International Journal of Food Nutrition and Safety, 2016, 7(1): 1-9 International Journal of Food Nutrition and Safety

Transcription

1 Article International Journal of Food Nutrition and Safety, 2016, 7(1): 1-9 International Journal of Food Nutrition and Safety Journal homepage: ISSN: X Florida, USA Rapid Identification of Salmonella Typhimurium Using inva Gene and Three Genome Regions (TSR1, TSR2 and TSR3) in Milk as a Food Model by Multiplex PCR Detection Hossein Gholampour 1, Razzagh Mahmoudi*,2, Payman Zare 3 and Hashem Gharedaghi 4 1 Department of Biology, Islamic Azad University, Zanjan Branch, Zanjan, Iran. 2 Department of Food Hygiene and Safety, School of Health, Qazvin University of Medical Sciences, Qazvin, Iran. 3 Department of Pathobiology, Faculty of veterinary medicine, University of Tabriz, Tabriz, Iran. 4 Department of Microbiology, Faculty of Sciences, Zanjan Branch of Islamic Azad University, Zanjan, Iran. * Author to whom correspondence should be addressed; r.mahmodi@yahoo.com. Article history: Received 3 September 2015, Received in revised form 10 October 2015, Accepted 12 December 2015, Published 1 January Abstract: Contamination of Milk with Salmonella is a major risk factor for human health and multiple outbreaks of salmonellosis by milk contamination have been reported. To decrease the time and labor requirements of conventional detection methods, rapid and sensitive methods mainly based on PCR amplification are preferred. The aim of the present study was improvement and optimization of multiplex PCR amplification of serovarspecific genomic regions for the direct detection and serotyping of Salmonella Typhimurium in milk. Samples of previously sterilized milk were inoculated with 10 to 10 5 CFU/mL of S. Typhimurium LT2 and tested for multiplex PCR of 4 sequences including inva gene as the marker of Salmonella and 3 SSGRs specific for S. Typhimurium. Direct plate counting and parallel PCR with filter-purified extracted DNA were simultaneously performed to validate the results. After several tests the lowest detection limit of the method for milk samples was determined. Although the detection limit was 10 CFU/mL, the sensitivity decreased in this concentration especially for larger PCR products. Results of this study in conjunction with control evaluations proved that this method can be used

2 2 routinely as a sensitive and rapid method with overall 3 hours time requirement for the detection of S. Typhimurium in milk samples. Keywords: Multiplex PCR, Milk, Salmonella Typhimurium, SSGRs 1. Introduction Salmonella species have been considered as one of the most important foodborne pathogens, all around the world. Animals are the principal reservoir of this pathogen. Foods from animal sources such as beef, poultry meat, egg and milk have been proved to carry these pathogens( Jamshidi et al., 2009). Because of this zoonotic nature, foods of animal origin are frequently associated with the spread of salmonellosis. Milk or products produced from milk have been implicated in outbreaks of salmonellosis in the United States and other industrialized countries (Karns et al., 2005). Salmonellosis is responsible for large numbers of infections in both humans and animals (Kessel, 2003).Typhoid fever and paratyphoid fever are still serious public health problems in many geographic areas and are endemic in most countries (Chiu et al., 2000). Typhoid fever, a septicemic disease caused by Salmonella typhi, is a serious health problem in developing countries (Karns et al., 2005). Salmonella isolation by conventional culture methods, are based on non-selective preenrichment followed by selective enrichment and plating on selective and differential agars. Suspected colonies are then confirmed by biochemical and serological methods (Kessel et al.,2003).generally, these techniques take longer time, since they give only presumptive results after 3-4 days and definitive results after 5-6 days (Malorny et al., 2003). In recent years, various molecular techniques, utilizing specific gene typing has been used in epidemiological studies (Majowicz et al., 2010). Hybridization using DNA probes was the first molecular biology technique used for the diagnosis of typhoid fever. This technique is specific, but its sensitivity is poor. The advent of PCR technology has provided sensitivity and specificity for the diagnosis of typhoid (Haque et al., 1999). In this work, we developed and evaluated a multiplex PCR-based assay in rapid detecting of S. Typhimurium using four primer-sets. We used purified colonies for our multiplex PCR. We plan to examine whether our system is usable for direct detection from clinical samples. 2. Materials and Methods Bacterial strains and culture media: All bacterial strains were grown at 37 C for 24h in Brain Heart Infusion (BHA) agar (Masato et al., 2011). Genomic sequences of seven serovars of Salmonella:Whole genome sequence data of serovars

3 3 Typhimurium, were obtained from GenBank ( (Benson et al., 2009) administered by the National Center for Biotechnology Information (NCBI). Primer Using specific primers for each gene TSR3, TSR2, TSR1, inva target gene were PCR. Area Profile cutting any of the primers are as follows (Hoelzer et al., 2011): Primer Sequence (5-3) ) Target gene Amplicon fragment (bp) Reference: No invaf AAACCTAAAACCAGCAAAGG inva invar TGTACCGTGGCATGTCTGAG (STM2896) TMP1F ATGCGGGTATGACAAACCCT TSR1 TMP1R TTAGCCCCATTTGGACCTTT (STM0292) TMP2F CAGACCAGGTAAGTTTCTGG TSR2 TMP2R CGCATATTTGGTGCAGAAAT (STM2235) TMP3F TTTACCTCAATGGCGGAACC TSR3 TMP3R CCCAAAAGCTGGGTTAGCAA (STM4493) 605 bp (Hoelzer et al., 2011) 94bp 196bp 303bp (Edwards and Ewing, 1986) (Edwards and Ewing, 1986) (Edwards and Ewing, 1986) Mixed with PCR premixes (20 ml): DNase Free Water, 2µl template DNA. 1µM of each primer, 10 µl. PCR amplification. Isolated colonies from bacterial strains were resuspended in sterile BHI medium, and DNA was extracted and purified using the G-spin Genomic DNA Extraction Kit (for Bacteria) as specified by the manufacturer. The number of genome equivalents in DNA extractions was calculated based on the genome size of S. Typhimurium ssp. Typhimurium serovar Choleraesuis str. SC-B67 genome (4.94 Mb) (Chiu et al., 2005) and L. monocytogenes EGD-e (2.94 Mb) (Glaser et al., 2001) and considering that the average base pair weight is 652 g/mol. Amplification was performed in a thermocycler (Biortech). The cycling condition was as follows: an initial incubation at 95 C for 3 minutes, followed by 30 cycles of denaturation at 94 C for 45 seconds, annealing at 60 C for 30 seconds, Secondly, the final elongation for 7 min at room temperature 72 C (Pierre et al., 2010). Amplified products were electrophoresed in 1% agarose gel and 1kbp, 50bp DNA ladders was used as a size reference. After staining with ethidium bromide the gel was documented with a gel documentation apparatus. Deionized distilled water was used as a template for negative control and S. typhymurium was used as a positive control. Boiling method was used to extract DNA from Salmonella typhimurium (Hoelzer et al., 2011).

4 4 3. Results and Discussion According to the results of electrophoresis of PCR for confirmation inva gene in strains of S. typhimurium LT2 is standard (figure 1). Figure 1: inva gene of S. typhimurium Mvrym confirmed by PCR. From left to right. Multiplex PCR method approved inva genes and three genes (TSR1, TSR2 and TSR3) Genomic DNA was purified from S.typhimurium (figures 2, 3). Figure 2: Experimental results obtained from ATCC electrophoresis A6, A3, A1 and S. typhimurium. Figure 3: Experimental results of electrophoresis of the standard strains of S.typhimurium LT2 Food Lion Area.

5 5 Figure 4-3, the right side of the abdomen, according to the Multiplex PCR dilutions ( ) which is left to the Food Lion last dilution in the case of S.typhimurium in standard strain (LT2) is. The results show Multiplex PCR dilution LT2 (10-2 ) in the milk diet is yes. Figure 4: Experimental results of electrophoresis of the standard strains of S.typhimurium LT2 model A1 and food milk. According to Figure A1 and LT2 all 4 band formed while preparing dilutions of the Food Lion in the form of the fourth band have left. Figure 5: Experimental results of electrophoresis of standard strains of S. typhimurium LT2 and model A1 Food Lion. The shape of the left (at the Food Lion). Multiplex PCR electrophoresis were obtained according to the above strains of S.typhimurium LT2 is A1 and show Multiplex PCR in concentration on both sides give a positive answer.

6 6 Figure 6: Experimental results of electrophoresis strains of S.typhimurium LT2 model A1 Food and Wine. The shape of the left: According to the result of Multiplex PCR and electrophoresis was used for all dilutions in both standard strains (A1 and LT2) of S. typhimurium is shown that only the dilution ( ) gives a positive answer. Salmonella as major pathogenic factors are known to cause serious infections in animals and humans. The bacteria can enter the digestive system and the initial colonization of the small intestine, the colon entrocytes attack. As important serotypes of S. typhimurium and Salmonella pathogenic in humans and animals are known and Iran is also very common. Given that traditional laboratory testing methods are often time-consuming and cost-effective despite having always been problematic for Microbiology (Florence et al., 2011). This gap is particularly fast when the results of the medical and economic importance are felt. Therefore, new techniques to detect pathogenic microbes in food by types genetic methods by various methods such as PCR and DNA hybridization methods And.yky raised by PCR, Multiplex PCR method is (Yiping et al., 2010). Few Multiplex PCR primers in the PCR method used and solution can be prepared in different sizes and for different DNA. By targeting multiple genes in a PCR solution can be shorter and less time testing information gathered through this method with different primers to pay searching various factors, such as meningitis is the most common factors. This method is mainly used to identify the roles of genes in many types of mutations that occur in them. The sectors unrelated to the target DNA can be tested. Large parts of the DNA (target), to seek changes can be assessed. For example, the in muscular dystrophy of defects Muscular dystrophy or explore different parts of IS6110 and IS986 in Mycobacterium tuberculosis causes tuberculosis.

7 7 In clinical microbiology, using this method allowed the identification of several factors simultaneously and disease in a sample can be mixed infections can be identified. To identify multiple pathogens simultaneously using Multiplex PCR technique is feasible, these molecular techniques for the detection of pathogens is a valuable tool when different target genes that are required to enhance proliferation sensitive and simple tool that simultaneously diagnosis of bacterial multiple pathogens is. In this study, a gene (inva (index of the most important functions in metabolism and pathogenesis of Salmonella with three gene fragment (TSR3, TSR2, TSR1) was studied for the first time since a similar study in Iran and in other countries on the antigen are found. This study gene (inva) with important functions in metabolism and the pathogenesis of Salmonella and three gene(tsr1,tsr2,tsr3) The first of these was examined for similar studies in Iran and other countries have so far not found on this serotype. Study on Bacterial strains and examine the simultaneous detection of pathogenic bacteria by multiplex PCR Microbial detection kits and compare them with conventional methods were considered research aims at different dilutions (16/1-5-10) was performed. After various tests to improve and optimize the reaction, the lowest limit of detection methods for milk samples was determined. The dilution of 1.2 in CFU / ml Food Lion was determined in a model organism. 4. Conclusion In this study, gene (inva) index with important functions in metabolism and pathogenesis of Salmonella and three gene (TSR3, TSR2, TSR1) for the first and so far examined for similar studies in other countries on this serotypes not found. Study on strains of bacteria and study at the same time identifying pathogenic bacteria by multiplex PCR method for detecting Microbial detection kits and compare them with conventional methods was research aims at various dilutions (10 5 1/16 ) Done. After various tests to improve and optimize the reaction, the lowest detection limit was determined for samples of milk. The dilution1/2 in CFU / ml bacteria in the milk food were determined. Results of this study in conjunction with control evaluations proved that this method can be used routinely as a sensitive and rapid method with overall 3 hours time requirement for the detection of S.Typhimurium in milk samples. Acknowledgements This study obtained from thesis of MSc field of Microbiology that is approval in Islamic Azad University, Zanjan Branch, Zanjan and thereby is necessary be thank from research respectable council

8 8 of University of Islamic Azad University, Zanjan Branch for approval and funding protection of this projects carried out thanking and appreciation. Finally is appreciated from laboratory of microbilogy, faculty of veterinary medicine, university of Tabriz. References Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Sayers, E.W.( 2009). Gen Bank. Nucleic Acids Res. 37: D26-D31. Chiu, C.H., Petrus, T., Chishih, C., Songnian, H., Qiyu, B., Jun, Y. (2005). The genome sequence of Salmonella entericaserovar Choleraesuis, a highly invasive and resistant zoonotic pathogen. Nucleic Acids Research. 33(5): 297. European Food Safety Authority [EFSA]. The Community Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents, Antimicrobial Resistance and Foodborne Outbreaks in The European Union in (2005). The EFSA Journal, 94:288. Florence, P., Hélène, F., Sonia, P., Jérôme, C., Danièle, Sohier. (2011). Recent advances in quantitative PCR (qpcr) applications in food microbiology. Food Microbiology, Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C. (2001). Comparative genomics of Listeria species. Science, 294: Haque, A., Ahmed, J. and Qureshi, A. (1999). Early detection of typhoid by polymerase chain reaction. Ann. Saudi Med. 19 (4): Hoelzer, K., Switt, M and Wiedmann, M. (2011). Animal contact as a source of human non-typhoidal salmonellosis. Veterinary Research, 42(1): 34. Hong, P., Irene, H., Robin, J., Philip, M., Dan, J., Donoghue, M. (2011). Multiplex PCR assay for the detection and quantification of Campylobacter spp., Escherichia coli O157:H7 and Salmonella serotypes in water samples; Final version published online 14 January, DOI: /j x. Jamshidi, A., Bassami, M.R., Afshari, S. (2009).Identification of Salmonella spp. and Salmonella typhimurium by a multiplex PCR-based assay from poultry carcasses in Mashhad- Iran. Int.J.Vet.Res. 3(1): Karns, J.S., Kessel, J.S., McCluskey, B.J., Perdue, M.L. (2005). Prevalence of Salmonella enterica in Bulk Tank Milk from US Dairies as Determined by Polymerase Chain Reaction. J. Dairy Sci. 88: Kessel, J.S., Karns, J.S., Perdue, M.L. (2003) Using a portable real-time PCR assay to detect Salmonella in raw milk. J. Food. Prot. 66:

9 9 Majowicz, S., Musto, E.J., Scallan,E., Angulo,F. J., Kirk, M., O'Brien, S. J. (2010). The global burden of nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases 50(6): 882. Malorny, B., Hoorfar, J., Hugas, M., Heuvelink, A., Fach, P., Ellerbyoek, L. (2003b). Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method. Int. J. Food Microbiol. 89: Masato, A., Masahiro, K., Taketoshi, I. (2011). Rapid identification of Salmonella enterica serovars, Typhimurium, Choleraesuis, Infantis, Hadar, Enteritidis, Dublin and Gallinarum, by multiplex PCR. Journal of Microbiological Methods, 85: doi: /j.mimet Pierre, W; Ce cile, B; and Sophie, Bertrand. (2011). Methodologies for Salmonella enterica subsp. enterica Subtyping.Gold Standards and Alternatives applied and environmental microbiology, Nov, p , doi: /aem Yiping, H., Xiaomin, Y., Nereus, W., Gunther, IV., Yanping, Xie., Shu-I, Tu., Xianming, Shi. (2010). Simultaneous Detection and Differentiation of Campylobacter jejuni, C. coli, and C. lari in Chickens Using a Multiplex Real-Time PCR Assay. Food Anal. Methods, DOI., /s