International Journal of Food Nutrition and Safety, 2016, 7(1): 1-9 International Journal of Food Nutrition and Safety
|
|
- Cornelia Walters
- 5 years ago
- Views:
Transcription
1 Article International Journal of Food Nutrition and Safety, 2016, 7(1): 1-9 International Journal of Food Nutrition and Safety Journal homepage: ISSN: X Florida, USA Rapid Identification of Salmonella Typhimurium Using inva Gene and Three Genome Regions (TSR1, TSR2 and TSR3) in Milk as a Food Model by Multiplex PCR Detection Hossein Gholampour 1, Razzagh Mahmoudi*,2, Payman Zare 3 and Hashem Gharedaghi 4 1 Department of Biology, Islamic Azad University, Zanjan Branch, Zanjan, Iran. 2 Department of Food Hygiene and Safety, School of Health, Qazvin University of Medical Sciences, Qazvin, Iran. 3 Department of Pathobiology, Faculty of veterinary medicine, University of Tabriz, Tabriz, Iran. 4 Department of Microbiology, Faculty of Sciences, Zanjan Branch of Islamic Azad University, Zanjan, Iran. * Author to whom correspondence should be addressed; r.mahmodi@yahoo.com. Article history: Received 3 September 2015, Received in revised form 10 October 2015, Accepted 12 December 2015, Published 1 January Abstract: Contamination of Milk with Salmonella is a major risk factor for human health and multiple outbreaks of salmonellosis by milk contamination have been reported. To decrease the time and labor requirements of conventional detection methods, rapid and sensitive methods mainly based on PCR amplification are preferred. The aim of the present study was improvement and optimization of multiplex PCR amplification of serovarspecific genomic regions for the direct detection and serotyping of Salmonella Typhimurium in milk. Samples of previously sterilized milk were inoculated with 10 to 10 5 CFU/mL of S. Typhimurium LT2 and tested for multiplex PCR of 4 sequences including inva gene as the marker of Salmonella and 3 SSGRs specific for S. Typhimurium. Direct plate counting and parallel PCR with filter-purified extracted DNA were simultaneously performed to validate the results. After several tests the lowest detection limit of the method for milk samples was determined. Although the detection limit was 10 CFU/mL, the sensitivity decreased in this concentration especially for larger PCR products. Results of this study in conjunction with control evaluations proved that this method can be used
2 2 routinely as a sensitive and rapid method with overall 3 hours time requirement for the detection of S. Typhimurium in milk samples. Keywords: Multiplex PCR, Milk, Salmonella Typhimurium, SSGRs 1. Introduction Salmonella species have been considered as one of the most important foodborne pathogens, all around the world. Animals are the principal reservoir of this pathogen. Foods from animal sources such as beef, poultry meat, egg and milk have been proved to carry these pathogens( Jamshidi et al., 2009). Because of this zoonotic nature, foods of animal origin are frequently associated with the spread of salmonellosis. Milk or products produced from milk have been implicated in outbreaks of salmonellosis in the United States and other industrialized countries (Karns et al., 2005). Salmonellosis is responsible for large numbers of infections in both humans and animals (Kessel, 2003).Typhoid fever and paratyphoid fever are still serious public health problems in many geographic areas and are endemic in most countries (Chiu et al., 2000). Typhoid fever, a septicemic disease caused by Salmonella typhi, is a serious health problem in developing countries (Karns et al., 2005). Salmonella isolation by conventional culture methods, are based on non-selective preenrichment followed by selective enrichment and plating on selective and differential agars. Suspected colonies are then confirmed by biochemical and serological methods (Kessel et al.,2003).generally, these techniques take longer time, since they give only presumptive results after 3-4 days and definitive results after 5-6 days (Malorny et al., 2003). In recent years, various molecular techniques, utilizing specific gene typing has been used in epidemiological studies (Majowicz et al., 2010). Hybridization using DNA probes was the first molecular biology technique used for the diagnosis of typhoid fever. This technique is specific, but its sensitivity is poor. The advent of PCR technology has provided sensitivity and specificity for the diagnosis of typhoid (Haque et al., 1999). In this work, we developed and evaluated a multiplex PCR-based assay in rapid detecting of S. Typhimurium using four primer-sets. We used purified colonies for our multiplex PCR. We plan to examine whether our system is usable for direct detection from clinical samples. 2. Materials and Methods Bacterial strains and culture media: All bacterial strains were grown at 37 C for 24h in Brain Heart Infusion (BHA) agar (Masato et al., 2011). Genomic sequences of seven serovars of Salmonella:Whole genome sequence data of serovars
3 3 Typhimurium, were obtained from GenBank ( (Benson et al., 2009) administered by the National Center for Biotechnology Information (NCBI). Primer Using specific primers for each gene TSR3, TSR2, TSR1, inva target gene were PCR. Area Profile cutting any of the primers are as follows (Hoelzer et al., 2011): Primer Sequence (5-3) ) Target gene Amplicon fragment (bp) Reference: No invaf AAACCTAAAACCAGCAAAGG inva invar TGTACCGTGGCATGTCTGAG (STM2896) TMP1F ATGCGGGTATGACAAACCCT TSR1 TMP1R TTAGCCCCATTTGGACCTTT (STM0292) TMP2F CAGACCAGGTAAGTTTCTGG TSR2 TMP2R CGCATATTTGGTGCAGAAAT (STM2235) TMP3F TTTACCTCAATGGCGGAACC TSR3 TMP3R CCCAAAAGCTGGGTTAGCAA (STM4493) 605 bp (Hoelzer et al., 2011) 94bp 196bp 303bp (Edwards and Ewing, 1986) (Edwards and Ewing, 1986) (Edwards and Ewing, 1986) Mixed with PCR premixes (20 ml): DNase Free Water, 2µl template DNA. 1µM of each primer, 10 µl. PCR amplification. Isolated colonies from bacterial strains were resuspended in sterile BHI medium, and DNA was extracted and purified using the G-spin Genomic DNA Extraction Kit (for Bacteria) as specified by the manufacturer. The number of genome equivalents in DNA extractions was calculated based on the genome size of S. Typhimurium ssp. Typhimurium serovar Choleraesuis str. SC-B67 genome (4.94 Mb) (Chiu et al., 2005) and L. monocytogenes EGD-e (2.94 Mb) (Glaser et al., 2001) and considering that the average base pair weight is 652 g/mol. Amplification was performed in a thermocycler (Biortech). The cycling condition was as follows: an initial incubation at 95 C for 3 minutes, followed by 30 cycles of denaturation at 94 C for 45 seconds, annealing at 60 C for 30 seconds, Secondly, the final elongation for 7 min at room temperature 72 C (Pierre et al., 2010). Amplified products were electrophoresed in 1% agarose gel and 1kbp, 50bp DNA ladders was used as a size reference. After staining with ethidium bromide the gel was documented with a gel documentation apparatus. Deionized distilled water was used as a template for negative control and S. typhymurium was used as a positive control. Boiling method was used to extract DNA from Salmonella typhimurium (Hoelzer et al., 2011).
4 4 3. Results and Discussion According to the results of electrophoresis of PCR for confirmation inva gene in strains of S. typhimurium LT2 is standard (figure 1). Figure 1: inva gene of S. typhimurium Mvrym confirmed by PCR. From left to right. Multiplex PCR method approved inva genes and three genes (TSR1, TSR2 and TSR3) Genomic DNA was purified from S.typhimurium (figures 2, 3). Figure 2: Experimental results obtained from ATCC electrophoresis A6, A3, A1 and S. typhimurium. Figure 3: Experimental results of electrophoresis of the standard strains of S.typhimurium LT2 Food Lion Area.
5 5 Figure 4-3, the right side of the abdomen, according to the Multiplex PCR dilutions ( ) which is left to the Food Lion last dilution in the case of S.typhimurium in standard strain (LT2) is. The results show Multiplex PCR dilution LT2 (10-2 ) in the milk diet is yes. Figure 4: Experimental results of electrophoresis of the standard strains of S.typhimurium LT2 model A1 and food milk. According to Figure A1 and LT2 all 4 band formed while preparing dilutions of the Food Lion in the form of the fourth band have left. Figure 5: Experimental results of electrophoresis of standard strains of S. typhimurium LT2 and model A1 Food Lion. The shape of the left (at the Food Lion). Multiplex PCR electrophoresis were obtained according to the above strains of S.typhimurium LT2 is A1 and show Multiplex PCR in concentration on both sides give a positive answer.
6 6 Figure 6: Experimental results of electrophoresis strains of S.typhimurium LT2 model A1 Food and Wine. The shape of the left: According to the result of Multiplex PCR and electrophoresis was used for all dilutions in both standard strains (A1 and LT2) of S. typhimurium is shown that only the dilution ( ) gives a positive answer. Salmonella as major pathogenic factors are known to cause serious infections in animals and humans. The bacteria can enter the digestive system and the initial colonization of the small intestine, the colon entrocytes attack. As important serotypes of S. typhimurium and Salmonella pathogenic in humans and animals are known and Iran is also very common. Given that traditional laboratory testing methods are often time-consuming and cost-effective despite having always been problematic for Microbiology (Florence et al., 2011). This gap is particularly fast when the results of the medical and economic importance are felt. Therefore, new techniques to detect pathogenic microbes in food by types genetic methods by various methods such as PCR and DNA hybridization methods And.yky raised by PCR, Multiplex PCR method is (Yiping et al., 2010). Few Multiplex PCR primers in the PCR method used and solution can be prepared in different sizes and for different DNA. By targeting multiple genes in a PCR solution can be shorter and less time testing information gathered through this method with different primers to pay searching various factors, such as meningitis is the most common factors. This method is mainly used to identify the roles of genes in many types of mutations that occur in them. The sectors unrelated to the target DNA can be tested. Large parts of the DNA (target), to seek changes can be assessed. For example, the in muscular dystrophy of defects Muscular dystrophy or explore different parts of IS6110 and IS986 in Mycobacterium tuberculosis causes tuberculosis.
7 7 In clinical microbiology, using this method allowed the identification of several factors simultaneously and disease in a sample can be mixed infections can be identified. To identify multiple pathogens simultaneously using Multiplex PCR technique is feasible, these molecular techniques for the detection of pathogens is a valuable tool when different target genes that are required to enhance proliferation sensitive and simple tool that simultaneously diagnosis of bacterial multiple pathogens is. In this study, a gene (inva (index of the most important functions in metabolism and pathogenesis of Salmonella with three gene fragment (TSR3, TSR2, TSR1) was studied for the first time since a similar study in Iran and in other countries on the antigen are found. This study gene (inva) with important functions in metabolism and the pathogenesis of Salmonella and three gene(tsr1,tsr2,tsr3) The first of these was examined for similar studies in Iran and other countries have so far not found on this serotype. Study on Bacterial strains and examine the simultaneous detection of pathogenic bacteria by multiplex PCR Microbial detection kits and compare them with conventional methods were considered research aims at different dilutions (16/1-5-10) was performed. After various tests to improve and optimize the reaction, the lowest limit of detection methods for milk samples was determined. The dilution of 1.2 in CFU / ml Food Lion was determined in a model organism. 4. Conclusion In this study, gene (inva) index with important functions in metabolism and pathogenesis of Salmonella and three gene (TSR3, TSR2, TSR1) for the first and so far examined for similar studies in other countries on this serotypes not found. Study on strains of bacteria and study at the same time identifying pathogenic bacteria by multiplex PCR method for detecting Microbial detection kits and compare them with conventional methods was research aims at various dilutions (10 5 1/16 ) Done. After various tests to improve and optimize the reaction, the lowest detection limit was determined for samples of milk. The dilution1/2 in CFU / ml bacteria in the milk food were determined. Results of this study in conjunction with control evaluations proved that this method can be used routinely as a sensitive and rapid method with overall 3 hours time requirement for the detection of S.Typhimurium in milk samples. Acknowledgements This study obtained from thesis of MSc field of Microbiology that is approval in Islamic Azad University, Zanjan Branch, Zanjan and thereby is necessary be thank from research respectable council
8 8 of University of Islamic Azad University, Zanjan Branch for approval and funding protection of this projects carried out thanking and appreciation. Finally is appreciated from laboratory of microbilogy, faculty of veterinary medicine, university of Tabriz. References Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Sayers, E.W.( 2009). Gen Bank. Nucleic Acids Res. 37: D26-D31. Chiu, C.H., Petrus, T., Chishih, C., Songnian, H., Qiyu, B., Jun, Y. (2005). The genome sequence of Salmonella entericaserovar Choleraesuis, a highly invasive and resistant zoonotic pathogen. Nucleic Acids Research. 33(5): 297. European Food Safety Authority [EFSA]. The Community Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents, Antimicrobial Resistance and Foodborne Outbreaks in The European Union in (2005). The EFSA Journal, 94:288. Florence, P., Hélène, F., Sonia, P., Jérôme, C., Danièle, Sohier. (2011). Recent advances in quantitative PCR (qpcr) applications in food microbiology. Food Microbiology, Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C. (2001). Comparative genomics of Listeria species. Science, 294: Haque, A., Ahmed, J. and Qureshi, A. (1999). Early detection of typhoid by polymerase chain reaction. Ann. Saudi Med. 19 (4): Hoelzer, K., Switt, M and Wiedmann, M. (2011). Animal contact as a source of human non-typhoidal salmonellosis. Veterinary Research, 42(1): 34. Hong, P., Irene, H., Robin, J., Philip, M., Dan, J., Donoghue, M. (2011). Multiplex PCR assay for the detection and quantification of Campylobacter spp., Escherichia coli O157:H7 and Salmonella serotypes in water samples; Final version published online 14 January, DOI: /j x. Jamshidi, A., Bassami, M.R., Afshari, S. (2009).Identification of Salmonella spp. and Salmonella typhimurium by a multiplex PCR-based assay from poultry carcasses in Mashhad- Iran. Int.J.Vet.Res. 3(1): Karns, J.S., Kessel, J.S., McCluskey, B.J., Perdue, M.L. (2005). Prevalence of Salmonella enterica in Bulk Tank Milk from US Dairies as Determined by Polymerase Chain Reaction. J. Dairy Sci. 88: Kessel, J.S., Karns, J.S., Perdue, M.L. (2003) Using a portable real-time PCR assay to detect Salmonella in raw milk. J. Food. Prot. 66:
9 9 Majowicz, S., Musto, E.J., Scallan,E., Angulo,F. J., Kirk, M., O'Brien, S. J. (2010). The global burden of nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases 50(6): 882. Malorny, B., Hoorfar, J., Hugas, M., Heuvelink, A., Fach, P., Ellerbyoek, L. (2003b). Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method. Int. J. Food Microbiol. 89: Masato, A., Masahiro, K., Taketoshi, I. (2011). Rapid identification of Salmonella enterica serovars, Typhimurium, Choleraesuis, Infantis, Hadar, Enteritidis, Dublin and Gallinarum, by multiplex PCR. Journal of Microbiological Methods, 85: doi: /j.mimet Pierre, W; Ce cile, B; and Sophie, Bertrand. (2011). Methodologies for Salmonella enterica subsp. enterica Subtyping.Gold Standards and Alternatives applied and environmental microbiology, Nov, p , doi: /aem Yiping, H., Xiaomin, Y., Nereus, W., Gunther, IV., Yanping, Xie., Shu-I, Tu., Xianming, Shi. (2010). Simultaneous Detection and Differentiation of Campylobacter jejuni, C. coli, and C. lari in Chickens Using a Multiplex Real-Time PCR Assay. Food Anal. Methods, DOI., /s
PCR- TTGE PCR (PCR-TTGE) PCR.
- m.besharaty89@yahoo.com 2500 (-) (tryptic soy broth) TSB - Typhi (-) m.besharaty89@yahoo.com 2500 enterica enterica Typhimurium (tryptic soy broth) TSB enterica 2500 bongori enterica Typhimurium Typhi
More informationUse of the 3M Molecular Detection System for Salmonella and Listeria spp.
Use of the 3M Molecular Detection System for Salmonella and Listeria spp. March 11, 213 Prof Steve Forsythe Pathogen Research Centre, School of Science and Technology Nottingham Trent University Clifton
More informationSalmonella enteritidis Identification and Isolation
Department of Microbiology, Qom Branch, Islamic Azad University. Qom, Iran Start Here Advisor Dr.Mohsen Zargar Consulting Advisor Dr.Taghi Salehi Zahraei Presented by Zeinab Yazdanpanah 1 Outcome Enterobacteriaceae
More informationThe effect of short-time microwave exposures on Salmonella typhimurium inoculated onto chicken drumettes
Short Paper The effect of short-time microwave exposures on Salmonella typhimurium inoculated onto chicken drumettes Jamshidi, A. 1* ; Ghasemi, A. 2 and Mohammadi, A. 3 1 Department of Food Hygiene and
More informationPCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates
Kasetsart J. (Nat. Sci.) 44 : 79-83 (2010) PCR-based Restriction Fragment Length Polymorphism for Subtyping of Salmonella from Chicken Isolates Han Yu Jong 1, Pak Thae Su 1, Pannatee Sanpong 2, Worawidh
More informationSTUDY OF FREQUENCY OF SALMONELLA STRAINS ISOLATED FROM MEAT, MEAT PRODUCTS AND ORGANS
STUDY OF FREQUENCY OF SALMONELLA STRAINS ISOLATED FROM MEAT, MEAT PRODUCTS AND ORGANS CARMEN DAVID 2, R. TRIF 1, E. TÎRZIU 1, ROXANA IRIMESCU 1, R. V. GROS 1 1 - Faculty of Veterinary Medicine, Timisoara,
More informationCOMMISSION REGULATION (EU)
26.5.2011 Official Journal of the European Union L 138/45 COMMISSION REGULATION (EU) No 517/2011 of 25 May 2011 implementing Regulation (EC) No 2160/2003 of the European Parliament and of the Council as
More informationWorld Journal of Pharmaceutical Research SJIF Impact Factor 8.074
SJIF Impact Factor 8.074 Volume 7, Issue 5, 966-973. Research Article ISSN 2277 7105 MOLECULAR DETECTION OF ENTEROTOXIGENIC ISOLATES OF SALMONELLA TYPHIMURIUM, SHIGELLA FLEXNERI AND STAPHYLOCOCCUS AUREUS
More informationCRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping
Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing
More informationFernando Leite, Connie Gebhart, Randall Singer, Richard Isaacson. University of Minnesota, St. Paul, MN
VACCINATION AGAINST LAWSONIA INTRACELLULARIS DECREASES SHEDDING OF SALMONELLA ENTERICA SEROVAR TYPHIMURIUM IN CO-INFECTED PIGS AND CHANGES THE HOST GUT MICROBIOME Fernando Leite, Connie Gebhart, Randall
More informationTyphoid Fever Dr. KHALID ALJARALLAH
Dr. KHALID ALJARALLAH kaljarallah@kfmc.med.sa Main objectives General characteristics (G-, Rod, Facultative anaerobe..etc,) Natural Habitat and transmission root Symptoms Pathogenicity Diagnosis and treatment
More informationCollaborators. Page 1 of 7
Anti-Salmonella and Anti-Campylobacter Properties of Sodium Metasilicate on Commercially Available Ready-to-Cook Broiler Breast Meat Stored at 4 ± 1 C for 7 Days Collaborators Sally K. Williams, Ph.D.
More informationNRL-Salmonella, Hungary. National Food Chain Safety Office Food and Feed Safety Directorate Erzsébet Adrián 29 May 2018
NRL-Salmonella, Hungary National Food Chain Safety Office Food and Feed Safety Directorate Erzsébet Adrián 29 May 2018 Structure National Food Chain Safety Office Food and Feed Safety Directorate Official
More informationAntimicrobial Activity of Cinnamic Acid, Citric Acid, Cinnamaldehyde, and Levulinic Acid Against Foodborne Pathogens
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2014 Antimicrobial Activity of
More informationTineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta
Growth of Escherichia Coli at Chiller Temperatures Tineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta \ Introduction The responses of mesophilic microorganisms to chiller
More information3 S. Heidelberg ESBL Extended spectrum lactamase
Vol. 25 No. 123 almonella Heidelberg 1 almonella enterica serovar Heidelberg 1 3. Heidelberg EBL Extended spectrum lactamase CTX M 2 EBL. Heidelberg almonella enterica serovar Heidelberg 1 3. Heidelberg
More information3M Food Safety 3M Petrifilm Salmonella Express System
3M Petrifilm Salmonella Express System 2 3M Food Safety 3M Petrifilm Salmonella Express System 3M Petrifilm Salmonella Express System is a qualitative test used for the rapid detection and biochemical
More informationITALY TRENDS AND SOURCES OF ZOONOSES AND ZOONOTIC AGENTS IN HUMANS, FOODSTUFFS, ANIMALS AND FEEDINGSTUFFS
ITALY The Report referred to in Article 9 of Directive 2003/99/EC TRENDS AND SOURCES OF ZOONOSES AND ZOONOTIC AGENTS IN HUMANS, FOODSTUFFS, ANIMALS AND FEEDINGSTUFFS including information on foodborne
More informationGram negative bacilli
Gram negative bacilli 1-Enterobacteriaceae Gram negative bacilli-rods Enterobacteriaceae Are everywhere Part of normal flora of humans and most animals They are cause of -30-35% septisemia -more than 70%
More informationThe emergence of a new phage type of Salmonella Typhimurium in humans and animals in New Zealand
Introduction The emergence of a new phage type of Salmonella Typhimurium in humans and animals in New Zealand M Dufour AIMS NZIMLS South Pacific Congress Gold Coast, August 2011 New Zealand is a geographically
More informationDynamics of Salmonella Typhimurium shedding from early to peak lay in laying hens
Dynamics of Salmonella Typhimurium shedding from early to peak lay in laying hens P. SHARMA*, V. PANDE, R. DEVON, A. MCWHORTER and K. K. CHOUSALKAR School of Animal and Veterinary Sciences, University
More informationPr oject Summar y. Funded by The Beef Checkoff
Pr oject Summar y Seasonal effects on E. coli O157:H7, multi drug-resistant Salmonella, and Listeria monocytogenes prevalence and E. coli O157:H7 and Salmonella load on hides and carcasses at cow/bull
More informationDevelopment and Evaluation of Visual Biosensors for Rapid Detection of Salmonella spp. and Listeria monocytogenes
Development and Evaluation of Visual Biosensors for Rapid Detection of Salmonella spp. and Listeria monocytogenes Lawrence D. Goodridge Department of Animal Sciences Colorado State University Lawrence.Goodridge@colostate.edu
More informationDistribution of virulence genes in Salmonella serovars isolated from man & animals
Indian J Med Res 117, February 2003, pp 66-70 Distribution of virulence genes in Salmonella serovars isolated from man & animals H.V. Murugkar*, H. Rahman* & P.K. Dutta Department of Microbiology, College
More informationMicrobial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity
Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Cat. no. 330043 BBID-1507ZR-3 For real-time PCR-based, application-specific microbial identification or profiling The Clostridium
More informationANTIMICROBIAL TESTING. E-Coli K-12 - E-Coli 0157:H7. Salmonella Enterica Servoar Typhimurium LT2 Enterococcus Faecalis
ANTIMICROBIAL TESTING E-Coli K-12 - E-Coli 0157:H7 Salmonella Enterica Servoar Typhimurium LT2 Enterococcus Faecalis Staphylococcus Aureus (Staph Infection MRSA) Streptococcus Pyrogenes Anti Bacteria effect
More informationNF VALIDATION Validation of alternative analytical methods Application in food microbiology. Summary report
ACCREDITATION N 1-0144 PORTEE DISPONIBLE SUR WWW.COFRAC.FR THERMO FISHER SCIENTIFIC 2130 Woodward Austin, TX 78744 USA NF VALIDATION Validation of alternative analytical methods Application in food microbiology
More informationCloning and sequencing of hfq (host factor required for synthesis of bacteriophage Q beta RNA) gene of Salmonella Typhimurium isolated from poultry
Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE Open Access Cloning and sequencing of hfq (host factor required for synthesis of bacteriophage Q beta RNA) gene of Salmonella Typhimurium isolated from
More informationSurvival and Heat Resistance of Salmonella enterica and Escherichia coli O157:H7 in Peanut Butter
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2011, p. 8434 8438 Vol. 77, No. 23 0099-2240/11/$12.00 doi:10.1128/aem.06270-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Survival
More informationDr. habil. Anna Salek. Mikrobiologist Biotechnologist Research Associate
Dr. habil. Anna Salek Mikrobiologist Biotechnologist Research Associate BIOTECHNOLOGY of Food Science Cell Biology of Microorganisms Physiology of Microorganisms Biochemistry of Microorganisms Molecularbiology
More informationSalmonella Enteritidis and Salmonella Typhimorium identification in poultry carcasses
Volume 10 Number 1 (February 2018) 45-50 ORIGINAL ARTICLE Salmonella Enteritidis and Salmonella Typhimorium identification in poultry carcasses Asma Afshari 1, Ahmad Baratpour 2, Saeed Khanzade 2, Abdollah
More informationModeling the effect of temperature on survival rate of Salmonella Enteritidis in yogurt
Polish Journal of Veterinary Sciences Vol. 7, No. (), 79 85 DOI.78/pjvs--69 Original article Modeling the effect of temperature on survival rate of Salmonella Enteritidis in yogurt J. Szczawiński, M.E.
More informationUsing molecular techniques for rapid detection of Salmonella serovars in frozen chicken and chicken products collected from Riyadh, Saudi Arabia
African Journal of Biotechnology Vol. 9(5), pp. 612-619, 1 February, 2010 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2010 Academic Journals Full Length Research Paper Using
More informationIDENTIFICATION AND SEQUENCING OF SALMONELLA ENTERICA SEROTYPE TYPHI ISOLATES OBTAINED FROM PATIENTS WITH PERFORATION AND NON-PERFORATION TYPHOID FEVER
IDENTIFICATION AND SEQUENCING OF SALMONELLA ENTERICA SEROTYPE TYPHI ISOLATES OBTAINED FROM PATIENTS WITH PERFORATION AND NON-PERFORATION TYPHOID FEVER Muhammad Nasrum Massi 1,3, Toshiro Shirakawa 1,2,
More informationMolecular epidemiology of Salmonella and Campylobacter contamination of poultry during transport and slaughter
Molecular epidemiology of Salmonella and Campylobacter contamination of poultry during transport and slaughter Geertrui Rasschaert Vakgroep Veterinaire Volksgezondheid & Voedselveiligheid Promotor: Prof.
More informationOverview. Michelle D. Danyluk University of Florida. 4/14/14
Michelle D. Danyluk University of Florida mddanyluk@ufl.edu Overview Biological Hazards What is the pathogen of concern? Are all strains created equal? What pathogen is the most resistant to the lethal
More informationCurriculum Vitae. Farzaneh Firoozeh Assistant Professor of Microbiology
Curriculum Vitae Farzaneh Firoozeh Assistant Professor of Microbiology PERSONAL First name: Farzaneh Family name: Firoozeh Nationality: Iranian Marital status: Married OFFICE ADDRESS Department of Microbiology
More informationMRVSA 5 (3), Lujain Dh. Al-Khayat et al., ISSN
Mirror of Research in Veterinary Sciences and Animals (MRVSA) Original article Rapid detection and identification of poultry Salmonella serotypes using multiplex PCR assay Lujain Dh. Al-Khayat 1* ; Emad
More informationC.M. Harris*, S.K. Williams* 1. PhD Candidate Department of Animal Sciences Meat and Poultry Processing and Food Safety
The Antimicrobial Properties of a Vinegar-based Ingredient on Salmonella Typhimurium and Psychrotrophs inoculated in Ground Chicken Breast Meat and stored at 3±1 C for 7 days C.M. Harris*, S.K. Williams*
More informationDEVELOPMENT OF MULTIPLEX PCR FOR RAPID IDENTIFICATION OF FOUR SALMONELLA SEROVARS MOST COMMONLY ISOLATED IN JAPAN
Southeast Asian J Trop Med Public Health DEVELOPMENT OF MULTIPLEX PCR FOR RAPID IDENTIFICATION OF FOUR SALMONELLA SEROVARS MOST COMMONLY ISOLATED IN JAPAN Rika Shimizu 1, Kayo Osawa 1, Katsumi Shigemura
More informationFOR RUMINANTS. kemin.com/guthealth
FOR RUMINANTS kemin.com/guthealth What is CLOSTAT? CLOSTAT contains a proprietary, patented strain of Bacillus subtilis PB6. PB6 is a unique, naturally occurring, spore-forming microorganism. Kemin has
More information! "#$ % &$ '( ) $! 0,8$ '$ +% A$ ( B 3% C! %,.E E7 '( - 9E '$ B$ ) # E )!
272261 : 2 (26) (2010)! "#$ % &$ '( ) *! +% &+) (1).-, /) 0 678$ 9 '$ (! 5 ) $ 0 1 2 3-4- ;? < 7= >! ; ) 9 '% ) 7 *! :!,. @3- $! 0,8$ '$ +% A$ ( B 3% C! $
More informationEvaluation of non-pathogenic surrogate bacteria as process validation indicators
Evaluation of non-pathogenic surrogate bacteria as process validation indicators for Salmonella enteric for selected antimicrobial treatments, cold storage and fermentation in meat S. E. Niebuhr 1, A.
More informationThe Pennsylvania State University. The Graduate School. Department of Food Science VIRULENCE GENE AND CRISPR MULTILOCUS SEQUENCE TYPING
The Pennsylvania State University The Graduate School Department of Food Science VIRULENCE GENE AND CRISPR MULTILOCUS SEQUENCE TYPING SCHEME FOR SUBTYPING THE MAJOR SEROVARS OF SALMONELLA ENTERICA SUBSPECIES
More informationThermo Scientific RapidFinder Salmonella species, Typhimurium, and Enteritidis PCR Kit AOAC- RI PTM Matrix Extension: Method Comparison Study
STUDY REPORT Thermo Scientific RapidFinder Salmonella species, Typhimurium, and Enteritidis PCR Kit AOAC- RI PTM Matrix Extension: Method Comparison Study Jessica Williams Thermo Fisher Scientific, Wade
More informationThe effect of salinomycin on Salmonella, Campylobacter and the intestinal microflora in experimentally infected broiler chickens
The effect of salinomycin on Salmonella, Campylobacter and the intestinal microflora in experimentally infected broiler chickens C. H. JOHANSEN, L. BJERRUM, M. LUND and K. PEDERSEN* Danish Institute for
More informationXingxing Ren, Ying Fu, Chenggang Xu, Zhou Feng, Miao Li, Lina Zhang, Jianmin Zhang, 1 and Ming Liao 1
High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum Xingxing Ren, Ying Fu, Chenggang Xu, Zhou Feng, Miao
More informationCandy Rutherford Hamilton Regional Lab Medicine Program St Joseph s Healthcare, Hamilton
Candy Rutherford Hamilton Regional Lab Medicine Program St Joseph s Healthcare, Hamilton Using the BD Max and a Lab Developed Test } Hektoen Enteric Agar 24hrs 37 o C } CIN Agar 24 hours 30 o C } Campy
More informationEstimating the Public Health Impact of Setting Targets at the European Level for the Reduction of Zoonotic Salmonella in Certain Poultry Populations
Int. J. Environ. Res. Public Health 2013, 10, 4836-4850; doi:10.3390/ijerph10104836 OPEN ACCESS Review International Journal of Environmental Research and Public Health ISSN 1660-4601 www.mdpi.com/journal/ijerph
More informationPart A: Salmonella prevalence estimates. (Question N EFSA-Q ) Adopted by The Task Force on 28 March 2007
The EFSA Journal (2007) 98, 1-85 Report of the Task Force on Zoonoses Data Collection on the Analysis of the baseline survey on the prevalence of Salmonella in broiler flocks of Gallus gallus, in the EU,
More informationDetection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test
Polish Journal of Microbiology 2006, Vol. 55, No 2, 113 118 Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test EL BIETA O TUSZAK-WALCZAK *, PIOTR WALCZAK
More informationOptimization of Covaris Settings for Shearing Bacterial Genomic DNA by Focused Ultrasonication and Analysis Using Agilent 2200 TapeStation
Optimization of Covaris Settings for Shearing Bacterial Genomic DNA by Focused Ultrasonication and Analysis Using Agilent 22 TapeStation Application Note Authors Richard Jeannotte, Eric Lee, Narine Arabyan,
More informationA pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa.
1 A pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa. Protozoa are single celled eukaryotic organisms. Some protozoa are pathogens.
More informationJournal of Physics: Conference Series PAPER OPEN ACCESS. To cite this article: M Nurjayadi et al 2018 J. Phys.: Conf. Ser.
Journal of Physics: Conference Series PAPER OPEN ACCESS Evaluation of Primers Detection Capabilities of the pef Salmonella typhimurium Gene and the fimc Eschericia coli Gene Using Real-Time PCR to Develop
More informationEffect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks
Effect of Mid-Ocean Exchange of Ballast Water on Bacterial Community in Ballast Tanks 58,098 GT Length(O.A.) 239.80m Length(PP) 230.00m Breadth 43.00m Depth 20.50m Akiko Tomaru 1, Yasuwo Fukuyo 1, Masanobu
More informationBactericidal Effect of Several Chemicals on Hatching Eggs Inoculated with Salmonella serovar Typhimurium
2007 Poultry Science Association, Inc. Bactericidal Effect of Several Chemicals on Hatching Eggs Inoculated with Salmonella serovar Typhimurium N. A. Cox,* 1 L. J. Richardson,* R. J. Buhr,* M. T. Musgrove,
More informationEvaluation of an immunochromatographic assay for rapid detection of Salmonella enterica serovars Typhimurium and Enteritidis
408063XXXXXX10.1177/1040638711408063Moo ngkarndi et al.evaluation of an immunochromatographic assay Evaluation of an immunochromatographic assay for rapid detection of Salmonella enterica serovars Typhimurium
More informationINTRODUCTION MATERIALS & METHODS
Evaluation of Three Bacterial Transport Systems, The New Copan M40 Transystem, Remel Bactiswab And Medical Wire & Equipment Transwab, for Maintenance of Aerobic Fastidious and Non-Fastidious Organisms
More informationCulture-independent quantification of Salmonellae in food by molecular beacon based real-time PCR
Journal of Applied Pharmaceutical Science Vol. 6 (11), pp. 153-157, November, 2016 Available online at http://www.japsonline.com DOI: 10.7324/JAPS.2016.601124 ISSN 2231-3354 Culture-independent quantification
More informationProgress on the biocontrol of foodborne pathogens on leafy greens with non-pathogenic microbes
Progress on the biocontrol of foodborne pathogens on leafy greens with non-pathogenic microbes M.O. Olanya and D.O. Ukuku USDA Agricultural Research Service, Eastern Regional Research Center, Wyndmoor,
More informationInvestigation of the Biocidal Effect of Electrochemically Activated Aqueous Sodium Chloride Solution on Gram-negative Pathogenic Bacteria
ISSN: 2319-7706 Volume 5 Number 1(2016) pp. 624-632 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.501.063 Investigation of the Biocidal Effect
More informationAOAC Method Comparison Study. Deli Turkey 1 CFU/25g & 5 CFU/25g
AOAC Method Comparison Study Deli Turkey 1 CFU/25g & 5 CFU/25g AOAC Guidelines for Matrix Validation - AOAC mandates two-tiered fractional recovery procedure 1 CFU/25g Low level, recovery target between
More informationPharmaceutical Microbiology Forum Newsletter Vol. 12 (4) Page 3 of 14 (NCIMB 8545, CIP NBRC. Salmonella enterica ssp typhimurium
Page 3 of 14 Continued from page 2 Table 2. Absence of Specified Details Media Growth Promotion Organisms for Trypticase Soy Staphylococcus aureus Escherichia coli Pseudomonas aeruginosa Salmonella Staphylococcus
More informationFeatures of Salmonella serovars among food handlers in Kyushu, Japan
NEW MICROBIOLOGICA, 30, 155-159, 2007 Features of Salmonella serovars among food handlers in Kyushu, Japan Koichi Murakami 1, Tatsuo Ishihara 2, Kazumi Horikawa 1, Takahiro Oda 3 1 Division of Pathology
More informationTHE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE 5/14/18
THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE Introduction: The identification of bacteria is important in order for us to differentiate one microorganism
More informationMLVA Update. Eija Trees, Ph.D., D.V.M. PulseNet Methods Development and Reference Unit Enteric Diseases Laboratory Branch CDC, Atlanta, GA
MLVA Update Eija Trees, Ph.D., D.V.M. PulseNet Methods Development and Reference Unit Enteric Diseases Laboratory Branch CDC, Atlanta, GA Presentation outline Status of the S. Enteritidis MLVA protocol
More informationExpansion of Salmonella Typhimurium ST34 clone carrying multiple. resistance determinants in China
AAC Accepts, published online ahead of print on 24 June 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.01174-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Expansion
More informationEN ISO validation study of the Assurance GDS TM Salmonella method
BIOCONTROL SYSTEMS Inc. 12822 SE 32nd Street BELLEVUE, WA 98005 USA NF VALIDATION Validation study according to the EN ISO 16140 standard: Summary Report EN ISO 16140 validation study of the Assurance
More informationRisk Assessment of Staphylococcus aureus and Clostridium perfringens in ready to eat Egg Products
Risk Assessment of Staphylococcus aureus and Clostridium perfringens in ready to eat Egg Products Introduction Egg products refer to products made by adding other types of food or food additives to eggs
More informationSalmonella monitoring data and foodborne outbreaks for 2015 in the European Union
Salmonella monitoring data and foodborne outbreaks for 2015 in the European Union Valentina Rizzi BIOCONTAM Unit 22 nd EURL- Salmonella Workshop 2017 Zaandam, 29-30 May 2017 OUTLINE EUSR zoonoses-fbo 2015
More informationA novel multiplex PCR assay for the detection of Salmonella
Letters in Applied Microbiology ISSN 0266-8254 ORIGINAL ARTICLE A novel multiplex PCR assay for the detection of Salmonella enterica serovar Enteritidis in human faeces E.A. Trafny, K. Kozłowska and M.
More informationProject Title: Estimation of the area affected by animal feces in vegetable field under overhead sprinkle irrigation system
I. Abstract. Project Title: Estimation of the area affected by animal feces in vegetable field under overhead sprinkle irrigation system Project Investigator(s): Jorge M. Fonseca 1, Sadhana Ravishankar
More informationPart A: Salmonella prevalence estimates. (Question N EFSA-Q A) Adopted by The Task Force on 28 April 2008
Report of the Task Force on Zoonoses Data Collection on the Analysis of the baseline survey on the prevalence of Salmonella in turkey flocks, in the EU, 2006-2007 1 Part A: Salmonella prevalence estimates
More informationStudies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib
Studies on virulence characters of Salmonella Typhimurium isolated from animal and human. Khalilia A. El-Taib Microbiology Unit, Suez Canal university Hospitals, Egypt dr. khalilia11@yahoo.com Abstract:
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationSSI ENTERIC PRODUCT INFORMATION. Detects all Enterobacteria. Direct identification. Rapid diagnosis. Cost saving
SSI ENTERIC M E D I U M Detects all Enterobacteria Direct identification Rapid diagnosis Cost saving SSI Diagnostica 2 Herredsvejen 3400 Hillerød Denmark PRODUCT INFORMATION Tel: +45 4829 9100 Fax: +45
More informationApplication of randomly ampli ed polymorphic DNA (RAPD) analysis for typing Avian Salmonella enterica subsp. enterica
FEMS Immunology and Medical Microbiology 29 (2000) 221^225 www.fems-microbiology.org a Application of randomly ampli ed polymorphic DNA (RAPD) analysis for typing Avian Salmonella enterica subsp. enterica
More informationValidation of methods of analysis. Application in food microbiology
Application identification number: NF102 Publication date: 07 th October 2016 Validation of methods of analysis Application in food microbiology Requirements regarding comparison and interlaboratory studies
More informationNetworks. The Salmonella Network, a tool for monitoring Salmonella from farm to fork
The Salmonella Network, a tool for monitoring Salmonella from farm to fork R. Lailler [renaud.lailler@anses.fr] (1), F. Moury [frederique.moury@anses.fr] (1), S. A. Granier [sophie.granier@anses.fr] (1),
More informationComparison of five culture methods for Salmonella isolation from swine fecal samples of known infection status
620 Brief Research Reports J Vet Diagn Invest 20:620 624 (2008) Comparison of five culture methods for Salmonella isolation from swine fecal samples of known infection status Brenda C. Love, 1 Marcos H.
More informationOutbreak of a new serotype Salmonella enterica subsp. enterica, with antigenic formula 11:z 41 : e,n,z 15 in Greece :
Outbreak of a new serotype Salmonella enterica subsp. enterica, with antigenic formula 11:z 41 : e,n,z 15 in Greece : 2016-2017 An investigation of the Hellenic Centre of Disease Control and Prevention
More informationIndustry Learning in Salmonella Control
Industry Learning in Salmonella Control Dr. Angie Siemens Cargill www.cargill.com CONTROL: to exercise restraint or direction over; dominate; command. CONTROL: to eliminate or prevent the flourishing or
More informationReview Article Application of Molecular Approaches for Understanding Foodborne Salmonella Establishment in Poultry Production
Advances in Biology, Article ID 813275, 25 pages http://dx.doi.org/10.1155/2014/813275 Review Article Application of Molecular Approaches for Understanding Foodborne Salmonella Establishment in Poultry
More informationLGC Standards Proficiency Testing Technical Changes January Start Schemes 2016
FOOD and FEED PT Schemes AFPS (Animal Feeds) Scheme 2016 Two new microbiological samples for 2016: Sample 11 for the detection of Listeria monocytogenes and Listeria species Sample 12 for the detection
More information16-23S rrna Spacer Region Polymorphism in Gangetic River Water Isolates of Salmonella
J. Water Resource and Protection, 2010, 2, 756-761 doi:10.4236/jwarp.2010.28088 Published Online August 2010 (http://www.scirp.org/journal/jwarp) 16-23S rrna Spacer Region Polymorphism in Gangetic River
More informationEstimation of Microbial Concentration in Food Products from Qualitative Microbiological Test Data with the MPN Technique
173 Original Paper Estimation of Microbial Concentration in Food Products from Qualitative Microbiological Test Data with the MPN Technique Hiroshi Fujikawa* Faculty of Agriculture, Tokyo University of
More informationRomanian Biotechnological Letters Vol. 23, No. 2, Effect of uranium on the radiosensitivity of Salmonella spp. in pork meat
Romanian Biotechnological Letters Vol. 3, No., 018 Copyright 018 University of Bucharest Printed in Romania. All rights reserved ORIGINAL PAPER Effect of uranium on the radiosensitivity of Salmonella spp.
More informationMicrobiology. Definition of a Microorganism. Microorganisms in the Lab. The Study of Microorganisms
Microbiology The Study of Microorganisms Definition of a Microorganism Derived from the Greek: Mikros, «small» and Organismos, organism Microscopic organism which is single celled (unicellular) or a mass
More informationSalmonella empyema: a case report
pneumonia 2015 Nov 17;6:120 124 Case Report Salmonella empyema: a case report Shivanshan Pathmanathan a, Suminda Welagedara a,c, Petra Dorrington b,c, Siddharth Sharma a,c a Department of Medicine, Gold
More informationFate of Enterohemorrhagic Escherichia coli 0157:H7 in Apple Cider with and without Preservatives
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 1993, p. 2526-253 99-224/93/82526-5$2./ Copyright 1993, American Society for Microbiology Vol. 59, No. 8 Fate of Enterohemorrhagic Escherichia coli 157:H7 in
More informationImmunomicroarray for multipathogens
Funding period: Jan 3-Feb ultipathogen screening and /or confirmation via microarray detection Arun Bhunia, ark organ, Shu-I Tu Center for Food Safety and Engineering, Purdue University ERRC, Wyndmoor,
More informationHAEMOPHILUS MODULE 29.1 INTRODUCTION OBJECTIVES 29.2 MORPHOLOGY. Notes
29 HAEMOPHILUS 29.1 INTRODUCTION The genus Haemophilus contains small, nonmotile, nonsporing, oxidase positive, pleomorphic, gram negative bacilli that are parasitic on human beings or animals. Haemophilus
More informationANTIBACTERIAL ACTIVITY OF PLANT EXTRACTS IN FOOD PRODUCTS
ANTIBACTERIAL ACTIVITY OF PLANT EXTRACTS IN FOOD PRODUCTS Antanas Šarkinas Food institute of Kaunas University of Technology, Taikos pr. 92, LT-51180, Kaunas; direktorius@lmai.lt Spices Spices have been
More informationINSTITUT FÜR ANGEWANDTE LABORANALYSEN GMBH. First-Beer Magnetic DNA Kit. Extraktion von Hefe- und Bakterien-DNA aus Bier und anderen Getränken
First-Beer INSTITUT FÜR ANGEWANDTE LABORANALYSEN GMBH First-Beer Magnetic DNA Kit Extraktion von Hefe- und Bakterien-DNA aus Bier und anderen Getränken Extraction of bacteria and yeast DNA from beer and
More informationIdenti'fication and Characterization of Salmonella Isolates by Automated Ribotyping t
519 Journal of Food Protection, Vol. 61, No.5, 1998, Pages 519-524 Copyright, International Association of Milk, Food and Environmental Sanitarians Identi'fication and Characterization of Salmonella Isolates
More informationPHE Food and Water Microbiology External Quality Assessment Schemes
Schedule: 1 January to 31 December 2018 PHE Food and Water Microbiology External Quality Assessment Schemes 0006 We aim to meet all the s in this document you will be advised as soon as possible if any
More informationAntimicrobial Effect of Buffered Sodium Citrate (BSC) on Foodborne Pathogens in Liquid Media and Ground Beef
J Food Sci Nutr Vol 5, p 9~ () DOI:.7/jfn..5..9 Antimicrobial Effect of Buffered Sodium Citrate (BSC) on Foodborne Pathogens in Liquid Media and Ground Beef Si Hyun Ryu and Daniel Y. C. Fung Department
More informationNF VALIDATION Validation of alternative analytical methods Application in food microbiology. Summary Report. Initial validation study
ACCREDITATION N 1-0144 PORTEE DISPONIBLE SUR WWW.COFRAC.FR NF VALIDATION Validation of alternative analytical methods Application in food microbiology Summary Report Initial validation study Validation
More informationSerotype and Phage Type Distribution of Salmonella Strains Isolated from Humans, Cattle, Pigs, and Chickens in The Netherlands from 1984 to 2001
JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2002, p. 3980 3985 Vol. 40, No. 11 0095-1137/02/$04.00 0 DOI: 10.1128/JCM.40.11.3980 3985.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
More informationbelonging to the Genus Pantoea
Emerging diseases of maize and onion caused by bacteria belonging to the Genus Pantoea by Teresa Goszczynska Submitted in partial fulfilment of the requirements for the degree Philosophiae Doctoriae in
More information