of erf1 is solely responsible for the stop codon specificity in eukaryotes. Through fusion of Tetrahymena domain 1 to domains 2 and 3 of the yeast Saccharomyces cerevisiae (Tt1/Sc23), it was shown that Tetrahymena s domain 1 recognized all three stops when expressed in yeast cells. This suggests that other domains of Tetrahymena erf1 may be involved in restricting stop codon recognition. In order to determine what region of Tetrahymena s erf1 is linked to their altered recognition, new fusion proteins were made with increasing amounts of Tetrahymena erf1. The results of a fusion protein with domains 1 and 2 or domain 3 from Tetrahymena (Tt12/Sc3 or Sc12/Tt3, respectively) indicate that domains 2 and 3 each reduced the ability of domains 1 to recognize UAG and UAA. The complete Tetrahymena erf1 was unable to support growth in an erf1 knockout strain. Analysis in the presence of the second Tetrahymena release factor, erf3 which has a ii

3 GTPase domain required for the proper function of the intact Tetrahymena erf1, also did not restore function of Tetrahymena erf1, suggesting that the full length erf1 from this organism may not interact properly with yeast ribosomes. iii

4 DEDICATION I would like to dedicate this work to and thank God, my fiancé, my friends, and my family. I would not be able to make it without any of them and I deeply thank them for all of their help and support. iv

5 ACKNOWLEDGEMENT I would like to acknowledge and thank my mentor, Dr. David Bedwell, for giving me this project and guiding me through. I will now have a better understanding of research and disease mechanisms and I will continue with research in the future. v

6 TABLE OF CONTENTS Page ABSTRACT... ii DEDICATION... iv ACKNOWLEDGMENTS...v LIST OF FIGURES... vii INTRODUCTION...1 MATERIALS AND METHODS...9 RESULTS...14 DISCUSSION...34 LIST OF REFERENCES...38 vi

7 LIST OF FIGURES Figure Page 1 Schematic of translation termination and polypeptide chain release mediated by the two release factors, erf1 and erf A) 3-D structure of human erf1. B) 3-D structure of the essential C-terminal region of S. pombe erf Phylogenetic tree of life Stop codons recognized by S. cerevisiae (Sc) and T. thermophila (Tt) Schematic showing the wild-type S. cerevisiae (Sc), the T. thermophila / S. cerevisiae (Tt/Sc) and the E. octocarinatus / S. cerevisiae (Eo/Sc) hybrid erf1 proteins 7 6 Schematic showing the T. thermophila domain 1-2/ S. cerevisiae domain 3 (Tt12/Sc3) hybrid erf Western blot with an HA antibody showing that each of the three erf1 HA-epitope tagged proteins are being expressed. Tom70 was used as loading control Plasmid shuffle to test the viability of the new Tt12/Sc3 hybrid erf1 protein A) Luciferase reporter plasmids, containing either a stop or a sense codon, used to monitor translation termination. B) Readthrough of stop codons in cells expressing WT erf1, Tt1/Sc23 erf1, or Tt12/Sc3 erf1 proteins Schematic showing the S. cerevisiae domain1-2/t. thermophila domain 3 (Tt3/Sc12) erf Western with an HA antibody showing that the Tt3/Sc12 erf1 protein was being expressed...21 vii

8 12 Plasmid shuffle to test the viability of the Sc12/Tt3 erf1 protein Percent readthrough at each of the three stop codons from WT erf1, Tt1/Sc23 erf1, and Tt3/Sc12 erf Schematic showing the T. thermophila domain 123/S. cerevisiae 3 UTR (Tt123) erf1. Stars indicate stop codons mutated back to glutamine Western with an HA antibody showing that the Tt123 erf1 was being expressed. Tom70 was used as a loading control Plasmid shuffle to test the viability of the Tt123 erf1 protein Schematic showing sup45 strains undergoing a carbon source shift in order to shut off the GAL1 promoter and delete out the WT erf Cultures with the indicated plasmid were grown in SM medium with galactose as the carbon source for several generations. Cells were then shifted to glucose to inhibit GAL1 promoters and WT was diluted out by growing for at least 6 doublings Schematic showing the SUP35 promoter driven Cmyc-Tetrahymena C-terminal domain erf3 (Tt NM erf3) and S. cerevisiae 3 UTR Schematic of expression plasmids needed to determine if Tetrahymena s erf3 can restore UGA-specific termination in a readthrough assay Western blot analysis of Tetrahymena and S. cerevisiae hybrid erf1 and erf3 proteins. SUP45 and Tom70 antibodies were used as loading controls Percent readthrough of the Tt123 erf1 Tt NM erf3 strain following galactose to glucose shift...33 viii

9 INTRODUCTION The central dogma of molecular biology involves transcription and translation in which the genetic code is used to make proteins. Transcription is the coding from DNA to mrna, and translation is the process in which an mrna is encoded into a functional protein. Translation begins when an initiation complex forms by the assembly of the ribosomal subunits and initiator trna (met-trna) at the start codon on the mrna. After the first trna has translocated to the P site in the ribosome, a second trna enters the A site of the ribosome and binds to its complementary codon in the mrna (21). This process of peptide synthesis continues as the ribosome moves along the mrna, and the future protein grows longer until the ribosome encounters any one of three stop codons (UAA, UAG, or UGA). The presence of a stop codon within the ribosomal A site initiates translation termination, and the subsequent binding of release factors, which recognize the stop codon and cause the GTP-dependent release of the nascent polypeptide chain (18) (Fig. 1). There are two release factors necessary for translation termination in eukaryotes (28, 31). The first, erf1, is a class one release factor that contains three functional domains (9). A class 1 release factor functions by recognizing the stop codon and by promoting the hydrolysis of the ester bond which links the trna in the peptidyl site of the ribosome with the growing polypeptide chain (27). Domain 1 of erf1 is responsible for recognizing the stop codon in the A site of the ribosome (2, 26). Domain 2 interacts 1

10 Figure 1. Schematic of translation termination and polypeptide chain release mediated by the two release factors, erf1 and erf3. 2

11 within the ribosome at the peptidyl transferase center (11), and domain 3 mediates the interaction between erf1 and erf3 (7, 8, 11, 22) (Fig. 2A). The second, erf3, is a class II release factor that functions in a GTP-dependent manner (10). It has been shown to have three important characteristics. It is able to bind and hydrolyze GTP, it binds to erf1, and it has been shown to have no release factor activity of its own in vivo. The GTPase activity of erf3 plays a significant role in translation termination. It has been shown that erf3 has three functional regions, which includes a GTPase domain that mediates GTP hydrolysis and stimulates polypeptide chain release and accurate stop codon recognition. The N (amino) terminal region as well as the M (middle) region of erf3 protein, consist of amino acids 1 to 253, and are both dispensable for translation (20). The N-terminal region is involved in prion formation and the M region is responsible for binding to poly(a)-binding protein (6). The C (carboxyl) terminal region is necessary for viability, responsible for erf1 binding, and contains the GTP binding motif (4, 24). The crystal structure of the C-terminal region from S. pombe erf3 is known and it contains three distinct domains. Domain 1 of erf3 contains the GTPase region and domains 2 and 3 are responsible for binding erf1 (19) (Fig. 2B). In the yeast Saccharomyces cerevisiae, the SUP45 gene encodes the erf1 protein and the SUP35 gene encodes the erf3 protein. Both genes have been found to be essential. Universal coding of the three stop codons (UAA, UAG, and UGA) is conserved across most organisms; therefore translation is terminated by the presence of any one of the three stop codons. However, there are major exceptions among the ciliate species. Ciliates are single cell 3

12 A B Figure 2: A) 3-D structure of human erf1. B) 3-D structure of the essential C-terminal region of S. pombe erf3 4

13 ciliated protozoans (Fig. 3). The erf1 proteins from the ciliates have the same domain structure as erf1 proteins from other eukaryotic species, but the ciliates have diverged from universal coding in their stop codon recognition pattern (13, 23). In one ciliated organism, Euplotes octocarinatus, the universal code has changed from recognizing all three stop codons to just recognizing UAA and UAG, while UGA functions as a cysteine codon. In another ciliated species, Tetrahymena thermophila, the opposite is true. It only recognizes UGA as a stop and has recoded UAG and UAA to function as glutamine codons (Fig. 4) (25). One approach to studying translation termination and release factors is by using these alternate code organisms. It has been shown that domain 1 of erf1 is responsible for recognizing stop codons (14). A previous study was conducted to see if domain 1 of either T. thermophila or E. octocarinatus, when fused to domains two and three of the yeast Saccharomyces cerevisiae, is capable of changing the coding pattern from universal to species specific (Fig. 5). The erf1 protein from these organisms share about 57% amino acid sequence homology to human and S. cerevisiae erf1 (15). The new fusion proteins were expressed from a plasmid with the erf1 (SUP45) promoter and were then transformed in a yeast strain with the endogenous SUP45 gene knocked out. The results showed that the Eo1/Sc23 hybrid was unable to complement the SUP45 knockout, and after further analysis it was determined that the Eo1/Sc23 hybrid was able to terminate translation efficiently at UAG and UAA, but not at the UGA codon. However, it was found that the Tetrahymena hybrid could complement the SUP45 knockout and terminate translation efficiently at all three stop codons. These results indicated that domain1 in the Eo1/Sc23 hybrid has the ability to recapitulate the stop 5

14 Figure 3: Phylogenetic tree of life ScUGAUAAUAG Tt UAGGln Gln Figure 4: Stop codons recognized by S. cerevisiae (Sc) and T. thermophila (Tt) 6

15 Sc Tt/Sc Eo/Sc Sc Domain 1 Sc Domain 2 Sc Domain 3 Tt Domain 1 Sc Domain 2 Sc Domain 3 Eo Domain 1 Sc Domain 2 Sc Domain 3 Figure 5. Schematic showing the wild-type S. cerevisiae (Sc), the T. thermophila/s. cerevisiae (Tt/Sc) and the E. octocarinatus/s. cerevisiae (Eo/Sc) hybrid erf1 proteins. 7

16 codon recognition pattern of the original organism, however; the Tt1/Sc23 hybrid must require other components or domains involved in the recognition of stop codons. 8

17 MATERIALS AND METHODS Strain. The S. cerevisiae sup45 yeast strain YDB447 (MAT ura3-52 leu2-3,112 ade1-14 lys2 trp1 his3 sup45::his3 [psi ]) and the sup35 yeast strain YDB405 (MAT ura3-52 leu2-3,112 his3 _ 200 trp1-901 ade2-101 suc2-9 sup35::his3 GAL+ mel [psi ])were used in all experiments. Hybrid erf1 gene constructions. For Tetrahymena thermophila erf1, each of the three domains were PCR amplified from a vector (pcr2.1-topo) that contained the full-length T. thermophila erf1 coding region (5). For S. cerevisiae erf1, all domains were PCR amplified using a vector (pukc802) that contained the SUP45 promoter, open-reading frame, and 3 untranslated region. In order to make the new hybrid erf1 constructs, the junction between domain 1 and domain 2 was defined as the hinge region consisting of residues 138 to 141 in T. thermophila erf1, and residues 136 to139 in S. cerevisiae erf1. The junction between domain 2 and domain 3 was defined as the hinge region consisting of residues 272 to 275 in T. thermophila, and residues 270 to 273 in S. cerevisiae. To make the T. thermophila domain 1-2 / S. cerevisiae domain 3 (Tt12/Sc3) hybrid erf1 expression plasmid, domain 2 of T. thermophila was PCR amplified using T. thermophila erf1/pcr2.1-topo. The oligos used for Tetrahymena domain 2 were DB2773 (GGCCAAGCTTTTCTTGAGCGAGTTCAATAGC) which added a HindIII site and DB2778 (GGCCTCGAGACCGACCCTCCTTTTGGTTTC) which added a 9

18 XhoI site. Domain 3 of S. cerevisiae and its 3 untranslated region were PCR amplified using pukc802 as the template. The forward primer DB2766 (GGCCAAGC TTGCCAATGTCAAGTATGTTCAA) added a HindIII site and the reverse primer DB2767 (GGCCGA GCTCGAAGAGAAACTCTCCTTTCC) added a SacI site. In domain 2 of T. thermophila erf1, three in-frame UAA stop codons and 1 in-frame UAG stop codon present at positions 210, 221, 271, and 239 respectively were changed to CAA and CAG codons by site-directed mutagenesis. Domain 2 of T. thermophila along with domain 3 of S. cerevisiae were then cloned into a plasmid consisting of a previously cloned hybrid hemagglutinin (HA)-tagged T. thermophila domain1 / S. cerevisiae domain 2 and 3 under the control of the SUP45 promoter by replacing the second and third domains of the hybrid erf1. This yielded the new SUP45 promoter HA-tagged Tt12/Sc3 erf1 expression plasmid. To make the T. thermophila domain 1, 2, and 3 (Tt123) hybrid erf1, domain 3 of T. thermophila was PCR amplified using T. thermophila erf1/pcr2.1-topo. The forward primer DB2518 (ATGTGACGTCGACATGTACCCATACGACGTCCCAGAC TACGCTGATAACGAGGTTGAAAAAAATATTGAG) added a SalI site and the reverse primer DB2805 (GGCCAAGCTTTTCGGCAGAAAGTTCGATAGC) added a HindIII site. In domain 2 of Tetrahymena erf1, three UAA stop codons at positions 281, 309, and 339 were converted back to CAA codons. The 3 untranslated region from S. cerevisiae was PCR amplified from pukc802. Both fragments were cloned into the previous Tt12/Sc3 erf1 by replacing the third domain, yielding the new SUP45 promoter HA-tagged Tt123 erf1 expression plasmid. 10

19 To make the S. cerevisiae domain 1 and 2 / T. thermophila domain 3 (Sc12/Tt3) hybrid erf1, domains 1 and 2 from S. cerevisiae were PCR amplified together and cloned into the previous Tt123 erf1 expression plasmid. This yielded the new HAtagged Sc12/Tt3 hybrid erf1 expression plasmid. Hybrid erf3 gene constructions. For T. thermophila erf3, a clone containing the coding region, was provided by Larry Klobutcher. For S. cerevisiae erf3, all regions were PCR amplified using a vector (ppw12.1) that contained the SUP45 promoter, openreading frame, and 3 untranslated region. To make the T. thermophila / S. cerevisiae hybrid erf3, the C terminal domain from amino acid residue 248 to the end was PCR amplified with a C-myc tag with DB3062 (GGGCCCGTCGACATGGAACAG AAGCTCATCTCAGAAGAAGACCTCAGGGAAAGAGATTCCGTCAATATCG) and DB3007 (GGGCCCGGATCCTCACACCTTGTAAGGCTTGATCTTCAT) which added a SalI site and a BamHI site, respectively. Ten in-frame stop codons present in the C terminal domain had to be converted back to sense codons. Nine UAA stop codons at positions 326, 423, 427, 488, 490, 517, 567, 577, and 587 were converted back to CAA, and one UAG at position 527 was converted to CAG. The S. cerevisiae SUP35 promoter and 3 untranslated region were both PCR amplified from ppw12.1. All three fragments were then cloned into a yeast expression vector (prs317) to yield the T. thermophila NM erf3 hybrid expression plasmid. Western Blot Analysis. Cultures of YDB447 containing each of the four HAtagged T.thermophila / S. cerevisiae erf1 hybrid constructs were grown in synthetic minimal medium. During the mid-log phase of growth, the cells were harvested, trichloroacetic acid precipitated, and ran on an sodium dodecyl sulfate-polyacrylamide 11

20 gel. The blots were incubated with an HA antibody followed by an incubation with rabbit anti mouse antibodies. A Tom70 was used as a loading control. Cultures were grown of three different strains: 1) YDB447 with pukc802 and HA-Tt 123 erf1, 2) YDB405 with ppw12.1 and Cmyc-Tt NM erf3, and 3) YDB447 with pukc802, HA-Tt123 erf1, and Cmyc-Tt NM erf3. During the mid-log phase of growth, the cells were harvested, trichloroacetic acid precipitated, and ran on a sodium dodecyl sulfate-polyacrylamide gel. The blots were then was incubated with HA and Cmyc antibodies followed by rabbit anti-mouse antibodies. Tom70 and SUP45 antibodies were used as controls. Viability assays. In order to determine if the T. thermophila / S. cerevisiae hybrid erf1 or erf3 proteins could support viability as the only source of erf1 or erf3 in the cell, a plasmid shuffle technique was used. The hybrid erf1 constructs were transformed into a sup45 yeast strain (YDB447) that carried plasmid pukc802 (SUP45-YEp24) to support viability. The erf3 hybrid construct was transformed into a sup35 yeast strain (YDB405) that carried plasmid ppw12.1 (SUP35-YEp24) to support viability. The strains were streaked on plates containing 5-fluoroorotic acid (5-FOA), which inhibits the growth of cells expressing the URA3 gene but allows the growth of cells that lost pukc802 or ppw12.1 ( as long as the erf1 or erf3 hybrid proteins were able to support viability as the only source of erf1 or erf3 in the cell). Dual luciferase readthrough assays. In order to determine how efficiently a stop codon is recognized or read through, a dual luciferase assay was utilized to determine the amount of readthrough at each stop codon (12, 17). The reporters contain a Renilla luciferase gene upstream, a firefly luciferase gene downstream, and the two 12

21 reporters are separated by a readthrough cassette that contains either a stop codon or a sense codon. Firefly luciferase activity is measured and normalized to the levels of Renilla luciferase activity. S. cerevisiae erf1 depletion experiments. The following four yeast strains were used for the depletion experiments: 1) YDB447 / GAL1 promoter HA-S. cerevisiae erf1-ycplac22, 2) YDB447 / GAL1 promoter HA-S. cerevisiae erf1-ycplac22, SUP45 promoter HA-Tt123 erf1-ycplac111, 3) YDB447 / GAL1 promoter HA-S. cerevisiae erf1-ycplac22, SUP45 promoter HA-Tt123 erf1-ycplac111, SUP35 promoter Cmyc-Tt NM erf3-prs317, 4) YDB447/ SUP45 promoter S. cerevisiae erf1-ycplac111. Cultures of the first three stains were grown in synthetic minimal (SM) medium with glucose as the carbon source for several generations. During the midlog stage of growth the cells were harvested, spun down, washed, and resuspended in SM medium with glucose as the carbon source to a cell density that would allow at least six cell doublings without nutrient depletion. Afterwards, the cells were harvested for dual luciferase readthrough assays. The fourth strain was used as a control to determine the wild-type (basal) level of readthrough. 13

22 RESULTS The objective of this study was to determine which domains in Tetrahymena thermophila erf1 are responsible for the variant-code UGA-specific stop codon recognition pattern. In order to determine which of the domains are responsible for recognizing the stop codon, constructs were made that expressed S. cerevisiae and T. thermophila hybrid erf1 proteins. Previous studies have already determined that domain 1 of T. thermophila is not sufficient to recapitulate the variant stop codon recognition observed in the Tetrahymena species. Therefore, new constructs were made containing different domains of T. thermophila and S. cerevisiae erf1. A series of fusion proteins were constructed that contained various Tetrahymena erf1 domains joined to S. cerevisiae erf1 domains. The junction for each hybrid protein in the hinge region between domains 1 and 2 of erf1 corresponds to amino acids in Saccharomyces cerevisiae. The junction for the hinge region between domains 2 and 3 corresponds to amino acids in Saccharomyces cerevisiae erf1. As a control, the full-length S. cerevisiae erf1 was also used in all experiments. In the yeast, Saccharomyces cerevisiae, the SUP45 gene encodes the erf1 protein and the SUP35 gene encodes the erf3 protein. In order to determine if more than domain 1 of Tetrahymena erf1 is necessary for UGA-specific termination, it was first necessary to clone a hybrid erf1 that 14

23 contained both domain 1 and domain 2 from Tetrahymena along with domain 3 from S. cerevisiae. This yielded the new SUP45 promoter hybrid Tt12/Sc3 erf1 (Fig. 6). In T. thermophila erf1, all UAG and UAA codons encode glutamine. Therefore before expressing these constructs in yeast, first it was necessary to convert any reassigned stop codons within Tetrahymena domain 2 back to the universal code. Tetrahymena erf1 domain 2 contained three in-frame UAA stop codons at positions 210, 221, and 271; and 1 in-frame UAG stop codon at position 239. Site directed mutagenesis was used to change these stop codons to either CAA or CAG (both glutamine) codons to allow the fusion proteins to be expressed in the yeast, S. cerevisiae. In order to determine if the hybrid Tt12/Sc3 erf1 protein was being expressed, we carried out a western blot on the new hybrid protein (Fig. 7). The new construct was cloned with an HA tag on the N terminal end. An HA epitope-specific monoclonal antibody was used to detect the wild-type Sc erf1, Tt1/Sc23 erf1, and Tt12/Sc3 erf1. As shown in figure 7, all three proteins were being expressed. In order to assess the function and viability of the hybrid Tt12/Sc3 erf1 protein, we used a yeast strain with a deletion/disruption of the gene that encodes erf1 (sup45 ). The SUP45 gene is essential; therefore the viability of this strain was maintained by expressing the wild-type SUP45 gene from a low-copy-number plasmid that carried a URA3 selectable marker. A plasmid expressing the Tt12/Sc3 hybrid erf1 gene under the control of a SUP45 promoter was transformed in the sup45 yeast strain, and a plasmid shuffle technique was used to determine if the new erf1 fusion protein could support viability as the sole source of erf1 in the cell. In order to assay for viability, the strain 15

24 Tt12/Sc3 HA Tt Domain 1 Tt Domain 2 Sc Domain 3 Figure 6. Schematic showing the T. thermophila domain 1-2/ S. cerevisiae domain 3 (Tt12/Sc3) hybrid erf1 HA-WT HA-Tt1/Sc23 HA-Tt12/Sc3 HA Tom 70 Figure 7. Western blot with an HA antibody showing that each of the three erf1 HAepitope tagged proteins are being expressed. Tom 70 was used as a loading control. 16

25 was streaked on SM medium plates containing glucose and supplemented with 5-FOA, a uracil analogue that allows the growth of only those colonies that have lost the original SUP45 plasmid with the URA3 selectable marker (Fig. 8) (3). As shown in figure 8, the S. cerevisiae erf1, the previous Tt1/Sc23 erf1, and the new Tt12/Sc3 erf1 were all able to support growth as the only source of erf1 in the cell by complementing the sup45. The Tt12/Sc3 hybrid erf1 has more Tetrahymena-like stop codon recognition. Since the Tt12/Sc3 hybrid erf1 protein was able to support viability as the sole source of erf1, this indicated that the hybrid erf1 was able to terminate at all three stop codons, and that UGA-specific termination had not been completely restored even when domain 2 of Tetrahymena was provided with domain 1 of Tetrahymena. However, in order to accurately determine how efficiently each stop codon is recognized, a dual luciferase readthrough reporter system was used. This system is used to determine the amount of readthrough at each stop codon, and it has been used to measure the efficiency of stop codon recognition in several previous studies (24,25). In order to utilize this assay, reporter plasmids containing either a stop or a sense codon in the dual luciferase construct, were transformed into the yeast strain containing the wild-type S. cerevisiae erf1, the Tt1/Sc23, and the Tt12/Sc3 erf1 as the sole source of erf1 (Fig. 9A). The level of readthrough at each stop codon was determined by measuring the firefly luciferase activity, which was then normalized to the Renilla luciferase activity. We found that the Tt12/Sc3 erf1 readthrough at the UGA stop codon remained relatively efficient (within 1.8 fold of WT yeast erf1). However, both UAG and UAA termination were considerably less efficient, UAG readthrough increased 19.8 fold relative to WT and UAA readthrough increased 11.8 fold relative to WT (Fig. 9B). Since 17

26 Tt D1/Sc D2-3 erf1 Sc erf1 Tt D1-2/ Sc D3 erf1 Vector Alone Figure 8. Plasmid shuffle to test the viability of the new Tt12/Sc3 hybrid erf1 protein. 18

27 B % Readthrough UGA UAG UAA UGA UAG UAA UGA UAG UAA WT TtD1/ScD2-3 TtD1-2/ScD3 Figure 9. A) Luciferase reporter plasmids, containing either a stop or sense codon, used to monitor translation termination. B) Readthrough of stop codons in cells expressing WT erf1, Tt1/Sc23 erf1, or Tt12/Sc3 erf1 proteins. 19

28 the new Tt12/Sc3 erf1 showed a decrease in readthrough at UGA and an increase in UAG and UAA relative to the previous Tt1/Sc23 erf1, it suggests that domain 2 of Tetrahymena erf1 specifically reduces the ability of domain 1 to recognize the UAG and UAA stop codons, and that the new Tt12/Sc3 erf1 is more Tetrahymena-like. The Tt3/Sc12 hybrid erf1 has increased UGA-specific recognition. In order to determine if domain 3 of Tetrahymena erf1 contributes to its UGA-specific termination, it was necessary to make a new construct. The new hybrid erf1 contained both domain 1 and domain 2 from S. cerevisiae and domain 3 from Tetrahymena. This yielded the SUP45 promoter hybrid Tt3/Sc12 erf1 (Fig. 10). The expression of the Tt3/Sc12 erf1 was confirmed by western blot (Fig. 11) In order to assess the function and viability of the hybrid Sc12/Tt3 erf1 protein, we transformed the new construct in the sup45 strain and performed a plasmid shuffle assay. After streaking the new strain on 5-FOA, we found that the new Tt3/Sc12 hybrid erf1 was able to support viability as the only source of erf1 in the cell (Fig. 12). In order to determine the exact levels of readthrough at each stop codon, we assayed the new strain with the dual luciferase readthrough assay. We found that the readthrough at the UGA stop codon remained efficient. However, the readthrough at the UAG and UAA stop codons was considerably less efficient relative to WT (Fig. 13). Since the new Tt3/Sc12 erf1 shows increases in UAG and UAA stop codon recognition, it suggests that domain 3 of Tetrahymena erf1 also specifically reduces the ability of domain 1 to recognize the UAG and UAA stop codons. It is therefore concluded that both domain 2 and domain 3 of Tetrahymena erf1 cause the erf1 to become more Tetrahymena-like. 20

29 Sc12/Tt3 HA Sc Domain 1 Sc Domain 2 Tt Domain 3 Sc 3 UTR Figure 10. Schematic showing the S. cerevisiae domain 1-2/T. thermophila domain 3 (Sc12/Tt3) erf1. HA-WT HA-Sc12/Tt3 HA Figure 11. Western with an HA antibody showing that the Tt3/Sc12 erf1 protein was being expressed Vector Only WT erf1 Sc12/Tt3 erf1 Figure 12. Plasmid shuffle to test the viability of the Sc12/Tt3 erf1 protein. 21

30 16 14 % Readthrough erf1: UGA UAG UAA UGA UAG UAA UGA UAG UAA UGA UAG UAA WT Tt1/Sc23 Tt12/Sc3 Sc12/Tt3 Figure 13. Percent readthrough at each of the three stop codons from WT erf1, Tt1/Sc23 erf1, Tt12/Sc3 erf1, and Tt3/Sc12 erf1 22

31 The Tt123 hybrid erf1 does not function in yeast cells. To determine if UGAspecific recognition could be completely restored by adding even more of Tetrahymena erf1, a new fusion protein was designed that consisted of all three domains of T. thermophila erf1 (referred to as Tt123 erf1) (Fig. 14). Before expressing the fulllength construct in yeast, four in-frame stop codons in domain 3 of Tetrahymena had to be converted back to universal code glutamine codons. This new construct was under the control of the SUP45 promoter and it also had the SUP45 3 untranslated region. This entire construct was cloned into a plasmid with a leucine selectable marker (YCplac111). The new hybrid protein was subjected to a viability assay as well as western analysis. The new Tt123 was cloned with an HA tag on its 3 end. In order to determine if this new protein was expressed, a western blot was carried out using the HA monoclonal antibody (Fig. 15). A Tom70 antibody was used as a loading control. From the western blot, we concluded that the Tt123 erf1 was being expressed and we next subjected this strain to a plasmid shuffle viability assay. After streaking the strain carrying the new Tt123 erf1 on 5-FOA plates, we discovered that the Tt123 erf1 was not able to support viability as the only source of erf1 in the cell (Fig. 16). Therefore, in order to more accurately determine the levels of readthrough in the Tt123 erf1 strain, we set up a dual expression system where S. cerevisiae erf1 was expressed from the regulated GAL1 promoter while the Tt123 erf1 was expressed from the constitutive SUP45 promoter. In this system, the WT S. cerevisiae expression was initially maintained by growing the cells in synthetic minimal medium with galactose as the carbon source. The cells were then shifted to a medium with glucose as the carbon source in order to inhibit the 23

32 Tt12/Sc3 HA Tt Domain 1 Tt Domain 2 Tt Domain 3 Sc 3 UTR Figure 14. Schematic showing the T. thermophila domain 1-2-3/S. cerevisiae 3 UTR (Tt123) erf1. Stars indicate stop codons mutated back to glutamine HA-WT HA- Tt1/Sc23 HA- Tt12/Sc3 HA-Tt123 HA Tom 70 Figure 15. Western with an HA antibody showing that the Tt123 erf1 was being expressed. Tom 70 was used as a loading control. 24

33 Tt D1/Sc D2-3 erf1 Sc erf1 Tt D1-2/ Sc D3 erf1 Vector Alone Tt D1-2-3 erf1 Figure 16. Plasmid shuffle to test the viability of the Tt123 erf1 protein. 25

34 expression from the GAL1 promoter-driven WT erf1. The cells were grown in the glucose medium for several generations in order to dilute out the preexisting S. cerevisiae erf1, while the Tt123 erf1 was continuously expressed (Fig. 17). Two control strains were used, one that only carried the WT erf1 under GAL1 promoter control, and one that carried only the WT erf1 under SUP45 promoter control. Using this system, we were able to assay the level of readthrough at each stop codon after the carbon source shift in strains that expressed essentially S. cerevisiae erf1, no erf1, or Tt123 erf1. The results showed that readthrough at the UGA, UAG, and UAA stop codons in strains expressing Tt123 erf1 was similar to having no erf1 in the cell (Fig. 18). This indicated that the Tt123 erf1 was incapable of mediating translation termination at any of the three stop codons. Analysis in the presence of Tetrahymena erf3. Our results showed that the new full-length Tt123 erf1 was being expressed. However the readthrough analysis suggests that it was functionally inactive. It has been shown in a previous study that the GTPase activity of S. cerevisiae erf3 plays a significant role in stop codon recognition. This led us to hypothesize that Tetrahymena s class II release factor, erf3, may be necessary in order to regain the UGA-specific function of the Tetrahymena erf1 protein. A search of the Tetrahymena genome database led us to identify a homologue of erf3, encoded by the open reading frame designated 11m00545 (29). The encoded protein from this particular sequence contains significant homology to S. cerevisiae and human erf3 over the entire amino acid sequence. The C terminal half of the encoded Tetrahymena protein, which includes the GTPase domain, showed 42% sequence identity (55% similarity) to S. cerevisiae erf3 and 45% sequence identity (56% similarity) to 26

35 SUP45 pgal Sc erf1 LUC reporter psup45 Tt123 erf1 Galactose medium Carbon source shift SUP45 psup45 pgal Tt123 Sc erf1 erf1 OFF LUC reporter Glucose medium Figure 17. Schematic showing sup45 strains undergoing a carbon source shift in order to shut off the GAL1 promoter and deplete out the WT erf1 27

36 16 14 % Readthrough psup45 Sc erf1 pgal Sc erf1 psup45 Tt 123 erf1 Figure 18. Cultures with the indicated plasmid were grown in SM medium with galactose as the carbon source for several generations. Cells then shifted to glucose to inhibit GAL1 promoters and WT was diluted out by growing for at least 6 doublings 28

37 human erf3 proteins. Based on these amino acid sequence alignments, we concluded that the 11m00545 gene is a likely candidate to encode Tetrahymena erf3. In order to see whether the presence of Tetrahymena s erf3 could restore UGA specific translation termination, it was necessary to clone Tetrahymena s erf3, together with S. cerevisiae s erf3 (SUP35) 3 untranslated region into a plasmid under the control of the SUP35 promoter. This new Tetrahymena erf3 contains only the carboxyl terminal domain, as this has been shown to be the only domain necessary for efficient translation termination in yeast and mammalian systems (Fig. 19) (30). Within the C terminal region of Tetrahymena erf3, there were 10 in-frame stop codons that had to be converted to glutamine codons before expressing the construct in S. cerevisiae. This new Tetrahymena hybrid erf3 protein (Tt NM erf3) was transformed in a SUP45 strain that contained the Tt123 erf1 in order to see if the presence of Tetrahymena s erf3 is enough to restore UGA-specific termination (Fig. 20). Before carrying out the functional analyses, a western blot was done to show that the new Tt NM erf3 was expressed (Fig. 21). The Tt NM erf3 was cloned with a C- myc epitope tag on its 5 end. Following the western blot analysis there were decreased levels of the SUP45 protein in the sup35 strain, and we are not sure why we are seeing repression. Following this experiment, a carbon source shift erf1 depletion experiment was done as described above in order to determine the stop codon recognition in cells expressing Tt123 erf1 and Tt NM erf3. The results of the luciferase assay showed that there was still high levels of readthrough at the UGA, UAA, and UAG stop codons. The readthrough levels were similar to having no erf1 in the cell, suggesting that the Tt123 erf1 is still non-functional even in the presence of Tt NM erf3 (Fig. 22). 29

38 Tt NM erf3 Psup35 C- myc C-terminal domain Sc 3 UTR Tt erf3 Figure 19. Schematic showing the SUP35 promoter driven Cmyc-Tetrahymena C- terminal domain erf3 (Tt NM erf3) and S. cerevisiae 3 UTR. 30

39 pgal Sc erf1 LUC reporter TRP psup45 Tt123 erf1 LEU YDB447 (sup45 ) URA3 psup35 Tt NM erf3 LYS Figure 20. Schematic of expression plasmids needed to determine if Tetrahymena s erf3 can restore UGA-specific termination in a readthrough assay. 31

40 sup45 HA-Tt123 erf1 sup35 Cmyc-Tt NM erf3 sup45 HA-Tt123 erf1+ Cmyc-Tt NM erf3 Cmyc (Tt erf3) HA (Tt erf1) SUP45 (Sc erf1) Tom70 (control) Figure 21. Western blot analysis of Tetrahymena and S. cerevisiae hybrid erf1 and erf3 proteins. SUP45 and Tom70 antibodies were used as loading controls. 32

41 % Readthrough UGA UAA UAG UGA UAA UAG UGA UAA UAG UGA UAA UAG psup45 pgal psup45 psup45 Sc erf1 Sc erf1 Tt123 erf1 Tt123 erf1 Tt NM erf3 Figure 22. Percent readthrough of the Tt123 erf1 Tt NM erf3 strain following galactose to glucose shift. 33

42 DISCUSSION Previously it was thought that domain 1 of the class I release factor, erf1, was solely responsible for the recognition of stop codons in eukaryotes. In a previous study, ciliated organisms were used as a way to study stop codon recognition patterns, by fusing domain 1 of either Tetrahymena thermophila or Euplotes octocarinatus erf1 to domains 2 and 3 of S. cerevisiae erf1 (25). Since these divergent code organisms no longer recognize all 3 stop codons, this was one approach to determine if domain 1 is responsible for stop codon recognition. It was found that Euplotes hybrid erf1 was sufficient to recapitulate its UAA and UAG-only recognition pattern, thereby confirming that domain 1 is sufficient to recapitulate Euplotes stop codon recognition. However, the Tetrahymena hybrid erf1 was still able to recognize all three stop codons, and domain 1 was not sufficient to restore the UGA-specific recognition pattern of the Tetrahymena species. This has led us to hypothesize that other erf1 domains or other factors may be involved in the recognition of stop codons by Tetrahymena. In the current study, we tested this hypothesis by making more fusion proteins that included more domains of Tetrahymena s erf1. The first fusion protein consisted of domains 1 and 2 from Tetrahymena and domain 3 from S. cerevisiae (Tt12/Sc3 erf1); and the second fusion protein contained domain 3 of Tetrahymena and domains 1 and 2 from S. cerevisiae (Tt3/Sc12). Finally a third construct consisted of all three domains of Tetrahymena s erf1 (Tt123 erf1). We found that the Tt12/Sc3 and Tt3/Sc12 hybrid erf1s were able 34

43 to maintain viability as the sole source of erf1 in the cell and recognize all three stop codons in a dual luciferase readthrough assay. However, the amount of readthrough at UGA decreased relative to the previous Tetrahymena domain 1 hybrid erf1, and the amount of readthrough at UAA and UAG increased relative to the Tt1/Sc23 erf1. This suggested that the addition of Tetrahymena domain 2 or domain 3 was causing stop codon recognition to be more Tetrahymena-like by becoming more UGA-specific. We next hypothesized that the complete Tetrahymena erf1 would lead to even higher increases in UAG and UAA readthrough causing the strain to be completely UGA-specific. After readthrough analysis it was determined that the new Tt123 erf1 was nonfunctional as it unable to terminate at any of the three stop codons. We then hypothesized that this failure was to the inability of Tetrahymena s erf1 domain 3 to interact with S. cerevisiae erf3. If correct, this predicted that the addition of Tetrahymena erf3 could restore termination at the UGA stop codon. In order to determine if this was the case, we cloned and expressed the C-terminal domain of Tetrahymena erf3 (Tt NM erf3) in a yeast strain that also expressed the Tt123 erf1 to see if UGA-specificity could be restored. Contrary to our hypothesis, the presence of Tetrahymena s erf3 did not alter the readthrough pattern of Tt123 erf1. There are several possibilities that could explain why UGA-specific termination was not observed in yeast expressing both the full-length Tetrahymena erf1 along with Tetrahymena erf3. First, it is plausible that the endogenous S. cerevisiae erf3 is outcompeting Tetrahymena erf3 by binding to the third domain of Tetrahymena erf1, and hindering Tetrahymena erf3 function. In order to directly test this hypothesis it will be necessary to repeat this experiment in a sup45 and sup35 double knockout yeast strain. 35

44 Second, it is also possible that the Tt123 erf1 can not interact with yeast ribosomes in a productive manner. Finally, it is possible that the open reading frame with homology to erf3 does not encode the Tetrahymena erf3 protein. In order to further understand the mechanism of UGA-specific recognition and termination by Tetrahymena thermophila erf1, further investigation will need to be carried out. The future directions of this project will consist of making new hybrid proteins with different combinations of the three domains of erf1. The future constructs will be a Tetrahymena domain 2/S.cereisiae domain 1and 3 erf1, a Tetrahymena domain 1 and 3/S.cerevisiae domain 2 erf1, and a Tetrahymena domain 2 and 3/S. cerevisiae domain 1 erf1. Since it has also been concluded that UGA-specific organisms diverged separately by a different mechanism than UAA and UAG-specific organisms, another future direction of this study would be to look at other UGA-specific organisms and their mechanisms of acquiring UGA-specificity Little is known about the mechanisms of translation termination and the components involved. Further research will not only expand the knowledge of what is known but it may also be useful as therapeutic targets for diseases caused by premature stop codons (1). Premature stop codons or nonsense mutations within the coding region of a gene cause translation to terminate early and result in a truncated, nonfunctional. These premature stop codons are the causes for several genetic diseases including cystic fibrosis (16). Five percent of mutations in cystic fibrosis are caused by nonsense mutations within the CFTR gene. Understanding how Tetrahymena may have diverged from the standard genetic code may provide further insight on the mechanism of 36

45 translation termination and provide useful information to be used for treating diseases caused by premature translation termination. 37

46 REFERENCES 1. Atkinson, J., and R. Martin Mutations to nonsense codons in human genetic disease: implications for gene therapy by nonsense suppressor trnas. Nucleic Acids Res 22: Bertram, G., H. A. Bell, D. W. Ritchie, G. Fullerton, and I. Stansfield Terminating eukaryote translation: domain 1 of release factor erf1 functions in stop codon recognition. RNA 6: Boeke, J. D., F. LaCroute, and G. R. Fink A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol Gen Genet 197: Chai, B. F., W. Wang, and A. H. Liang Expression, characterization and immunolocalization of translation termination factor erf3 in the ciliate Euplotes octocarinatus. Res Microbiol 157: Chilcoat, N. D., N. C. Elde, and A. P. Turkewitz An antisense approach to phenotype-based gene cloning in Tetrahymena. Proc Natl Acad Sci U S A 98: Cosson, B., A. Couturier, S. Chabelskaya, D. Kiktev, S. Inge-Vechtomov, M. Philippe, and G. Zhouravleva Poly(A)-binding protein acts in translation 38

47 termination via eukaryotic release factor 3 interaction and does not influence [PSI(+)] propagation. Mol Cell Biol 22: Ebihara, K., and Y. Nakamura C-terminal interaction of translational release factors erf1 and erf3 of fission yeast: G-domain uncoupled binding and the role of conserved amino acids. RNA 5: Eurwilaichitr, L., F. M. Graves, I. Stansfield, and M. F. Tuite The C- terminus of erf1 defines a functionally important domain for translation termination in Saccharomyces cerevisiae. Mol Microbiol 32: Frolova, L. Y., T. I. Merkulova, and L. L. Kisselev Translation termination in eukaryotes: polypeptide release factor erf1 is composed of functionally and structurally distinct domains. RNA 6: Frolova, L. Y., J. L. Simonsen, T. I. Merkulova, D. Y. Litvinov, P. M. Martensen, V. O. Rechinsky, J. H. Camonis, L. L. Kisselev, and J. Justesen Functional expression of eukaryotic polypeptide chain release factors 1 and 3 by means of baculovirus/insect cells and complex formation between the factors. Eur J Biochem 256: Frolova, L. Y., R. Y. Tsivkovskii, G. F. Sivolobova, N. Y. Oparina, O. I. Serpinsky, V. M. Blinov, S. I. Tatkov, and L. L. Kisselev Mutations in the highly conserved GGQ motif of class 1 polypeptide release factors abolish ability of human erf1 to trigger peptidyl-trna hydrolysis. RNA 5: Grentzmann, G., J. A. Ingram, P. J. Kelly, R. F. Gesteland, and J. F. Atkins A dual-luciferase reporter system for studying recoding signals. RNA 4:

48 13. Inagaki, Y., and W. F. Doolittle Class I release factors in ciliates with variant genetic codes. Nucleic Acids Res 29: Ito, K., L. Frolova, A. Seit-Nebi, A. Karamyshev, L. Kisselev, and Y. Nakamura Omnipotent decoding potential resides in eukaryotic translation termination factor erf1 of variant-code organisms and is modulated by the interactions of amino acid sequences within domain 1. Proc Natl Acad Sci U S A 99: Karamyshev, A. L., K. Ito, and Y. Nakamura Polypeptide release factor erf1 from Tetrahymena thermophila: cdna cloning, purification and complex formation with yeast erf3. FEBS Lett 457: Keeling, K. M., and D. M. Bedwell Pharmacological suppression of premature stop mutations that cause genetic diseases. Current Pharmacogenomics 3: Keeling, K. M., J. Lanier, M. Du, J. Salas-Marco, L. Gao, A. Kaenjak-Angeletti, and D. M. Bedwell Leaky termination at premature stop codons antagonizes nonsense-mediated mrna decay in S. cerevisiae. RNA 10: Kisselev, L. L., and R. H. Buckingham Translational termination comes of age. Trends Biochem Sci 25: Kong, C., K. Ito, M. A. Walsh, M. Wada, Y. Liu, S. Kumar, D. Barford, Y. Nakamura, and H. Song Crystal Structure and Functional Analysis of the Eukaryotic Class II Release Factor erf3 from S. pombe. Mol Cell 14: Kushnirov, V. V., M. D. Ter-Avanesyan, M. V. Telckov, A. P. Surguchov, V. N. Smirnov, and S. G. Inge-Vechtomov Nucleotide sequence of the SUP2 (SUP35) gene of Saccharomyces cerevisiae. Gene 66:

49 21. Liang, H., J. Y. Wong, Q. Bao, A. R. Cavalcanti, and L. F. Landweber Decoding the Decoding Region: Analysis of Eukaryotic Release Factor (erf1) Stop Codon-Binding Residues. J Mol Evol 60: Merkulova, T. I., L. Y. Frolova, M. Lazar, J. Camonis, and L. L. Kisselev C-terminal domains of human translation termination factors erf1 and erf3 mediate their in vivo interaction. FEBS Lett 443: Moreira, D., S. Kervestin, O. Jean-Jean, and H. Philippe Evolution of eukaryotic translation elongation and termination factors: variations of evolutionary rate and genetic code deviations. Mol Biol Evol 19: Salas-Marco, J., and D. M. Bedwell GTP Hydrolysis by erf3 Facilitates Stop Codon Decoding during Eukaryotic Translation Termination. Mol Cell Biol 24: Salas-Marco, J., H. Fan-Minogue, A. K. Kallmeyer, L. A. Klobutcher, P. J. Farabaugh, and D. M. Bedwell Distinct paths to stop codon reassignment by the variant-code organisms Tetrahymena and Euplotes. Mol Cell Biol 26: Seit-Nebi, A., L. Frolova, and L. Kisselev Conversion of omnipotent translation termination factor erf1 into ciliate-like UGA-only unipotent erf1. EMBO Rep 3: Song, H., P. Mugnier, A. K. Das, H. M. Webb, D. R. Evans, M. F. Tuite, B. A. Hemmings, and D. Barford The crystal structure of human eukaryotic release factor erf1-- mechanism of stop codon recognition and peptidyl-trna hydrolysis. Cell 100:

50 28. Stansfield, I., K. M. Jones, V. V. Kushnirov, A. R. Dagkesamanskaya, A. I. Poznyakovski, S. V. Paushkin, C. R. Nierras, B. S. Cox, M. D. Ter-Avanesyan, and M. F. Tuite The products of the SUP45 (erf1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae. EMBO J 14: Stover, N. A., C. J. Krieger, G. Binkley, Q. Dong, D. G. Fisk, R. Nash, A. Sethuraman, S. Weng, and J. M. Cherry Tetrahymena Genome Database (TGD): a new genomic resource for Tetrahymena thermophila research. Nucleic Acids Res 34:D Ter-Avanesyan, M. D., V. V. Kushnirov, A. R. Dagkesamanskaya, S. A. Didichenko, Y. O. Chernoff, S. G. Inge-Vechtomov, and V. N. Smirnov Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two nonoverlapping functional regions in the encoded protein. Mol Microbiol 7: Zhouravleva, G., L. Frolova, X. Le Goff, R. Le Guellec, S. Inge-Vechtomov, L. Kisselev, and M. Philippe Termination of translation in eukaryotes is governed by two interacting polypeptide chain release factors, erf1 and erf3. EMBO J 14: