Ben Hecht Columbia River Inter-Tribal Fish Commission March 19, 2013

Size: px
Start display at page:

Download "Ben Hecht Columbia River Inter-Tribal Fish Commission March 19, 2013"

Transcription

1 The Genetic Basis for the Propensity to Migrate in a Sequestered Population of Rainbow and Steelhead Trout Ben Hecht Columbia River Inter-Tribal Fish Commission March 19, 2013

2 Migration Cultural, ecological, and economic benefits and services Migratory species declining globally Migratory species purported to have common syndrome (Dingle 2006)

3 Anadromy Oncorhynchus mykiss smoltification Freshwater Saltwater

4 Smoltification Parr Environmental cues Physiology Morphology Behavior Smolt Genetic component

5 Objectives Identify regions of the genome associated with migration in a wild population of O.mykiss which maintains connection to ocean in a wild population of O.mykiss sequestered for last 50 years behind barrier dam Are the same genetic regions associated with migration in both populations? Is migration a derived trait? Is migration locally adapted?

6 Genetics of Anadromy Genome-Wide Association Study (GWAS) Samples Wild populations of segregating individuals Genetic Markers Thousands distributed throughout the genome Statistics Marker/Trait associations

7 Samples Washington Idaho Columbia R. Oregon M. F. Teanaway R. N. F. Teanaway R. Brownlee Dam (est. 1958) Teanaway River WDFW Holecek et al. (2012) Barrier Dam

8 Samples Yakima River, WA Electrofishing by WDFW PIT tagged in Spring 2008 recovered in Summer/Fall Resident RBT = mature w/ gametes Smolt = PIT array detection at downstream dam Upper Mann Creek, ID Screw trap (March-June 2009) Parr = fish >1 yo with gametes and/or parr marks Smolts = silver fish >1 yo w/out parr marks

9 Samples Smolts Residents Total Yakima R Upper Mann Cr Total Smolts Residents Total Female Male Total

10 Genetic Markers Restriction-site Associated DNA (RAD) tag sequencing Thousands of markers distributed throughout the genome OmyY1 molecular sex marker

11 Genetic Markers 12,073 Polymorphic RAD-tag SNPs 8,219 (68%) SNPs aligned perfectly to loci from Miller et al. (2012) and Hecht et al. (2012) 1,148 (14%) SNPs had been assigned to a linkage group.

12 Statistics Phenotype No Association A/A A/T T/T Genotype

13 Statistics Global GWAS Yakima River GWAS Upper Mann Creek GWAS GLM y = XX + Sα + QQ + e Life-History = SSS + sss + SSSSSSSSS + e MLM y = XX + Sα + QQ + ZZ + e Life-History = SSS + sss + SSSSSSSSS + kkkkkkk + e

14 Results - GWAS Population # Loci # Sig. Loci GLM # Sig. Loci MLM Global 5, Yakima River 4, Upper Mann Creek 6, loci detected overall 267 loci detected in Global analyses 123 loci detected in Yakima River analyses 157 loci detected in Upper Mann Creek analyses

15 Results - Marker Overlap Significant Loci

16 Omy02 Omy R R12608 OMM R39115 Omy1INRA R08156 R14304 R38491 R01652 R02962 R15531 R21685 R23663 R21702 R29254 OMM1131 R R29399 R30558 R35027 R15247 R02310 R35562 OMM1438 R24084 Nichols et al. (2008) Martínez et al. (2011) Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM UMC MLM Linkage map adapted from Miller et al. (2012)

17 Omy11 Omy R28660 R07406 R02275 R28384 R29969 R36274 R29914 OMM3099 R07285 R21488 R23618 R27894 R29567 R30555 R14519 R32458 R36340 R18827 OMM1333 OMM5018 R30426 R01365 R03000 R R38774 R17449 R00232 R12248 OMM1656 R37119 R05093 R29412 Martínez et al. (2011) 38.1 OMM5219 Le Bras et al. (2011) Hecht et al. (2012) R12078 R28590 Nichols et al. (2008) Wringe et al. (2010) Le Bras et al. (2011) Martínez et al. (2011) Hecht et al. (2012) R05448 Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM UMC MLM Linkage map adapted from Miller et al. (2012)

18 Omy18 Omy R08648 R17025 R30518 R31824 OMM5297 R08096 R22726 R05140 R R34214 R24327 OMM5138 R12113 R12951 R30168 Nichols et al. (2008) R27950 R Martínez et al. R17895 (2011) R28704 Hecht et al. (2012) R R19422 Le Bras et al. (2011) R02446 BX Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM UMC MLM Linkage map adapted from Miller et al. (2012)

19 Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM Linkage map adapted from Miller et al. (2012) UMC MLM

20 Conclusions Identified 504 loci associated with the propensity to migrate in two wild populations of O.mykiss Several mapped loci localize to QTL regions previously detected suggesting some conserved mechanisms between populations Some loci are unique to each population, suggesting locally adapted mechanisms

21 Conclusions UMC continues to exhibit genetic variation for propensity to migrate despite 50 years sequestration above a barrier dam Does this mean if passage to the ocean is restored anadromy in Upper Mann Creek would be reestablished???

22

23 Thank You Contact: Ben Hecht Scott M. Blankenship Cherril Bowman Dennis Scarnecchia Rob Lyon IBEST CRC Alex Lipka Garrett McKinney Mike Miller Doug Turnbull GCF Megan Moore Travis Jacobson Andrew Matala

24 Results - Structure K = 4 MFT NFT TAN UMC-R UMC-S Yakima River Upper Mann Creek Estimated using programs STRUCTURE and CLUMPP using a subset of 1,000 SNPs with 100% genotype frequency and MAF Figure generated by program DISTRUCT.

25 RADseq DNA CCTGCAGG CCTGCAGG CCTGCAGG CCTGCAGG sbfi digestion P1 Ligation Sonication Size Select P2 Ligation PCR

26 Genotyping by sequencing L1 L2 L3 L4 L5 L6 L7 ID001 LL A/A, LL C/G AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG AATTCCTGCAGGAATCGTGGTAGCTGATCGATCG AATTCCTGCAGGAATCGTGGTAGCTGATCGATCG AATTCCTGCAGGAATCGTGGTAGCTGATCGATCG AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG ID002 LL T/T, LL C/G GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG 26

27 Results - RAD 5 RAD libraries barcoded samples per library Avg. 185M raw & 123M QF reads per library 189 total individuals sequenced Avg. 2.8M QF reads per individual 12,073 polymorphic loci detected RAD Seq Reads Individual QF Reads

28 Linkage group assignment of significant loci Linkage group Global Yakima Upper Mann Creek GLM MLM GLM MLM GLM MLM Total OmySex 2 2 Omy Omy Omy Omy Omy5 0 Omy Omy Omy Omy9 1 1 Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy Omy26 0 Omy Omy Total Linkage group assignment based on alignment of RAD markers to Miller et al. (2012) and Hecht et al. (2012)

Columbia River Basin Steelhead Kelt Reconditioning Physiology Research

Columbia River Basin Steelhead Kelt Reconditioning Physiology Research Columbia River Basin Steelhead Kelt Reconditioning Physiology Research Andy Pierce 1, 2, Doug Hatch 2, Dave Fast 3, Scott Everett 4, Matt Abrahamse 3, Laura Jenkins 1, Neil Graham 2, Lea Medeiros 1, Jim

More information

The Genetic Architecture of Juvenile Migration in Rainbow Trout (Oncorhynchus mykiss)

The Genetic Architecture of Juvenile Migration in Rainbow Trout (Oncorhynchus mykiss) Purdue University Purdue e-pubs Open Access Dissertations Theses and Dissertations Fall 2013 The Genetic Architecture of Juvenile Migration in Rainbow Trout (Oncorhynchus mykiss) Benjamin Charles Hecht

More information

Life-history diversity and ecology of O. mykiss in a coastal California watershed

Life-history diversity and ecology of O. mykiss in a coastal California watershed Life-history diversity and ecology of O. mykiss in a coastal California watershed Jeremy Monroe Thomas Williams, Dave Rundio, and Steve Lindley NOAA National Marine Fisheries Service, Southwest Fisheries

More information

Fei Lu. Post doctoral Associate Cornell University

Fei Lu. Post doctoral Associate Cornell University Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.

More information

Evidence for Genetic Adaptation to Captivity and a Potential Mechanism to Account for Domestication in Hatchery- Reared Steelhead

Evidence for Genetic Adaptation to Captivity and a Potential Mechanism to Account for Domestication in Hatchery- Reared Steelhead Evidence for Genetic Adaptation to Captivity and a Potential Mechanism to Account for Domestication in Hatchery- Reared Steelhead Neil Thompson neil.thompson@noaa.gov 1. F1 vs. natural-origin RRS Christie

More information

The genetic and evolutionary basis of summer run timing in coastal steelhead. Michael Miller

The genetic and evolutionary basis of summer run timing in coastal steelhead. Michael Miller The genetic and evolutionary basis of summer run timing in coastal steelhead Michael Miller Summer run timing (aka premature migration) likely evolved in response to seasonal variation in water fow and

More information

Steelhead Hatchery Wild Introgression in Puget Sound, WA

Steelhead Hatchery Wild Introgression in Puget Sound, WA Steelhead Hatchery Wild Introgression in Puget Sound, WA Kenneth I. Warheit WDFW, Olympia WA 2016 Pacific Coast Steelhead Management Meeting ASILOMAR CONFERENCE GROUNDS PACIFIC GROVE, CALIFORNIA MARCH

More information

Detecting historical population structure among highly impacted White Sturgeon populations of the Upper Columbia River

Detecting historical population structure among highly impacted White Sturgeon populations of the Upper Columbia River Detecting historical population structure among highly impacted White Sturgeon populations of the Upper Columbia River Dr. R. John Nelson University of Victoria Victoria, British Columbia, Canada Acispenserformidae

More information

Reproduction & Recovery - Energetics

Reproduction & Recovery - Energetics Reproduction & Recovery - Energetics Iteroparity & Semelparity Iteroparity- (perennial) reproduces more than once. Semelparity- (annual) reproduces only once. 1 Crespi, B.J. and R. Teo. 2002. Comparative

More information

Lecture WS Evolutionary Genetics Part I 1

Lecture WS Evolutionary Genetics Part I 1 Quantitative genetics Quantitative genetics is the study of the inheritance of quantitative/continuous phenotypic traits, like human height and body size, grain colour in winter wheat or beak depth in

More information

Genotype Imputation. Biostatistics 666

Genotype Imputation. Biostatistics 666 Genotype Imputation Biostatistics 666 Previously Hidden Markov Models for Relative Pairs Linkage analysis using affected sibling pairs Estimation of pairwise relationships Identity-by-Descent Relatives

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture16: Population structure and logistic regression I Jason Mezey jgm45@cornell.edu April 11, 2017 (T) 8:40-9:55 Announcements I April

More information

Juvenile physiology, performance and migration behavior of triploid summer steelhead

Juvenile physiology, performance and migration behavior of triploid summer steelhead Juvenile physiology, performance and migration behavior of triploid summer steelhead Marc A. Johnson 1 Thomas A. Friesen 1, Andrew H. Dittman 2, Paul M. Olmsted 1, David L. G. Noakes 3, 4, Ryan B. Couture

More information

Detecting Introgressive Hybridization between Segregated Hatchery and Wild Populations

Detecting Introgressive Hybridization between Segregated Hatchery and Wild Populations Detecting Introgressive Hybridization between Segregated Hatchery and Wild Populations Part II Kenneth I. Warheit 2014 Pacific Coast Steelhead Management Meeting Skamania Lodge, WA March 18, 2014 Prolog

More information

Thermal and ph tolerance of farmed, wild and first generation farmed-wild hybrid salmon (Salmo salar)

Thermal and ph tolerance of farmed, wild and first generation farmed-wild hybrid salmon (Salmo salar) Thermal and ph tolerance of farmed, wild and first generation farmed-wild hybrid salmon (Salmo salar) D. Hamoutene, L. Lush, I. Costa, K. Burt, J. Perez-Casanova, J. Caines Fisheries and Oceans Canada,

More information

The Mac & Jack study: Size and domestication effects on minijack rates of summer Chinook salmon from McCall Fish Hatchery, Idaho.

The Mac & Jack study: Size and domestication effects on minijack rates of summer Chinook salmon from McCall Fish Hatchery, Idaho. The Mac & Jack study: Size and domestication effects on minijack rates of summer Chinook salmon from McCall Fish Hatchery, Idaho. Deb Harstad 1 *, Don Larsen 1, Abby Fuhrman 1, Dina Spangenberg 1, Chris

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu February 12, 2015 Lecture 3:

More information

Natural Selection results in increase in one (or more) genotypes relative to other genotypes.

Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Fitness - The fitness of a genotype is the average per capita lifetime contribution of individuals of that

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture 18: Introduction to covariates, the QQ plot, and population structure II + minimal GWAS steps Jason Mezey jgm45@cornell.edu April

More information

9 Genetic diversity and adaptation Support. AQA Biology. Genetic diversity and adaptation. Specification reference. Learning objectives.

9 Genetic diversity and adaptation Support. AQA Biology. Genetic diversity and adaptation. Specification reference. Learning objectives. Genetic diversity and adaptation Specification reference 3.4.3 3.4.4 Learning objectives After completing this worksheet you should be able to: understand how meiosis produces haploid gametes know how

More information

MOLECULAR MAPS AND MARKERS FOR DIPLOID ROSES

MOLECULAR MAPS AND MARKERS FOR DIPLOID ROSES MOLECULAR MAPS AND MARKERS FOR DIPLOID ROSES Patricia E Klein, Mandy Yan, Ellen Young, Jeekin Lau, Stella Kang, Natalie Patterson, Natalie Anderson and David Byrne Department of Horticultural Sciences,

More information

PanHomc'r I'rui;* :".>r '.a'' W"»' I'fltolt. 'j'l :. r... Jnfii<on. Kslaiaaac. <.T i.. %.. 1 >

PanHomc'r I'rui;* :.>r '.a'' W»' I'fltolt. 'j'l :. r... Jnfii<on. Kslaiaaac. <.T i.. %.. 1 > 5 28 (x / &» )»(»»» Q ( 3 Q» (» ( (3 5» ( q 2 5 q 2 5 5 8) 5 2 2 ) ~ ( / x {» /»»»»» (»»» ( 3 ) / & Q ) X ] Q & X X X x» 8 ( &» 2 & % X ) 8 x & X ( #»»q 3 ( ) & X 3 / Q X»»» %» ( z 22 (»» 2» }» / & 2 X

More information

INTERACTION OF STRESS, PATHOGENS AND DEVELOPMENT ON THE BEHAVIOR OF TELEOSTS

INTERACTION OF STRESS, PATHOGENS AND DEVELOPMENT ON THE BEHAVIOR OF TELEOSTS INTERACTION OF STRESS, PATHOGENS AND DEVELOPMENT ON THE BEHAVIOR OF TELEOSTS Carl B. Schreck Oregon Cooperative Fish and Wildlife Research Unit (U.S.G.S.) Oregon State University, Corvallis, Oregon 97331,

More information

The evolution, ecology, and restoration of anadromy in. rainbow trout/steelhead Oncorhynchus mykiss

The evolution, ecology, and restoration of anadromy in. rainbow trout/steelhead Oncorhynchus mykiss The evolution, ecology, and restoration of anadromy in rainbow trout/steelhead Oncorhynchus mykiss by Corey Christopher Phillis B.Sc. (Marine Biology), University of California (Santa Cruz), 2002 Thesis

More information

Friday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo

Friday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo Friday Harbor 2017 From Genetics to GWAS (Genome-wide Association Study) Sept 7 2017 David Fardo Purpose: prepare for tomorrow s tutorial Genetic Variants Quality Control Imputation Association Visualization

More information

Potential for anthropogenic disturbances to influence evolutionary change in the life history of a threatened salmonid

Potential for anthropogenic disturbances to influence evolutionary change in the life history of a threatened salmonid University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Publications, Agencies and Staff of the U.S. Department of Commerce U.S. Department of Commerce 2008 Potential for anthropogenic

More information

The unfolding of genomic divergence during ecological speciation in whitefish.

The unfolding of genomic divergence during ecological speciation in whitefish. The unfolding of genomic divergence during ecological speciation in whitefish. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL Pierre-Alexandre Gagnaire On the Origins

More information

Adaptation and genetics. Block course Zoology & Evolution 2013, Daniel Berner

Adaptation and genetics. Block course Zoology & Evolution 2013, Daniel Berner Adaptation and genetics Block course Zoology & Evolution 2013, Daniel Berner 2 Conceptual framework Evolutionary biology tries to understand the mechanisms that lead from environmental variation to biological

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture 20: Epistasis and Alternative Tests in GWAS Jason Mezey jgm45@cornell.edu April 16, 2016 (Th) 8:40-9:55 None Announcements Summary

More information

F1 Parent Cell R R. Name Period. Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes

F1 Parent Cell R R. Name Period. Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes Name Period Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2. Explain the law of segregation. Use two different

More information

Genome Analysis In Domestic Animals By H. Geldermann

Genome Analysis In Domestic Animals By H. Geldermann Genome Analysis In Domestic Animals By H. Geldermann If you are searched for the ebook by H. Geldermann Genome Analysis in Domestic Animals in pdf form, then you've come to faithful website. We furnish

More information

The role of reproductive timing as a driver of genetic differentiation in populations of Pacific herring

The role of reproductive timing as a driver of genetic differentiation in populations of Pacific herring Western Washington University Western CEDAR Salish Sea Ecosystem Conference 2018 Salish Sea Ecosystem Conference (Seattle, Wash.) Apr 6th, 2:30 PM - 2:45 PM The role of reproductive timing as a driver

More information

allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured

allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate

More information

Objectives. Announcements. Comparison of mitosis and meiosis

Objectives. Announcements. Comparison of mitosis and meiosis Announcements Colloquium sessions for which you can get credit posted on web site: Feb 20, 27 Mar 6, 13, 20 Apr 17, 24 May 15. Review study CD that came with text for lab this week (especially mitosis

More information

ANNUAL STOCK ASSESSMENT - CODED WIRE TAG PROGRAM (ODFW) 2003 Annual Report. Prepared by. Mark A. Lewis William M. Murray

ANNUAL STOCK ASSESSMENT - CODED WIRE TAG PROGRAM (ODFW) 2003 Annual Report. Prepared by. Mark A. Lewis William M. Murray ANNUAL STOCK ASSESSMENT - CODED WIRE TAG PROGRAM (ODFW) 2003 Annual Report Prepared by Mark A. Lewis William M. Murray Oregon Department of Fish and Wildlife Prepared For Tracy Yerxa, Technical Representative

More information

UNIT 8 BIOLOGY: Meiosis and Heredity Page 148

UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 CP: CHAPTER 6, Sections 1-6; CHAPTER 7, Sections 1-4; HN: CHAPTER 11, Section 1-5 Standard B-4: The student will demonstrate an understanding of the molecular

More information

Lecture 2: Genetic Association Testing with Quantitative Traits. Summer Institute in Statistical Genetics 2017

Lecture 2: Genetic Association Testing with Quantitative Traits. Summer Institute in Statistical Genetics 2017 Lecture 2: Genetic Association Testing with Quantitative Traits Instructors: Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2017 1 / 29 Introduction to Quantitative Trait Mapping

More information

When one gene is wild type and the other mutant:

When one gene is wild type and the other mutant: Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Update Report. Hauser, Lorenz

Update Report. Hauser, Lorenz Update Report Hauser, Lorenz Period: 2/1/2012-1/31/2013 Project: R/LME-6 - Local adaptation in Puget Sound Pacific cod (Gadus macrocephalus): phenotypic and genomic differentiation and the conservation

More information

Blue Mountain Province

Blue Mountain Province Rolling Provincial Review: Implementation 2001-2003 Province 23 Columbia Basin Fish & Wildlife Authority Province FY 2001-2003 Spending Summaries NPCC Recommendations and BPA Spending by Project Category,

More information

Name Class Date. KEY CONCEPT Gametes have half the number of chromosomes that body cells have.

Name Class Date. KEY CONCEPT Gametes have half the number of chromosomes that body cells have. Section 1: Chromosomes and Meiosis KEY CONCEPT Gametes have half the number of chromosomes that body cells have. VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous

More information

Principles of QTL Mapping. M.Imtiaz

Principles of QTL Mapping. M.Imtiaz Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL

More information

opulation genetics undamentals for SNP datasets

opulation genetics undamentals for SNP datasets opulation genetics undamentals for SNP datasets with crocodiles) Sam Banks Charles Darwin University sam.banks@cdu.edu.au I ve got a SNP genotype dataset, now what? Do my data meet the requirements of

More information

Which of these best predicts the outcome of the changes illustrated in the diagrams?

Which of these best predicts the outcome of the changes illustrated in the diagrams? 1. The diagrams below show two different scenarios for a pair of homologous chromosomes, known as a tetrad, undergoing a change where segments of DNA switch on parts of the chromosomes. In each scenario,

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both

More information

Microsatellites as genetic tools for monitoring escapes and introgression

Microsatellites as genetic tools for monitoring escapes and introgression Microsatellites as genetic tools for monitoring escapes and introgression Alexander TRIANTAFYLLIDIS & Paulo A. PRODÖHL What are microsatellites? Microsatellites (SSR Simple Sequence Repeats) The repeat

More information

Final Report for the Green Valley Creek Winter Refugia Enhancement Project Monitoring December 2016

Final Report for the Green Valley Creek Winter Refugia Enhancement Project Monitoring December 2016 Final Report for the Green Valley Creek Winter Refugia Enhancement Project Monitoring December 2016 Prepared by: Mariska Obedzinski and Sarah Nossaman University of California Cooperative Extension & California

More information

Case-Control Association Testing. Case-Control Association Testing

Case-Control Association Testing. Case-Control Association Testing Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies

More information

Amherst. University of Massachusetts - Amherst

Amherst. University of Massachusetts - Amherst University of Massachusetts - Amherst ScholarWorks@UMass Amherst International Conference on Engineering and Ecohydrology for Fish Passage International Conference on Engineering and Ecohydrology for Fish

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Runaway. demogenetic model for sexual selection. Louise Chevalier. Jacques Labonne

Runaway. demogenetic model for sexual selection. Louise Chevalier. Jacques Labonne Runaway demogenetic model for sexual selection Louise Chevalier Master 2 thesis UPMC, Specialization Oceanography and Marine Environments Jacques Labonne UMR Ecobiop INRA - National Institute for Agronomic

More information

Proportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power

Proportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion

More information

Columbia Estuary Province

Columbia Estuary Province Rolling Provincial Review: Implementation 2001-2004 Province 73 Columbia Basin Fish & Wildlife Authority Province FY 2001-2004 Spending Summaries NPCC Recommendations and BPA Spending by Project Category,

More information

Heredity and Genetics WKSH

Heredity and Genetics WKSH Chapter 6, Section 3 Heredity and Genetics WKSH KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. Vocabulary trait purebred law of segregation genetics cross MAIN IDEA:

More information

Evolution of phenotypic traits

Evolution of phenotypic traits Quantitative genetics Evolution of phenotypic traits Very few phenotypic traits are controlled by one locus, as in our previous discussion of genetics and evolution Quantitative genetics considers characters

More information

Educjatipnal. L a d ie s * COBNWALILI.S H IG H SCHOOL. I F O R G IR L S A n B k i n d e r g a r t e n.

Educjatipnal. L a d ie s * COBNWALILI.S H IG H SCHOOL. I F O R G IR L S A n B k i n d e r g a r t e n. - - - 0 x ] - ) ) -? - Q - - z 0 x 8 - #? ) 80 0 0 Q ) - 8-8 - ) x ) - ) -] ) Q x?- x - - / - - x - - - x / /- Q ] 8 Q x / / - 0-0 0 x 8 ] ) / - - /- - / /? x ) x x Q ) 8 x q q q )- 8-0 0? - Q - - x?-

More information

(Write your name on every page. One point will be deducted for every page without your name!)

(Write your name on every page. One point will be deducted for every page without your name!) POPULATION GENETICS AND MICROEVOLUTIONARY THEORY FINAL EXAMINATION (Write your name on every page. One point will be deducted for every page without your name!) 1. Briefly define (5 points each): a) Average

More information

Biology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name:

Biology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name: Biology 6. Inheritance, Variation and Evolution Revisiting Booklet Name: Reproduction Name the process by which body cells divide:... What kind of cells are produced this way? Name the process by which

More information

Exam 1 PBG430/

Exam 1 PBG430/ 1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.

More information

EXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?

EXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important? Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population

More information

CHAPTER 6. Chromosomes and Meiosis

CHAPTER 6. Chromosomes and Meiosis CHAPTER 6 Chromosomes and Meiosis CHROMOSOMES DNA (deoxyribonucleic acid) is a long, thin molecule that directs cellular functions and heredity. DNA contains information that is encoded in segments called

More information

(Genome-wide) association analysis

(Genome-wide) association analysis (Genome-wide) association analysis 1 Key concepts Mapping QTL by association relies on linkage disequilibrium in the population; LD can be caused by close linkage between a QTL and marker (= good) or by

More information

SoyBase, the USDA-ARS Soybean Genetics and Genomics Database

SoyBase, the USDA-ARS Soybean Genetics and Genomics Database SoyBase, the USDA-ARS Soybean Genetics and Genomics Database David Grant Victoria Carollo Blake Steven B. Cannon Kevin Feeley Rex T. Nelson Nathan Weeks SoyBase Site Map and Navigation Video Tutorials:

More information

Lesson 4: Understanding Genetics

Lesson 4: Understanding Genetics Lesson 4: Understanding Genetics 1 Terms Alleles Chromosome Co dominance Crossover Deoxyribonucleic acid DNA Dominant Genetic code Genome Genotype Heredity Heritability Heritability estimate Heterozygous

More information

Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5

Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 Association Testing with Quantitative Traits: Common and Rare Variants Timothy Thornton and Katie Kerr Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 1 / 41 Introduction to Quantitative

More information

Comparative Genomics of Fagaceae

Comparative Genomics of Fagaceae Fagaceae Images.google.com Linkage Map www.quia.com TM www.clipartlord.com Selection of mapping parents SM2 SM1 Predominant pollinator? Progeny Exclusion for Full Sib Linkage Mapping Year Acorns genotyped

More information

Chromosome duplication and distribution during cell division

Chromosome duplication and distribution during cell division CELL DIVISION AND HEREDITY Student Packet SUMMARY IN EUKARYOTES, HERITABLE INFORMATION IS PASSED TO THE NEXT GENERATION VIA PROCESSES THAT INCLUDE THE CELL CYCLE, MITOSIS /MEIOSIS AND FERTILIZATION Mitosis

More information

Processes of Evolution

Processes of Evolution Processes of Evolution Microevolution Processes of Microevolution How Species Arise Macroevolution Microevolution Population: localized group of individuals belonging to the same species with the potential

More information

Comparative mapping between coho salmon (Oncorhynchus kisutch) and three other

Comparative mapping between coho salmon (Oncorhynchus kisutch) and three other G3: Genes Genomes Genetics Early Online, published on July 21, 2014 as doi:10.1534/g3.114.012294 Comparative mapping between coho salmon (Oncorhynchus kisutch) and three other salmonids suggests a role

More information

Outline of lectures 3-6

Outline of lectures 3-6 GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results

More information

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS. !! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms

More information

February 27, Jim Ruff, Manager, Mainstem Passage and River Operations. March 2008 Runoff Forecast and Power Supply Status

February 27, Jim Ruff, Manager, Mainstem Passage and River Operations. March 2008 Runoff Forecast and Power Supply Status W. Bill Booth Chair Idaho James A. Yost Idaho Tom Karier Washington Richard K. Wallace Washington Bruce A. Measure Vice-Chair Montana Rhonda Whiting Montana Melinda S. Eden Oregon Joan M. Dukes Oregon

More information

Case Study 2: Twenty-mile Creek Rock Fords

Case Study 2: Twenty-mile Creek Rock Fords Case Study : Twenty-mile Creek Rock Fords Location Crossing Description Washington. Okanagan National Forest. Methow Valley Ranger District. Chewuch river basin, East Chewuch Road. The Twenty-mile Creek

More information

Lecture 28: BLUP and Genomic Selection. Bruce Walsh lecture notes Synbreed course version 11 July 2013

Lecture 28: BLUP and Genomic Selection. Bruce Walsh lecture notes Synbreed course version 11 July 2013 Lecture 28: BLUP and Genomic Selection Bruce Walsh lecture notes Synbreed course version 11 July 2013 1 BLUP Selection The idea behind BLUP selection is very straightforward: An appropriate mixed-model

More information

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012 Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based

More information

Processes of Evolution

Processes of Evolution 15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection

More information

Introduction to Meiosis Many organisms pass their genes to their offspring through.

Introduction to Meiosis   Many organisms pass their genes to their offspring through. MEIOSIS NAME DATE 1 Introduction to Meiosis http://vcell.ndsu.nodak.edu/animations/meiosis/movie-flash.htm Many organisms pass their genes to their offspring through. This begins when two gametes unite

More information

Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution

Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.

More information

Solutions to Problem Set 4

Solutions to Problem Set 4 Question 1 Solutions to 7.014 Problem Set 4 Because you have not read much scientific literature, you decide to study the genetics of garden peas. You have two pure breeding pea strains. One that is tall

More information

Stephanie Pedersen. A Thesis presented to The University of Guelph

Stephanie Pedersen. A Thesis presented to The University of Guelph The Mapping of Quantitative Trait Loci Associated with Morphometrics and Parr Marks in an F 2 cross of European and North American Strains of Cultured Atlantic Salmon by Stephanie Pedersen A Thesis presented

More information

Genotyping By Sequencing (GBS) Method Overview

Genotyping By Sequencing (GBS) Method Overview enotyping By Sequencing (BS) Method Overview RJ Elshire, JC laubitz, Q Sun, JV Harriman ES Buckler, and SE Mitchell http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina

More information

Significant synteny and co-localization of ecologically relevant. quantitative trait loci within and across species of salmonid fishes

Significant synteny and co-localization of ecologically relevant. quantitative trait loci within and across species of salmonid fishes Genetics: Early Online, published on July 31, 2017 as 10.1534/genetics.117.300093 Investigation article to Genetics Significant synteny and co-localization of ecologically relevant quantitative trait loci

More information

Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;

Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China; Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin

More information

Problems for 3505 (2011)

Problems for 3505 (2011) Problems for 505 (2011) 1. In the simplex of genotype distributions x + y + z = 1, for two alleles, the Hardy- Weinberg distributions x = p 2, y = 2pq, z = q 2 (p + q = 1) are characterized by y 2 = 4xz.

More information

Lecture 2: Individual-based Modelling

Lecture 2: Individual-based Modelling Lecture 2: Individual-based Modelling Part I Steve Railsback Humboldt State University Department of Mathematics & Lang, Railsback & Associates Arcata, California USA www.langrailsback.com 1 Outline 1.

More information

Physiological Characterization of Hatchery-Origin Juvenile Steelhead Oncorhynchus mykiss Adopting Divergent Life-History Strategies

Physiological Characterization of Hatchery-Origin Juvenile Steelhead Oncorhynchus mykiss Adopting Divergent Life-History Strategies Articles Physiological Characterization of Hatchery-Origin Juvenile Steelhead Oncorhynchus mykiss Adopting Divergent Life-History Strategies Kyle C. Hanson*, William L. Gale, William G. Simpson, Benjamen

More information

Computations with Markers

Computations with Markers Computations with Markers Paulino Pérez 1 José Crossa 1 1 ColPos-México 2 CIMMyT-México June, 2015. CIMMYT, México-SAGPDB Computations with Markers 1/20 Contents 1 Genomic relationship matrix 2 3 Big Data!

More information

Lecture 9: Readings: Chapter 20, pp ;

Lecture 9: Readings: Chapter 20, pp ; Lecture 9: Meiosis i and heredity Readings: Chapter 20, pp 659-686; skim through pp 682-3 & p685 (but just for fun) Chromosome number: haploid, diploid, id polyploid l Talking about the number of chromosome

More information

6.6 Meiosis and Genetic Variation. KEY CONCEPT Independent assortment and crossing over during meiosis result in genetic diversity.

6.6 Meiosis and Genetic Variation. KEY CONCEPT Independent assortment and crossing over during meiosis result in genetic diversity. 6.6 Meiosis and Genetic Variation KEY CONCEPT Independent assortment and crossing over during meiosis result in genetic diversity. 6.6 Meiosis and Genetic Variation! Sexual reproduction creates unique

More information

Evolutionary Ecology of Senecio

Evolutionary Ecology of Senecio Evolutionary Ecology of Senecio Evolutionary ecology The primary focus of evolutionary ecology is to identify and understand the evolution of key traits, by which plants are adapted to their environment,

More information

BIOL EVOLUTION OF QUANTITATIVE CHARACTERS

BIOL EVOLUTION OF QUANTITATIVE CHARACTERS 1 BIOL2007 - EVOLUTION OF QUANTITATIVE CHARACTERS How do evolutionary biologists measure variation in a typical quantitative character? Let s use beak size in birds as a typical example. Phenotypic variation

More information

Accounting for read depth in the analysis of genotyping-by-sequencing data

Accounting for read depth in the analysis of genotyping-by-sequencing data Accounting for read depth in the analysis of genotyping-by-sequencing data Ken Dodds, John McEwan, Timothy Bilton, Rudi Brauning, Rayna Anderson, Tracey Van Stijn, Theodor Kristjánsson, Shannon Clarke

More information

Evolutionary factors and synthetic biology

Evolutionary factors and synthetic biology Evolutionary factors and synthetic biology NAS Joint Session on Climate Change and Ecology Owain Edwards Group Leader, Environmental Synthetic Genomics, CSIRO, Perth, Australia Domain Leader, Biocontrol

More information

BIOL Evolution. Lecture 9

BIOL Evolution. Lecture 9 BIOL 432 - Evolution Lecture 9 J Krause et al. Nature 000, 1-4 (2010) doi:10.1038/nature08976 Selection http://www.youtube.com/watch?v=a38k mj0amhc&feature=playlist&p=61e033 F110013706&index=0&playnext=1

More information

APPENDIX 15-S KSM PROJECT: 2012 FISH BEARING STATUS ASSESSMENT MEMORANDUM

APPENDIX 15-S KSM PROJECT: 2012 FISH BEARING STATUS ASSESSMENT MEMORANDUM APPENDIX 15-S KSM PROJECT: 2012 FISH BEARING STATUS ASSESSMENT MEMORANDUM TM Memorandum Refer to File No.: N:\868 Seabridge\868-017 KSM 2012 Fieldwork\868- DATE: December 17, 2012 017-19 Fisheries - Treaty

More information

SNPs versus sequences for phylogeography an explora:on using simula:ons and massively parallel sequencing in a non- model bird

SNPs versus sequences for phylogeography an explora:on using simula:ons and massively parallel sequencing in a non- model bird SNPs versus sequences for phylogeography an explora:on using simula:ons and massively parallel sequencing in a non- model bird Michael G. Harvey, Brian T. Smith, Brant C. Faircloth, Travis C. Glenn, and

More information

P A L A C E P IE R, S T. L E O N A R D S. R a n n o w, q u a r r y. W WALTER CR O TC H, Esq., Local Chairman. E. CO O PER EVANS, Esq.,.

P A L A C E P IE R, S T. L E O N A R D S. R a n n o w, q u a r r y. W WALTER CR O TC H, Esq., Local Chairman. E. CO O PER EVANS, Esq.,. ? ( # [ ( 8? [ > 3 Q [ ««> » 9 Q { «33 Q> 8 \ \ 3 3 3> Q»«9 Q ««« 3 8 3 8 X \ [ 3 ( ( Z ( Z 3( 9 9 > < < > >? 8 98 ««3 ( 98 < # # Q 3 98? 98 > > 3 8 9 9 ««««> 3 «>

More information

Linear Regression (1/1/17)

Linear Regression (1/1/17) STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression

More information

Biol. 303 EXAM I 9/22/08 Name

Biol. 303 EXAM I 9/22/08 Name Biol. 303 EXAM I 9/22/08 Name -------------------------------------------------------------------------------------------------------------- This exam consists of 40 multiple choice questions worth 2.5

More information