Opportunities with USDA-ARS Locations in South Central Texas
|
|
|
- Lauren Chambers
- 5 years ago
- Views:
Transcription
1 Opportunities with USDA-ARS Locations in South Central Texas Kevin Temeyer Knipling-Bushland U.S. Livestock Insects Research Laboratory, Kerrville, TX 78028
2 USDA-ARS Locations in Texas Kerrville (Moore Field & Panama), Temple, College Station, Bushland, Lubbock
3
4
5
6
7
8
9
10
11
12
13 Pathogenic Landscape Arundo River willows donax Cattle fever tick Infested hosts Cattle Deer 1. Arundo and Guineagrass enhance survival of tick 2. Transition back to native vegetation--better biological barrier to ticks Racelis, A.E., R. B. Davey, J. A. Goolsby, A. A. Pérez de León, K. Varner, and R. Duhaime Facilitative ecological interactions between invasive species: Arundo donax (Poaceae) stands as favorable habitat for cattle ticks (Acari: Ixodidae) along the US- Mexico border. Journal of Medical Entomology 49: Nilgai
14
15
16
17
18
19
20
21
22 Deployed Warfighter Protection Program Joint program between Dept. of Defense and Dept. of Agriculture
23 Agricultural Research Service Sand fly AChE Target of organophosphate insecticides Identical residues Non-identical residues Unaligned residues Catalytic triad: Ser336, Glu462, His576 of P. papatasi sequence Constructed rppache1- G119S by targeted mutagenesis containing Gly Ser OP-R substitution (G256S) for biochemical characterization Alignment of PpAChE sequence to Drosophila melanogaster AChE (MMDB 1QO9) Partial PpAChE1 cdna sequence containing G119S codon identified as OP-R in An. gambiae and other insects Ser OP-insensitive TGGATCTTCGGTGGTAGCTTCTACTCAGGAACATCCAC TGGATCTTCGGTGGTGGCTTCTACTCAGGAACATCCAC Gly OP-sensitive
24 rppache1 containing G119S codon OP-R in An. gambiae and other insects Property a Ser OP-insensitive ATCTTCGGTGGTAGCTTCTACTCAGGAACATCC ATCTTCGGTGGTGGCTTCTACTCAGGAACATCC Gly OP-sensitive (wt) Biochemical properties of rppache1 rppache1 (OP-sensitive) rppache1-g256s (OP-insensitive) K m AcSCh b (μm) (4-fold) IC50 Paraoxon (10-7 M) (1300-fold) IC50 Malaoxon (10-8 M) (455-fold) IC50 Eserine (10-9 M) (25-fold)
25 Continuing need for new pest control technologies Genomics Pest physiology Vaccines New, targeted pesticides Strategies for control of pest populations Strategies to prevent pathogen transmission by vectors Host animal resistance to parasites & disease
26 Tick AChE Phylogram Ixodes scapularis predicted AChEs R. microplus BmAChEs
27 Acetylcholinesterase - Target Site Insensitivity in R. microplus Three AChEs expresses in synganglion: BmAChE1, K m 4-5 μm BmAChE2, K m μm BmAChE3, K m μm BmAChE1, BmAChE2 & BmAChE3 are functional complements BmAChE1, BmAChE2 & BmAChE3 are amplified, expressing more than two transcript alleles Multiple amino acid substitutions were associated with resistance for each of the three BmAChEs Individual ticks maintained & expressed multiple alleles for each of the three BmAChEs Acetylcholinesterase target site insensitivity is multigenic in R. microplus
28 Current studies probable additional BmAChEs Fsg186 (salivary) Tc19987 (gut) possible vaccine candidates? Noteworthy opportunity to investigate host-parasite interaction (nervous/immune integration) External collaborations with Univ. Florida, Virginia Tech., Southwest Research Institute (San Antonio), Mayo Clinic, Iowa State University Ixodes scapularis AChE phylogram R. microplus AChEs: BmAChE2 BmAChE3 BmAChE1
29 Proposed Role of Tick Salivary AChE Tick Gut AChE: Detoxifies Bloodmeal Parasite factors Host factors Pathogen factors Tick Salivary AChE: Hydrolyzes acetylcholine in host tissues Alters acetylcholine activation of nicotinic and muscarinic receptors Modulates host inflammatory response Modulates host innate immunity Modulates host acquired immunity
30 Acetylcholinesterase: The Target of AChE function Organophosphates Key synaptic enzyme in CNS Hydrolyzes neurotransmitter AcCh Regulation of Inflammation & Immune Response via local acetylcholine Detoxification of bloodmeal OPs bind to and inhibit AChE Blocking nerve impulse transmission Desensitizes AcCh receptors Mutations in AChE may lead to OP resistance
31 Thank you for your attention!
Pesticide Biochemistry and Physiology
Pesticide Biochemistry and Physiology xxx (2013) xxx xxx Contents lists available at SciVerse ScienceDirect Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest Acetylcholinesterase
BIOAG'L SCI + PEST MGMT- BSPM (BSPM)
Bioag'l Sci + Pest Mgmt-BSPM (BSPM) 1 BIOAG'L SCI + PEST MGMT- BSPM (BSPM) Courses BSPM 102 Insects, Science, and Society (GT-SC2) Credits: 3 (3-0-0) How insects develop, behave, and affect human activity.
Pesticide Lesson Plan
Chemical Control of Insect Pests Cultural Mechanical Biological Chemical Pesticide Lesson Plan Theory (Lecture) Issues surrounding pesticide use Kinds of pesticides How they are named Insecticide families
Neurons and Nervous Systems
34 Neurons and Nervous Systems Concept 34.1 Nervous Systems Consist of Neurons and Glia Nervous systems have two categories of cells: Neurons, or nerve cells, are excitable they generate and transmit electrical
ing equilibrium i Dynamics? simulations on AchE and Implications for Edwin Kamau Protein Science (2008). 17: /29/08
Induced-fit d or Pre-existin ing equilibrium i Dynamics? Lessons from Protein Crystallography yand MD simulations on AchE and Implications for Structure-based Drug De esign Xu Y. et al. Protein Science
BIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
Nervous Systems: Neuron Structure and Function
Nervous Systems: Neuron Structure and Function Integration An animal needs to function like a coherent organism, not like a loose collection of cells. Integration = refers to processes such as summation
Nervous System AP Biology
Nervous System 2007-2008 Why do animals need a nervous system? What characteristics do animals need in a nervous system? fast accurate reset quickly Remember Poor think bunny! about the bunny signal direction
Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles
This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004
BEFORE TAKING THIS MODULE YOU MUST ( TAKE BIO-4013Y OR TAKE BIO-
2018/9 - BIO-4001A BIODIVERSITY Autumn Semester, Level 4 module (Maximum 150 Students) Organiser: Dr Harriet Jones Timetable Slot:DD This module explores life on Earth. You will be introduced to the major
Introduction Acetylcholinesterase (AChE) is one of the most important enzymes involved in nerve transmission. The enzyme is bound to cellular membrane
Cell Technology PROTOCOL acella - AChE * Bioluminescence Assay for Monitoring Acetylcholinesterase Activity *Patent Pending Contact Information Address Cell Technology Inc 950 Rengstorff Ave Suite D Mountain
Lecture 8 Insect ecology and balance of life
Lecture 8 Insect ecology and balance of life Ecology: The term ecology is derived from the Greek term oikos meaning house combined with logy meaning the science of or the study of. Thus literally ecology
Approved Courses for General Science students with Major/Minors in Biological Sciences
Approved Courses for General Science students with Major/Minors in Biological Sciences List C: Physiology, cell and developmental biology BIOIN 301 Bioinformatics. * (fi 6) (first term, 3-0-0). Introduction
Dendrites - receives information from other neuron cells - input receivers.
The Nerve Tissue Neuron - the nerve cell Dendrites - receives information from other neuron cells - input receivers. Cell body - includes usual parts of the organelles of a cell (nucleus, mitochondria)
Catalysis. v 0 no catalyst v c -- catalyst present. v c. dt with no catalyst) (v c = -d[a]/dt dt with a catalyst)
![Catalysis. v 0 no catalyst v c -- catalyst present. v c. dt with no catalyst) (v c = -d[a]/dt dt with a catalyst)](/thumbs/87/95598212.jpg "Catalysis. v 0 no catalyst v c -- catalyst present. v c. dt with no catalyst) (v c = -d[a]/dt dt with a catalyst)")
Catalysis Catalysis provides an additional mechanism by which reactants can be converted to products. The alternative mechanism has a lower activation energy than the reaction in the absence of a catalyst.
Prereq: Concurrent 3 CH
0201107 0201101 General Biology (1) General Biology (1) is an introductory course which covers the basics of cell biology in a traditional order, from the structure and function of molecules to the structure
MICROBIOLOGY (MICRO) Microbiology (MICRO) 1. MICRO 310: Medical Microbiology
Microbiology (MICRO) 1 MICROBIOLOGY (MICRO) Courses primarily for undergraduates: MICRO 101: Microbial World Prereq: High school biology or equivalent Introduction to the importance of viruses, bacteria,
VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
Signal Transduction. Dr. Chaidir, Apt
Signal Transduction Dr. Chaidir, Apt Background Complex unicellular organisms existed on Earth for approximately 2.5 billion years before the first multicellular organisms appeared.this long period for
Nervous Tissue. Neurons Electrochemical Gradient Propagation & Transduction Neurotransmitters Temporal & Spatial Summation
Nervous Tissue Neurons Electrochemical Gradient Propagation & Transduction Neurotransmitters Temporal & Spatial Summation What is the function of nervous tissue? Maintain homeostasis & respond to stimuli
Neurophysiology. Danil Hammoudi.MD
Neurophysiology Danil Hammoudi.MD ACTION POTENTIAL An action potential is a wave of electrical discharge that travels along the membrane of a cell. Action potentials are an essential feature of animal
Nervous Tissue. Neurons Neural communication Nervous Systems
Nervous Tissue Neurons Neural communication Nervous Systems What is the function of nervous tissue? Maintain homeostasis & respond to stimuli Sense & transmit information rapidly, to specific cells and
Runs of homozygosity and evidence of adaptation in Nellore cattle. Elisa Peripolli UNESP/FCAV - Brazil
Runs of homozygosity and evidence of adaptation in Nellore cattle Elisa Peripolli UNESP/FCAV - Brazil Objective 1. Identify autozygosity islands based on ROH in the genome of the Nellore cattle. 2. Examine
Why Should We Care About Invasive Species?
Why Should We Care About Invasive Species? Dr. Vanessa Beauchamp Towson University Department of Biological Sciences Maryland Native Plant Society Fall Conference September 15, 2018 Exotic Exotic Species
Biology II : Embedded Inquiry
Biology II : Embedded Inquiry Conceptual Strand Understandings about scientific inquiry and the ability to conduct inquiry are essential for living in the 21 st century. Guiding Question What tools, skills,
AP Biology. Free-Response Questions
2018 AP Biology Free-Response Questions College Board, Advanced Placement Program, AP, AP Central, and the acorn logo are registered trademarks of the College Board. AP Central is the official online home
Processes of Evolution
15 Processes of Evolution Chapter 15 Processes of Evolution Key Concepts 15.1 Evolution Is Both Factual and the Basis of Broader Theory 15.2 Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom
Biochemistry 3100 Sample Problems Binding proteins, Kinetics & Catalysis
(1) Draw an approximate denaturation curve for a typical blood protein (eg myoglobin) as a function of ph. (2) Myoglobin is a simple, single subunit binding protein that has an oxygen storage function
Plant Stimuli pp Topic 3: Plant Behaviour Ch. 39. Plant Behavioural Responses. Plant Hormones. Plant Hormones pp
Topic 3: Plant Behaviour Ch. 39 Plants exist in environments that are constantly changing. Like animals, plants must be able to detect and react to stimuli in the environment. Unlike animals, plants can
Understanding relationship between homologous sequences
Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective
Host-Pathogen Interaction. PN Sharma Department of Plant Pathology CSK HPKV, Palampur
Host-Pathogen Interaction PN Sharma Department of Plant Pathology CSK HPKV, Palampur-176062 PATHOGEN DEFENCE IN PLANTS A BIOLOGICAL AND MOLECULAR VIEW Two types of plant resistance response to potential
ENTOMOLOGY. Undergraduate Study Minor - Insect Science. Graduate Study. Minor - Emerging Global Diseases. Entomology 1
Entomology 1 ENTOMOLOGY Undergraduate Study Minor - Insect Science The department offers a minor in Insect Science that may be earned by completing ENT 370 Insect Biology and 12 credits in courses selected
Untitled Document. A. antibiotics B. cell structure C. DNA structure D. sterile procedures
Name: Date: 1. The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification of genetic diseases? A. antibiotics
Identification number: TÁMOP /1/A
Manifestation of Novel Social Challenges of the European Union in the Teaching Material of Medical Biotechnology Master s Programmes at the University of Pécs and at the University of Debrecen Identification
A look at the recently published Honey Bee Genome (Apis mellifera), it s uses and potential ramification for the Beekeeping Industry and Human Health.
Master Beekeeper Certification Course: Category #3 By: Louis A. Matej Date: 1 December 2006 Name: Genetic Control of Colony Traits Subject: A look at the recently published Honey Bee Genome (Apis mellifera),
The Royal Entomological Society Journals
Read the latest Virtual Special Issues from The Royal Entomological Society Journals Click on the buttons below to view the Virtual Special Issues Agricultural and Forest Pests Introduction This virtual
Bio/Life: Cell Biology
Bio/Life: Cell Biology 1a The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism's cells. As a basis for understanding
PHYSIOLOGY CHAPTER 9 MUSCLE TISSUE Fall 2016
PHYSIOLOGY CHAPTER 9 MUSCLE TISSUE Fall 2016 2 Chapter 9 Muscles and Muscle Tissue Overview of Muscle Tissue types of muscle: are all prefixes for muscle Contractility all muscles cells can Smooth & skeletal
Introduction Principles of Signaling and Organization p. 3 Signaling in Simple Neuronal Circuits p. 4 Organization of the Retina p.
Introduction Principles of Signaling and Organization p. 3 Signaling in Simple Neuronal Circuits p. 4 Organization of the Retina p. 5 Signaling in Nerve Cells p. 9 Cellular and Molecular Biology of Neurons
Department Curriculum and Assessment Outline
Department: Science Year Group: 10 Teaching, learning and assessment during the course: Combined Science 1 2 B1 Key concepts in Biology B2 Cells and control What are the structure and function of cells.
Madhya Pradesh Bhoj Open University. Bhopal M.sc Zoology Final Year
Subject : Comparative Anatomy of Vertebrates Q.1 Describe the inter-relationship of Uro chords and cephalochordates and their relationship with other deuterostomes. Q.2 Describe origin, evolution and general
A DISEASE ECOLOGIST S GUIDE TO EVOLUTION: EVIDENCE FROM HOST- PARASITE RELATIONSHIPS
A DISEASE ECOLOGIST S GUIDE TO EVOLUTION: EVIDENCE FROM HOST- PARASITE RELATIONSHIPS SARAH A. ORLOFSKE TEACHING EVOLUTION WORKSHOP UNIVERSITY OF COLORADO BOULDER sarah.orlofske@colorado.edu Ph.D. Candidate
Putnam County Public Schools Curriculum Map BIOLOGY Yearly Outlook First Nine Weeks Second Nine Weeks Third Nine Weeks Fourth Nine Weeks
Putnam County Public Schools Curriculum Map BIOLOGY Yearly Outlook 2017-2018 First Nine Weeks Second Nine Weeks Third Nine Weeks Fourth Nine Weeks Unit 1 Ecology* SC.912.L.17.2: Explain the general distribution
The Nervous System. Nerve Impulses. Resting Membrane Potential. Overview. Nerve Impulses. Resting Membrane Potential
The Nervous System Overview Nerve Impulses (completed12/03/04) (completed12/03/04) How do nerve impulses start? (completed 19/03/04) (completed 19/03/04) How Fast are Nerve Impulses? Nerve Impulses Nerve
EXAMgen Correlation to Texas Essential Knowledge and Skills (TEKS)
EXAMgen Correlation to Texas Essential Knowledge and Skills (TEKS) TEKS EXAMgen Biology 3rd Edition Outline 112.34 Biology *TEKS in red denote Readiness Standards ex: (B.4)(B)R *TEKS in green denote Supporting
Keystone Exams: Biology Assessment Anchors and Eligible Content. Pennsylvania Department of Education
Assessment Anchors and Pennsylvania Department of Education www.education.state.pa.us 2010 PENNSYLVANIA DEPARTMENT OF EDUCATION General Introduction to the Keystone Exam Assessment Anchors Introduction
Side View with Rings of Charge
1 Ion Channel Biophysics Describe the main biophysical characteristics of at least one type of ionic channel. How does its biophysical properties contribute to its physiological function. What is thought
Evolution of Populations. Populations evolve. Changes in populations. Natural selection acts on individuals differential survival. Populations evolve
Evolution of Populations Doonesbury - Sunday February 8, 2004 Populations evolve Natural selection acts on individuals differential survival differential reproductive success survival of the fittest who
Biology B. There are no objectives for this lesson.
Biology B Course Summary This is the second of two courses that comprise Biology. This course is designed to prepare the student to confidently enter and complete college-level biology courses. The Glencoe
keâesme& Meer Mechanisms of catalysis
Mechanisms of catalysis Proximity and orientation effects Proximity: Reaction between bound molecules doesn't require an improbable collision of 2 molecules -- they're already in "contact" (increases the
Overview of ion channel proteins. What do ion channels do? Three important points:
Overview of ion channel proteins Protein Structure Membrane proteins & channels Specific channels Several hundred distinct types Organization Evolution We need to consider 1. Structure 2. Functions 3.
Arachis glabrata (perennial peanut) Has the species become naturalised where grown? n Does the species have weedy races?
Australia/New Zealand Weed Risk Assessment adapted for Florida. Data used for analysis published in: Gordon, D.R., D.A. Onderdonk, A.M. Fox, R.K. Stocker, and C. Gantz. 28. Predicting Invasive Plants in
INDIRECT EFFECTS OF GARLIC MUSTARD ON THE BLACKLEGGED TICK?
INDIRECT EFFECTS OF GARLIC MUSTARD ON THE BLACKLEGGED TICK? RACHEL ROLLINS Concordia College, Bronxville, NY 178 USA MENTOR SCIENTISTS: DRS. RICHARD S. OSTFELD 1 AND FELICIA KEESING 2 1 Institute of Ecosystem
Supplemental table S7.
Supplemental table S7. GO terms significantly enriched in significantly up-regulated genes of the microarray. K: number of genes from the input cluster in the given category. F: number of total genes in
Membranes 2: Transportation
Membranes 2: Transportation Steven E. Massey, Ph.D. Associate Professor Bioinformatics Department of Biology University of Puerto Rico Río Piedras Office & Lab: NCN#343B Tel: 787-764-0000 ext. 7798 E-mail:
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
Effect of Temperature Increasing the temperature increases the energy in the system. Two effects kinetic. denaturing
Effect of Temperature Increasing the temperature increases the energy in the system Two effects kinetic denaturing Kinetic effect Increased motion of molecules Increased collisions between enzyme/substrate
OT Exam 1, August 9, 2002 Page 1 of 8. Occupational Therapy Physiology, Summer Examination 1. August 9, 2002
Page 1 of 8 Occupational Therapy Physiology, Summer 2002 Examination 1 August 9, 2002 Dr. Heckman's section is questions 1-6 and each question is worth 5 points for a total of 30 points. Dr. Driska's section
Advanced Anatomy and Physiology
Lakeshore Technical College 10806179 Advanced Anatomy and Physiology Course Outcome Summary Course Information Alternate Title Description Total Credits 4 Total Hours 90 Adv Anatomy & Physiology Advanced
Adaptation, natural selection and evolution
Adaptation, natural selection and evolution Learning Intentions Give the meaning of the term mutation. State that mutations may be neutral, confer an advantage or a disadvantage. State that mutations are
Prentice Hall Biology: Exploring Life 2004 Correlated to: North Carolina Standard Course of Study and Grade Level Competencies, Biology (Grades 9-12)
North Carolina Standard Course of Study and Grade Level Competencies, Biology LEVEL COMPETENCIES (REVISED, 2004) BIOLOGY (If submission is not a book, cite appropriate location(s)) COMPETENCY GOAL 1: The
ENZYME KINETICS. Medical Biochemistry, Lecture 24
ENZYME KINETICS Medical Biochemistry, Lecture 24 Lecture 24, Outline Michaelis-Menten kinetics Interpretations and uses of the Michaelis- Menten equation Enzyme inhibitors: types and kinetics Enzyme Kinetics
Protein Architecture V: Evolution, Function & Classification. Lecture 9: Amino acid use units. Caveat: collagen is a. Margaret A. Daugherty.
Lecture 9: Protein Architecture V: Evolution, Function & Classification Margaret A. Daugherty Fall 2004 Amino acid use *Proteins don t use aa s equally; eg, most proteins not repeating units. Caveat: collagen
1 Molecular Ecotoxicology: From Man-Made Pollutants to Multiple Environmental Stresses
1 Molecular Ecotoxicology: From Man-Made Pollutants to Multiple Environmental Stresses H. Sandermann 1.1 Overview All life forms depend on plants as primary producers of food and feed and of substrates
non-host plants immunity basic resistance basic incompatibility avoidance pathogenicity factor host plant basic compatibility disease symptoms
1 Introduction The interactions between plants and phytopathogenic fungi are complex. The first studies of the processes involved pursued two questions: first what is the physiological and biochemical
Putnam County Public Schools Curriculum Map BIOLOGY Yearly Outlook First Nine Weeks Second Nine Weeks Third Nine Weeks Fourth Nine Weeks
Putnam County Public Schools Curriculum Map BIOLOGY Yearly Outlook 2018-2019 First Nine Weeks Second Nine Weeks Third Nine Weeks Fourth Nine Weeks Unit 1 Ecology* SC.912.L.17.2: Explain the general distribution
The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants
The Science of Plants in Agriculture Pl.Sci 102 Getting to Know Plants Growth and Development of Plants Growth and Development of Plants Why it s important to have knowledge about plant development. What
Generation Date: 12/07/2015 Generated By: Tristan Wiley Title: Bio I Winter Packet
Generation Date: 12/07/2015 Generated By: Tristan Wiley Title: Bio I Winter Packet 1. Many natural ecosystems have been destroyed by human activity. To better manage our remaining natural ecosystems, we
Chapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
Developed in Consultation with Florida Educators
Developed in Consultation with Florida Educators Table of Contents Next Generation Sunshine State Standards Correlation Chart............................... 6 Benchmarks Chapter 1 The Nature of Science...............
Acetylcholinesterase inhibition by nootkatone and carvacrol in arthropods
Entomology Publications Entomology 2-2012 Acetylcholinesterase inhibition by nootkatone and carvacrol in arthropods Jennifer A. Anderson Iowa State University Joel R. Coats Iowa State University, jcoats@iastate.edu
Bioengineering & Bioinformatics Summer Institute, Dept. Computational Biology, University of Pittsburgh, PGH, PA
Pharmacophore Model Development for the Identification of Novel Acetylcholinesterase Inhibitors Edwin Kamau Dept Chem & Biochem Kennesa State Uni ersit Kennesa GA 30144 Dept. Chem. & Biochem. Kennesaw
Evolutionary factors and synthetic biology
Evolutionary factors and synthetic biology NAS Joint Session on Climate Change and Ecology Owain Edwards Group Leader, Environmental Synthetic Genomics, CSIRO, Perth, Australia Domain Leader, Biocontrol
ANIMAL ECOLOGY (A ECL)
Animal Ecology (A ECL) 1 ANIMAL ECOLOGY (A ECL) Courses primarily for undergraduates: A ECL 312: Ecology (Cross-listed with BIOL, ENSCI). (3-3) Cr. 4. SS. Prereq: BIOL 211, BIOL 211L, BIOL 212, and BIOL
Membrane Protein Channels
Membrane Protein Channels Potassium ions queuing up in the potassium channel Pumps: 1000 s -1 Channels: 1000000 s -1 Pumps & Channels The lipid bilayer of biological membranes is intrinsically impermeable
NOTES: CH 48 Neurons, Synapses, and Signaling
NOTES: CH 48 Neurons, Synapses, and Signaling A nervous system has three overlapping functions: 1) SENSORY INPUT: signals from sensory receptors to integration centers 2) INTEGRATION: information from
BIOLOGY YEAR AT A GLANCE RESOURCE ( )
BIOLOGY YEAR AT A GLANCE RESOURCE (2016-17) DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/22 8/25/16 I. Introduction to Biology Lab 1: Seed Germination A. What is Biology B. Science in the real world
Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
Sequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
Advanced Higher Biology. Unit 1- Cells and Proteins 2c) Membrane Proteins
Advanced Higher Biology Unit 1- Cells and Proteins 2c) Membrane Proteins Membrane Structure Phospholipid bilayer Transmembrane protein Integral protein Movement of Molecules Across Membranes Phospholipid
BIOLOGY YEAR AT A GLANCE RESOURCE ( ) REVISED FOR HURRICANE DAYS
BIOLOGY YEAR AT A GLANCE RESOURCE (2017-18) REVISED FOR HURRICANE DAYS DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/21 8/24/17 I. Introduction to Biology A. What is Biology B. Science in the real
Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
OCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
Goal 1: Learner will develop abilities necessary to do and understand scientific inquiry.
Goal 1: Learner will develop abilities necessary to do and understand scientific inquiry. Objective Essential Questions/Extended Content Suggested Activities # Days What is the significance of scientific
OCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
Introduction 21 animals, where the aortic bodies successively compensate for the loss of carotid body function (Honda, 1992). Mechanism(s) of oxygen sensing and signalling and the role of nicotinic transmission
Georgia Performance Standards for Urban Watch Restoration Field Trips
Georgia Performance Standards for Field Trips 6 th grade S6E3. Students will recognize the significant role of water in earth processes. a. Explain that a large portion of the Earth s surface is water,
Unit G: Pest Management. Lesson 2: Managing Crop Diseases
Unit G: Pest Management Lesson 2: Managing Crop Diseases 1 Terms Abiotic disease Bacteria Biotic disease Cultural disease control Disease avoidance Disease resistance Disease tolerance Fungi Infectious
Curriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
Population Ecology. Study of populations in relation to the environment. Increase population size= endangered species
Population Basics Population Ecology Study of populations in relation to the environment Purpose: Increase population size= endangered species Decrease population size = pests, invasive species Maintain
Biological control of invasive weeds: the fight against the homogenization and decline of the earth s floral biodiversity
Biological control of invasive weeds: the fight against the homogenization and decline of the earth s floral biodiversity Bill Overholt Biological Control Research and Containment Laboratory Indian River
2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW
Name: Period: 2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW 1. List the characteristics of living things. (p 7) 2. Use the Aquatic Food Web above to answer the following questions (Ch. 2) a. Which
Chapter 5 Evolution of Biodiversity. Sunday, October 1, 17
Chapter 5 Evolution of Biodiversity CHAPTER INTRO: The Dung of the Devil Read and Answer Questions Provided Module 14 The Biodiversity of Earth After reading this module you should be able to understand
CST and FINAL EXAM REVIEW
Name Date Period CST and FINAL EXAM REVIEW Directions: Both your final exam and the CST (STAR) test are based on the California Standards. There are five major categories and they include: Investigation
ADVANCED PLACEMENT BIOLOGY
ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week
Distance Learning course Plant pathology and entomology Covered topics
Distance Learning course Plant pathology and entomology Covered topics The distance learning course Plant pathology and entomology consist of four online modules that treat with the main groups of plant
FOR RUMINANTS. kemin.com/guthealth
FOR RUMINANTS kemin.com/guthealth What is CLOSTAT? CLOSTAT contains a proprietary, patented strain of Bacillus subtilis PB6. PB6 is a unique, naturally occurring, spore-forming microorganism. Kemin has
MEMBRANE POTENTIALS AND ACTION POTENTIALS:
University of Jordan Faculty of Medicine Department of Physiology & Biochemistry Medical students, 2017/2018 +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Review: Membrane physiology