Xingxing Ren, Ying Fu, Chenggang Xu, Zhou Feng, Miao Li, Lina Zhang, Jianmin Zhang, 1 and Ming Liao 1

Transcription

1 High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum Xingxing Ren, Ying Fu, Chenggang Xu, Zhou Feng, Miao Li, Lina Zhang, Jianmin Zhang, 1 and Ming Liao 1 Key Laboratory of Veterinary Vaccine Innovation of the Ministry of Agriculture, Key Laboratory of Zoonosis Prevention and Control of Guangdong Province, PR China, College of Veterinary Medicine, South China Agricultural University, Guangzhou , China ABSTRACT Salmonella enterica serovar Gallinarum gene. A total of 15 reference and 33 clinical isolates biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbs, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG- 598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. Key words: high resolution melting (HRM), S. Pullorum, S. Gallinarum, identification, SNP 2017 Poultry Science 96: INTRODUCTION Pullorum disease (PD) and fowl typhoid (FT) are 2 distinct septicaemic diseases that specifically affect avian species of major economic significance in many regions worldwide. Salmonella enterica serovar Gallinarum biovars Pullorum (S. Pullorum) and Gallinarum (S. Gallinarum) are the causative agents of these 2 diseases (Foley, et al., 2011). S. Pullorum and S. Gallinarum belong to Kauffmann White scheme serogroup D. Both S. Pullorum and S. Gallinarum display O antigens 1, 9, and 12, and exhibit high cross-reactivity with both each other and other serogroup D serovars, such as S. Enteritidis. As a consequence, they can be simultaneously detected using the conventional Kaufmann White scheme (Proux, et al., 2002). To combat these pathogens, molecular methods have been used to differentiate S. Gallinarum and S. Pul- C 2016 Poultry Science Association Inc. Received July 26, Accepted October 3, Corresponding authors: junfeng-v@163.com (JZ); mliao@scau.edu.cn (ML) lorum, such as PCR followed by restriction fragment length polymorphism based on the flic gene or spec gene present in S. Gallinarum and S. Pullorum has polymorphisms to differentiate the 2 serovars (Kwon, et al., 2000; Ribeiro, et al., 2009). Additional methods include duplex PCR designed to simultaneously detect and differentiate these 2 serovars based on variable regions in the glgc and spec genes (Kang, et al., 2011), or an allele-specific PCR method to differentiate S. Gallinarum and S. Pullorum based on single nucleotide polymorphisms (SNPs) in the rfbs gene at positions 237 and 598 (Shah, et al., 2005). However, such methods often require combinations of different approaches and are not yet economically viable (Barrow and Freitas Neto, 2011). High resolution melting (HRM) analysis represents a post-pcr technique that was developed for mutation scanning in nucleic acid sequences. It has been previously used to identify viruses, bacteria, nematodes, and fungi (Tong and Giffard, 2012). Herein, we developed a PCR-HRM curve assay to detect and discriminate S. Pullorum and S. Gallinarum based on SNPs in the rfbs gene at positions 237 and 598. Our findings 1088

2 HRM IDENTIFICATION SALMONELLA PULLORUM AND GALLINARUM 1089 Table 1. Bacterial strains used in this study. Tm ( C) Strain and serogroup Coding Source Number rfbs237 rfbs598 S. Pullorum CVCC535 CVCC S. Gallinarum CICC21510 CICC S. Enteritidis ATCC13076 ATCC S. Typhimurium ATCC14028 ATCC 1 NA 4 NA S. Indiana ATCC51959 ATCC 1 NA NA S. Hadar ATCC51956 ATCC 1 NA NA S. Agona ATCC51957 ATCC 1 NA NA S. Weltevreden ATCC BAA-2568 ATCC 1 NA NA S. Meleagridis CICC21511 CICC 1 NA NA S. Thompson ATCC8391 ATCC 1 NA NA S. Senftenberg ATCC43845 ATCC 1 NA NA S. Stanle ATCC7308 ATCC 1 NA NA S. Infantis ATCC BAA-1675 ATCC 1 NA NA Escherichia coli ATCC25922 ATCC 1 NA NA Pasteurella multocida ATCC12948 ATCC 1 NA NA S. Pullorum SP-gd01 SP-gd22 Field sample ± ± 0.03 S. Gallinarum SG-gd01 SG-gd07 Field sample ± ± 0.02 S. Enteritidis SE-gd01 SE-gd04 Field sample ± ± CVCC, China Veterinary Culture Collection Center. 2 CICC, China Center of Industrial Culture Collection. 3 ATCC, American Type Culture Collection. 4 NA, not available. Table 2. Primers used for HRM analysis in this study. Primer Sequence (5 3 ) Amplicon size Interpretation SP-237F AAAGCAATATTCTTATGCCTA 72 bp HRM primer can differentiate S. Pullorum SP-237R CACAATTTATGAATACTGCATC SG-598F TGTTAATAATTTCCCCAA 79 bp HRM primer can differentiate S. Gallinarum SG-598R AGTCTCTACATATTCACG rfbs-f ACATACTGTGATTGGCTTAG 661 bp Pre-amplification and sequencing primer rfbs-r CATTGGCTCTTTCTTTGA indicate that PCR-HRM analysis may represent a potent, rapid, and economic tool for the specific and sensitive detection of both S. Pullorum and S. Gallinarum. MATERIALS AND METHODS Sample Collection and DNA Extraction This study included a total of 48 reference and field strains of Salmonella and other related Gram-negative bacteria (Table 1). A total of 15 reference strains were used to establish and optimize the PCR-HRM protocol. Additionally, this protocol was used to analyse 33 Salmonella spp. (22 S. Pullorum, 7 S. Gallinarum, and 4 S. Enteritidis) from fecal or visceral samples of diseased poultry, which had been previously obtained from various parts of China between 2009 and All strains were identified using API identification kits (BioMerieux, Marcy, France) and serotyped with commercial antiserum (S&A Reagents Lab, Bangkok, Thailand). Serotypes were assigned according to the Kauffmann White scheme and strains were stored at 80 C. Genomic DNA was extracted using a DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer s instructions. Primer Design The rfbs gene, which encodes a factor important for the biosynthesis of ADP paratose in serogroup D Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598 (Park, et al., 2001). The gene sequences of S. Pullorum (GenBank accession numbers: LK931482, CP006575, and AF442575), S. Gallinarun (GenBank: AF and AM933173), and S. Enteritidis (Gen- Bank: CP007267, CP009084, and CP009087) were obtained from GenBank. For molecular analyses, 3 sets of primers were designed. The first primer set, rfbs-f/r, was designed to amplify a 661 bp fragment to allow the rfbs gene to be compared between S. Pullorum, S. Gallinarun, and other strains that contain a rfbs gene. The second primer set, SP-237F/237R, was designed to distinguish S. Pullorum from other strains, while the third primer set, SG-598F/598R, was used to distinguish S. Gallinarun from other strains. (Table 2). PCR-HRM Analysis Real-time PCR was performed in a final volume of 20 μl that contained one μl Premix ExTaq mix-

3 1090 REN ET AL. Figure 1. The 2 amplicon fragments amplified by primer SP-237F/237R and primer SG-598F/598R in this study. The SNPs are indicated by the box. ture, one μl each primer (10 μm; SP-237F/237R or SG-598F/598R), one ml EvaGreen fluorescent dye (Biotium, Hayward, CA), 6 ml H 2 O, and one μl template DNA (15 to 50 ng). Reactions were carried out using a Corbett Rotor-Gene Q TM (Qiagen) with an initial denaturation step of 95 C for 5 min, followed by 40 cycles of 95 C for 20 s, 54 C for 20 s, and 72 C for 20 seconds. After amplification, HRM analysis was performed between 60 Cand85 Catarateof0.3 C. All specimens were analyzed in triplicate, and melting profiles were analyzed using Rotor-Gene Q TM software v In this analysis, samples were normalized using the following temperature ranges: 69.0 to 70.0 C and 70.0 to 71.0 C for primer SP-237F/237R, and 72 to 73 C and 72.5 to 73.5 C for primer SG-598F/598R. Melting curves were interpreted using genotype confidence percentage (GCP) values generated with Rotor- Gene Q TM. Each strain was genotyped with reference samples in a normalized HRM graph equal to or greater than 90% GCP. To ensure the accuracy of this method, all PCR products were sequenced to confirm that the correct products had been amplified. Specificity and Sensitivity Testing To construct a recombinant plasmid that contained the rfbs gene for use in sensitivity tests, conventional amplification of the rfbs gene (primer rfbs-f/r) of standard bacteria strains S. Pullorum and S. Gallinarun was performed. Amplified rfbs genes were cloned into pmd19-t vectors (TaKaRa). Then, pmd19-t vectors were sequenced and validated. Positive plasmids were diluted in 10-fold serial dilutions with ddh 2 Oandthe minimum copy number was detected in the optimised PCR-HRM reaction. Each dilution series was repeated 3 times, and a blank control also was established. A total of 14 Gram-negative bacteria, namely Pasteurella multocida, Escherichia coli, S. Typhimurium, S. Indiana, S. Hadar, S. Agona, S. Weltevreden, S. Meleagridis, S. Thompson, S. Senftenberg, S.Stanle,S.Infantis, S. Enteritidis, S. Pullorum or S. Gallinarun, were tested for specificity of the assay. RESULTS AND DISCUSSION According to previous reports based on multi-locus sequence analyses, various SNPs that define particular S. Pullorum and S. Gallinarun species have been identified (Barrow and Freitas Neto, 2011). We developed a HRM-based method to examine 2 of the SNP regions rfbs 237 and rfbs 598 using isolates known to be S. Pullorum and S. Gallinarun. For each region, we obtained 2 easily distinguishable curves. Then, 2 sets of primers were designed based on the conserved flanking sequences, using sequence data retrieved from GenBank. Primer selection was carried out both to ensure specificity and resolve the different between-strain variants (Figure 1). Target choice is of key importance in the development of this type of detection assay. The rfb gene cluster has been used as a target to differentiate serogroups A, B, C2, and D by PCR; among these serogroups, the rfbs genes encoding paratose synthase have been found to be uniquely present in Salmonella serogroup D (Luk, et al., 1993). According to previous reports and based on our present sequence analysis, there were regular changes in the rfbs gene at positions 237 and 598 in the serogroup D Salmonella strains. Specifically, at position of 237, all S. Pullorum isolates had a G nucleotide base, while the other serogroup D Salmonella strains, including S. Gallinarum, had an A nucleotide. At position 598, other serogroup D Salmonella strains (including S. Pullorum) had a G residue, while S. Gallinarum had an A residue, which corresponds to an amino acid change from alanine to threonine. Therefore, the polymorphisms at positions 237 and 598 represent 2 potential robust molecular targets for specific detection of S. Pullorum and S. Gallinarum, respectively, by PCR-HRM. Representative normalized melt curves from PCR- HRM analyses of the rfbs gene using primer sets SP- 237F/237R and SG-598F/598R are shown in Figure 2. Samples with mutations, which are represented by colored lines, can be easily differentiated from susceptible isolates based on differences in the shapes of the melt curves. Notably, there was good concordance in the melting profile for the susceptible isolates, as one composite melt curve was observed for all of the susceptible

4 HRM IDENTIFICATION SALMONELLA PULLORUM AND GALLINARUM 1091 Figure 2. Conventional and normalized melt curves analysis of PCR products from reference strains amplified by primer SP-237F/237R (A and B). Conventional and normalized melt curves analysis of PCR products from reference strains amplified by primer SG-598F/598R (C and D). isolates. For S. Pullorum, the Tm showed an 0.6 Cdifference compared with the other strains, and there was also a large difference of 0.5 C in the Tm between S. Gallinarun and other strains, so both serovars could be easily distinguished based on the melting curves. HRM analyses of all 33 Salmonella isolates using the 2 primer sets are shown in Figure 3. Using the primer set SP-237F/237R, 2 separate groups could be observed in this HRM curve. The S. Gallinarum and S. Enteritidis strains exhibited a lower temperature melting profile, and the S. Pullorum samples were easily distinguished from S. Gallinarum and S. Enteritidis samples based on the 0.6 C difference in Tm. Among the 33 samples, 22 were determined to be S. Pullorum. The S. Pullorum samples had a mean Tm of ± 0.04 C. The remaining 11 samples were subjected to further analysis with the primer set SG-598F/598R, and all 7 S. Gallinarum samples were identified with a mean Tm of ± 0.02 C. To ensure the accuracy of this method, the amplified products were sequenced. We found that all sequences were in accord with the HRM analysis findings. Using the primers SP-237F/237R for the amplification and analysis of different samples, we determined that large differences in the Tm of 0.5 C existed between S. Pullorum and other D serogroup Salmonella, allowing the serovars to be easily distinguished by melting curves. This was because the base pair changes were A/T to G/C at position 237 in the rfbs gene (S. Pullorum-specific), and the numbers of hydrogen bonds between A/T and G/C are strongly associated with differences in melting temperature. Similarly, S. Gallinarum samples could be easily distinguished from other samples. Primer specificity was determined by PCR-HRM using genomic DNA from closely related Gram-negative isolates; none of the strains was positive by HRM analysis, and the blank control (water) was also negative. For sensitivity, the concentrations of the positive plasmids PMD19T-SP and pmd19t-sg were and ng/μl, respectively. Our findings indicated that when serial dilutions were made of a positive plasmid containing the target gene, there was a good correlation between copy number and the CT values of PMD19T- SP (R2 = ) and pmd19t-sg (R2 = ; Figure 4). The minimum detectable concentrations of each primer set for the detection of S. Pullorum and S. Gallinarun were 34 and 42 copies/μl, respectively. These data indicated that PCR-HRM can be 100-times more sensitive than conventional PCR (Shah, Park, Cho, Kim and Chae, 2005). Previous studies showed that the fluorescence of unlabelled real-time PCR was nearly 10-fold stronger than that of TaqMan real-time PCR, in part because of the inclusion of saturating dyes, such as LC green or Eva green (Yu, et al., 2015). Both PD and FT, which are caused by S. Pullorum and S. Gallinarum, respectively, show a tendency to cause substantial economic losses of livestock in areas such as Asia, where the growth of the poultry industry

5 1092 REN ET AL. Figure 3. Conventional and normalized melt curves analysis of PCR products from field strains amplified by primer SP-237F/237R (A and B). Conventional and normalized melt curves analysis of PCR products from field strains amplified by primer SG-598F/598R (C and D). Figure 4. The sensitivity of the PCR-HRM based on EvaGreen for the detection S. Pullorum and S. Gallinarum. (A) Normalized melt curve analysis in serial dilution of S. Pullorum DNA (amplicon a is the concentration of PMD19T-SP) and a standard curve of S. Pullorum performed in a linear graph with R (B) Normalized melt curve analysis in serial dilution of S. Gallinarum DNA (amplicon b is the concentration of PMD19T-SG) and a standard cure of S. Gallinarum performed in a linear graph with R remains in its infancy (Wigley, et al., 2001). Although many developed countries have eradicated these diseases from commercial poultry, they remain a cause of significant economic losses in developing countries (Barrow and Freitas Neto, 2011). For example, S. Pullorum and S. Gallinarum are some of the most important poultry bacterial diseases in China (Gong, et al., 2014). The key to preventing and controlling S. Pullorum and S. Gallinarum in poultry is the definitive diagnosis and removal of infected birds (Shivaprasad, 2000). Traditional methods based on positive serological reactions can be useful in identifying birds as a flock test, but cross-reactivity with other serogroup D serovars, such as S. Enteritidis, also can occur (Christensen, et al., 1993). Molecular assays can show high sensitivity and specificity for identifying and discriminating closely related bacterial strains and variants. Although some molecular assays have been shown to be sufficient for identification, others are relatively complex and require combinations of 2 genes and electrophoresis (Shah, Park, Cho, Kim and Chae, 2005). Additionally, many detection methods are based on a single SNP, although a single mutant gene locus can be difficult to detect by conventional methods or may require a series of complex subsequent operations. Indeed, PCR-RFPL and allele-specific PCR have been used to differentiate S. Pullorum, S. Gallinarum, and other bacterial strains based on polymorphisms in the flic gene at codons 316 and 339, andintherfbs gene at positions 237 and 598 (Kang,

6 HRM IDENTIFICATION SALMONELLA PULLORUM AND GALLINARUM 1093 Kwon, Jung, Kim, Lee, An, Song, Kwon and Chung, 2011). These inherent limitations have limited molecular diagnostic applications in the differential diagnosis of PD and FT. A rapid and affordable diagnosis method is urgently needed for the detection of S. Pullorum and S. Gallinarum. We established a simple, quick, and cost-effective approach for the rapid identification of Salmonella enterica serotype gallinarum biotypes Pullorum and Gallinarum using integrated PCR-HRM curve analysis. PCR-HRM is a novel molecular approach that was originally developed for SNP genotyping, mutation scanning, and sequence scanning in DNA samples. The recent availability of improved doublestranded DNA binding dyes and next-generation realtime PCR instrumentation have allowed for accurate fluorescence data acquisition over small temperature increments (i.e., as low as 0.01 C) (Bingga, et al., 2014). Hence, even a single base change in sample DNA sequences can cause differences in the HRM curve. In conclusion, this represents the first report of the successful application of PCR-HRM technology to distinguish S. Pullorum, S. Gallinarum, and other strains. Each assay was shown to be sufficiently sensitive and specific to allow the melting profiles to distinguish different characteristics of specific mutations. Our findings suggest that PCR-HRM analysis represents a single-step, closed-tube, and economical procedure for the rapid, specific, and sensitive detection of both S. Pullorum and S. Gallinarum. This technique may be applicable in epidemiological research and diagnostic applications in veterinary clinical laboratories, and it may contribute to more timely and efficient control measures on either PD or FT. ACKNOWLEDGMENTS This work was supported by the Special Fund for Agro-scientific Research in the Public Interest [grant numbers , ]; and the National Natural Science Foundation of China [grant number ]. REFERENCES Barrow, P. A., and O. C. Freitas Neto Pullorum disease and fowl typhoid new thoughts on old diseases: A review. Avian. Pathol. 40:1 13. Bingga,G.,Z.Liu,J.Zhang,Y.Zhu,L.Lin,S.Ding,andP.Guo High resolution melting curve analysis as a new tool for rapid identification of canine parvovirus type 2 strains. Mol. Cell Probes. 28: Christensen, J. P., J. E. Olsen, and M. Bisgaard Ribotypes of Salmonella enterica serovar Gallinarum biovars gallinarum and pullorum. Avian Pathol. 22: Foley,S.L.,R.Nayak,I.B.Hanning,T.J.Johnson,J.Han,and S. C. Ricke Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl. Environ. Microbiol. 77: Gong, J., J. Zhang, M. Xu, C. Zhu, Y. Yu, X. Liu, P. Kelly, B. Xu, and C. Wang Prevalence and fimbrial genotype distribution of poultry Salmonella isolates in China (2006 to 2012). Appl. Environ. Microbiol. 80: Kang,M.S.,Y.K.Kwon,B.Y.Jung,A.Kim,K.M.Lee,B.K. An, E. A. Song, J. H. Kwon, and G. S. Chung Differential identification of Salmonella enterica subsp. enterica serovar Gallinarum biovars Gallinarum and Pullorum based on polymorphic regions of glgc and spec genes. Vet. Microbiol. 147: Kwon, H. J., K. Y. Park, H. S. Yoo, J. Y. Park, Y. H. Park, and S. J. Kim Differentiation of Salmonella enterica serotype gallinarum biotype pullorum from biotype gallinarum by analysis of phase 1 flagellin C gene (flic). J. Microbiol. Methods. 40: Luk, J. M., U. Kongmuang, P. R. Reeves, and A. A. Lindberg Selective amplification of abequose and paratose synthase genes (rfb) by polymerase chain reaction for identification of Salmonella major serogroups (A, B, C2, and D). J. Clin. Microbiol. 31: Park,M.K.,K.S.Choi,M.C.Kim,andJ.S.Chae.2001.Differential diagnosis of Salmonella gallinarum and S. pullorum using PCR- RELP. J. Vet. Sci. 2: Proux, K., F. Humbert, E. Jouy, C. Houdayer, F. Lalande, A. Oger, and G. Salvat Improvements required for the detection of Salmonella Pullorum and Gallinarum. Can. J. Vet. Res. 66: Ribeiro, S. A., J. B. de Paiva, F. Zotesso, M. V. Lemos, and A. Berchieri Janior Molecular differentiation between Salmonella enterica subsp enterica serovar Pullorum and Salmonella enterica subsp enterica serovar Gallinarum. Braz. J. Microbiol. 40: Shah, D. H., J. H. Park, M. R. Cho, M. C. Kim, and J. S. Chae Allele-specific PCR method based on rfbs sequence for distinguishing Salmonella gallinarum from Salmonella pullorum: Serotype-specific rfbs sequence polymorphism. J. Microbiol. Methods. 60: Shivaprasad, H. L Fowl typhoid and pullorum disease. Rev. Sci. Tech. 19: Tong, S. Y., and P. M. Giffard Microbiological applications of high-resolution melting analysis. J. Clin. Microbiol. 50: Wigley, P., A. Berchieri, Jr, K. L. Page, A. L. Smith, and P. A. Barrow Salmonella enterica serovar Pullorum persists in splenic macrophages and in the reproductive tract during persistent, disease-free carriage in chickens. Infect. Immun. 69: Yu, H. Q., X. Q. Cai, Z. X. Lin, X. L. Li, Q. Y. Yue, R. Li, and X. Q. Zhu Rapid and specific detection of porcine parvovirus using real-time PCR and high resolution melting (HRM) analysis. BMC Vet. Res. 11:46.