The lysine-299 residue endows multi-subunit Mrp1 antiporter

Transcription

1 AEM Accepted Manuscript Posted Online 9 March 2018 Appl. Environ. Microbiol. doi: /aem Copyright 2018 American Society for Microbiology. All Rights Reserved The lysine-299 residue endows multi-subunit Mrp1 antiporter with dominant roles in Na + -resistance and ph homeostasis in Corynebacterium glutamicum Ning Xu 1, Yingying Zheng 1, Xiaochen Wang 1, Terry A. Krulwich 2, Yanhe Ma 1, Jun Liu 1 1 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin , P. R. China 2 Department of Pharmacological Sciences, Icahn School of Medicine at Mount Sinai, New York 10029, USA The authors declare no conflict of interest. Running title: Physiological roles of C. glutamicum Na + /H + antiporter To whom correspondence should be addressed: Address: Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, 32 Xiqi Road, Tianjin Airport Economic Aera , P. R. China liu_jun@tib.cas.cn Tel: Abstract 1

2 Corynebacterium glutamicum is generally regarded as a moderately salt-alkali-tolerant industrial organism. However, relatively little is known about the molecular mechanisms underlying these specific adaptations. Here, we found that the Mrp1 antiporter played crucial roles in conferring both environmental Na + -resistance and alkali-tolerance, whereas the Mrp2 antiporter was necessary in coping with high KCl stress at alkaline ph. Furthermore, the mrp1mrp2 double mutant showed most severe growth retardation, and failed to grow under high salt or alkaline conditions. Consistent with growth properties, the Na + /H + antiporters of C. glutamicum were differentially expressed in response to specific salt or alkaline stress, and an alkaline stimulus particularly induced transcript levels of the Mrp-type antiporters. When the major Mrp1 antiporter was overwhelmed, C. glutamicum might employ alternative coordinate strategies to regulate antiport activities. Site-directed mutagenesis demonstrated that several conserved residues were required for optimal Na + resistance, such as Mrp1A-K 299, Mrp1C-I 76, Mrp1A-H 230 and Mrp1D-E 136. Moreover, the chromosomal replacement of lysine-299 in the Mrp1A subunit resulted in a higher intracellular Na + level and a more alkaline intracellular ph value, thereby causing a remarkable growth attenuation. Homology modelling of the Mrp1 sub-complex suggested two possible ion translocation pathways, and lysine-299 might exert its effect by affecting the stability and flexibility of cytoplasmic-facing channel in the Mrp1A subunit. Overall, these findings will provide new clues to the understanding of salt-alkali adaptation during C. glutamicum stress acclimatization. 45 Keywords: Corynebacterium glutamicum; Na + /H + antiporter; Mrp-type system; 2

3 46 expression pattern; site mutations Importance The capacity to adapt to harsh environments is crucial for bacterial survival and product yields, including industrially useful Corynebacterium glutamicum. Although C. glutamicum exhibits a marked resistance to salt-alkaline stress, the possible mechanism for these adaptations is still unclear. Here, we present the physiological functions, expression patterns of C. glutamicum putative Na + /H + antiporters, and conserved residues of Mrp1 subunits which respond to different salt and alkaline stresses. We found that the Mrp-type antiporters, particularly the Mrp1 antiporter, played a predominant role in maintaining intracellular non-toxic Na + levels and alkaline ph homeostasis. Loss of the major Mrp1 antiporter had a profound effect on gene expression of other antiporters under salt or alkaline condition. The lysine-299 residue may play its essential roles in conferring salt-alkaline tolerance by affecting the ion translocation channel of the Mrp1A subunit. These findings will contribute to better understanding of Na + /H + antiporters in sodium antiport and ph regulation Introduction 3

4 Bacteria (or prokaryotes) constantly encounter diverse environmental stresses throughout their lives, which for some organisms includes high salt and alkaline ph conditions (1). Bacteria have developed numerous efficient strategies to maintain cellular homeostasis and adapt to these external stress changes (2-6). One of these physiological strategies is governed by the monovalent cation/proton antiporter, commonly referred to as Na + /H + or K + /H + antiporters (7). These antiporters are widely distributed in prokaryotes and unicellular eukaryotes, and generally catalyze the efflux of intracellular cations such as Na +, Li +, K + and NH 4 + in exchange for external protons (8-10). Energized by the membrane potential, Na + /H + antiporters are essential for the establishment of an sodium electrochemical gradient that drives Na + -coupled solute uptake from the surrounding environments (11-13). In bacteria, the Na + /H + antiporters have been categorized into multiple different families according to sequence-based Transporter Classification system (3, 7, 14), including the CPA1-3 families (Cation/Proton Antiporter), the MFS family (Major Facilitator Superfamily), the CaCA family (Calcium/Cation Antiporter), and other as yet unclassified Na + /H + antiporters. Most characterized Na + /H + antiporters are individual hydrophobic gene products, whereas the Mrp-type antiporters, belonging to the CPA3 family, function as hetero-oligomeric complexes (10). Interestingly, most bacteria contain 85 at least 5~9 distinct Na + /H + antiporters, however, some organisms that are 86 exposed to numerous environmental stresses exhibit even higher numbers (7). 4

5 Although physiological characteristics of individual Na + /H + antiporters have been extensively investigated, the reason for which a bacterium contains so many different types of Na + /H + antiporters needs to be further elaborated. Krulwich TA et al (7) hypothesized that a particular antiporter could have a dominant role in confronting a specific condition, e.g. a high NaCl stress, while multiple types of Na + /H + antiporters with overlapping roles give the organism more opportunity to cover all contingencies. Thus, detailed information about specific properties and physiological roles of multiple Na + /H + antiporters will provide new insights into the strategies employed by various bacteria to cope with environmental challenges. The Mrp-type antiporter system is widely distributed among physiologically diverse prokaryotes, and most organisms contain only one Mrp-type system (10). However, several bacteria have dual Mrp-type systems, such as certain strains derived from Corynebacterium, Staphylococcus and Sinorhizobium species (7). The Mrp operon typically contains six (mrpacdefg) or seven (mrpabcdefg) genes encoding hydrophobic proteins, and all of them are required for optimal Mrp-dependent sodium and alkali resistance (10, 15, 16). However, the sole MrpA subunit derived from the archaeon Methanosarcina acetivorans is sufficient for antiport activity, challenging current dogma for Mrp complexes (17). The Mrp-type system generally functions as a secondary active transporter that is energized by an imposed transmembrane potential generated from proton-pumping respiratory 107 complexes or ATP hydrolysis. Many studies demonstrate that the Mrp-type 5

6 antiporter supports dominant roles in conferring tolerance to high salt and alkaline stresses in some bacteria, in contrast to other types of Na + /H + antiporters (10, 18, 19). One reason might be that the oligomeric structure of the Mrp-type system presents a larger proton-gathering surface, which facilitates the capture and flow of protons under higher ph conditions (10). In addition, three Mrp gene products, MrpA, MrpC and MrpD, exhibit a striking resemblance to membrane-embedded NuoL, NuoK, NuoM/N subunits of the NADH: quinone oxidoreductase (complex I) of the bacterial respiratory chains, providing another coherent explanation that there is a higher transmembrane potential in the presence of the Mrp-type antiporter (20-22). Structural complexity of the Mrp-type antiporter has made it difficult to fully discern the antiport mechanisms (10). Nevertheless, some attempts have been made to investigate the potential roles of single subunits or conserved motifs in the hetero-oligomeric Mrp-type antiporters. Two previous studies have revealed that both the G 393 site of BhMrpA protein and the G 82 site of BhMrpC protein are required for the alkaliphily of alkaliphilic Bacillus halodurans C-125 (23, 24). Site-directed mutagenesis studies of Bacillus subtilis Mrp antiporter have suggested that several acidic residues in BsMrpA and BsMrpD subunits are required for normal antiport activities instead of Mrp complex formation (25, 26). In alkaliphilic Bacillus pseudofirmus OF4, the BpMrpE subunit is required for normal 128 membrane levels of other Mrp proteins and the formation of a stable active Mrp 6

7 complex (27). Further studies about the effects of point mutations in 28 different sites throughout the BpMrp subunits indicated the importance of multiple amino acid residues in Na + /H + antiport activity, sodium exclusion or BpMrp complex formation, including the positions BpMrpA-K 299, BpMrpA-H 700, BpMrpD-E 137, BpMrpE-P 114 and BpMrpG-P 81 (28). Thus, more detailed characterization of the Mrp-type antiporters will undoubtedly expand our knowledge of the antiport mechanism. The Gram-positive soil bacterium Corynebacterium glutamicum is widely referred to as an industrial workhorse for amino acid production (29). However, the bacteria are usually confronted with numerous metabolic challenges and stress situations throughout industrial fermentation, leading to negative effects on biomass and product yields (30-33). Previous reports have suggested that C. glutamicum is a moderately salt-alkali tolerant organism with optimal growth at neutral-alkaline ph (31, 34). C. glutamicum genome sequences reveal that there are four putative Na + /H + antiporters, Mrp1, Mrp2, NhaP, and ChaA, belonging to the CPA3, CPA1 and CaCA families of secondary transporters, respectively (3). Our previous experiments suggest that only Mrp1 antiporter displays obvious Na + (Li + )/H + antiport activities with low apparent Km values, which enable Mrp1 to effectively rescue growth defects of the Na + -sensitive Escherichia coli KNabc strain, whereas other antiporters exhibit weaker antiport activities for monovalent 149 cations (34). The in vivo roles and mechanisms of these Na + /H + antiporters 7

8 conferring physiological adaptation are still unclear. In this study, we will report on efforts to explore the underlying mechanisms by which C. glutamicum Na + /H + antiporters affect physiology in the presence of complex salt-alkali stresses, and attempt to identify specific conserved sites necessary for the optimal activity of Mrp1 antiporter. 2. Results 2.1 The Mrp-type antiporters are involved in resistance to high salt and adaption to alkaline ph C. glutamicum is considered to be a moderately salt-tolerant organism that exhibits optimal growth at neutral-alkaline ph (31, 34). According to the sequence-based Transporter Classification system, C. glutamicum harbors at least four putative Na + /H + antiporters, including Mrp1, Mrp2, NhaP and ChaA, as shown in Fig. 1A. Sequence analyses reveal that both Mrp1 and Mrp2 are encoded by 6 individual genes in each operon, whereas the other two antiporters are encoded by a single gene. Four single antiporter-deficient mutants ( mrp1, mrp2, nhap, chaa) and a double antiporter-deficient mutant ( mrp1mrp2) were constructed to explore physiological roles of these antiporters in C. glutamicum. As shown in Fig. 1B, under no-stress condition at ph 7.0, only the mrp1 and mrp1mrp2 mutants showed moderate growth defects, and the complementation of specific mrp1 gene could partially restore the defective phenotypes of the mrp1 mutant. At alkaline ph, the mrp1 mutant displayed more serious growth 8

9 attenuation with a ph higher than 8.0, whereas the mrp2 mutant did not show growth differences compared with the wild-type strain. The mrp1mrp2 double mutant lost almost the ability to grow under high alkaline conditions. Under high NaCl conditions, deletion of mrp1 had an obvious negative effect on bacterial growth, which was exacerbated by increased ph values. However, the mrp2 mutant showed growth properties similar to the wild-type strain. The double mrp1 and mrp2 mutant almost completely lost the ability to grow in the presence of NaCl stress. When 0.6 M KCl was added instead, deletion of mrp2 resulted in a significant growth defect at ph 7.0, which was also exacerbated by increased ph values. Although deletion of mrp1 had a minor effect on cell growth, the mrp1mrp2 double mutant displayed a more serious growth defect in comparison to each single mutant. Furthermore, as shown in Fig. S1, deletion of nhap or chaa had no significant influence on cell growth either alkaline ph or high salt conditions. Our previous findings indicated that both C. glutamicum Mrp-type and NhaP antiporters exhibit detectable K + /H + antiport activities (34). Thus, we further employed the potassium transport-deficient E. coli TK2420 strain to investigate their potential roles. The E. coli TK2420 lacking three major K + uptake systems (Trk, Kup, and Kdp) exhibits severe growth retardation under K + -limiting or high-osmotic conditions (35). As shown in Fig. 1C, when grown in Ko minimal medium containing 115 mm NaCl as osmoticum, E. coli TK2420 derivatives failed to grow when KCl concentration was at and below 10 mm. Although an increased K + concentration improved the growth of most E. coli TK2420 derivatives, the cells 9

10 carrying C. glutamicum Mrp2 or NhaP antiporter still showed an obvious growth deficiency even in the presence of 100 mm KCl. The growth attenuation meant that intracellular K + content in these two mutants was still lower than the minimal requirement for normal growth. Interestingly, the E. coli TK2420 carrying E. coli nhaa or C. glutamicum mrp1 showed enhanced growth behaviors as compared to the control strain in the presence of 20 mm KCl. This might be attributed to a decrease in Na + osmotic pressure caused by these antiporters in the preferable Na + efflux from the cytoplasm. 2.2 Loss of Mrp-type antiporters affects intracellular Na + and ph homeostasis To investigate the potential mechanism underlying growth defects, we examined the intracellular Na + content and cytoplasmic ph (ph i ) levels in the Mrp-type antiporter deletions. As shown in Fig. 2A, the mrp1 mutant showed an elevated intracellular Na + concentration in comparison to wild-type cells, whereas the simultaneous deletion of mrp1 and mrp2 further exacerbates intracellular Na + accumulation. Fig. 2B showed that the mrp1 mutant exhibited a slightly more alkaline ph i level when compared to that of wild-type control under higher alkaline conditions. The mrp1mrp2 double mutant was unable to maintain its ph i homeostasis under alkaline conditions, showing no difference between internal and external ph values. These data were consistent with growth phenotypes of the markerless deletions, suggesting that C. glutamicum Mrp-type antiporters, especially the Mrp1 antiporter, played a predominant role in conferring Na + -resistance and alkali-tolerance. 2.3 C. glutamicum Na + /H + antiporters are differentially expressed in the alkaline 10

11 and salt stress response. In order to achieve a greater understanding of physiological roles of these Na + /H + antiporters in C. glutamicum, the absolute expression levels of these four antiporter genes in response to alkaline and salt stresses were determined (Table 1). Given that the mrp-type operons of C. glutamicum contain 6 different adjacent genes, we chose two representative genes (mrpa and mrpg) to evaluate the transcription patterns of whole operons. Under normal neutral ph conditions, the mrp2 operon showed higher transcript levels than three other genes (mrp1, nhap and chaa), reaching to approximately 304 copies per ng total cellular RNA. As compared to the non-inducing condition at ph 7.0, an alkaline stimulus induced transcription of Mrp-type antiporters but not nhap and chaa to high levels, further supporting a pivotal role of Mrp-type antiporters in the maintenance of ph homeostasis under alkaline conditions. When confronted with high NaCl or KCl challenges, C. glutamicum responded with significant elevations in the expression levels of Mrp-type and NhaP antiporters, consistent with previous findings that the Mrp-type and NhaP antiporters show clear Na + (K + )/H + antiport activity. Although biochemical and growth assays for ChaA antiporter revealed no obvious antiport activity (data not shown), the transcript levels of chaa gene in response to NaCl stress were also slightly induced, suggesting a possible minor role in conferring Na + resistance under specific conditions. The above assays exhibited that double deletion of mrp1 and mrp2 led to a more severe reduction of cell growth under tested conditions. One explanation for this phenomenon is that C. glutamicum might have alternative regulatory 11

12 strategies, such as a functional redundancy and/or compensatory up-regulation mechanism, to rescue negative effects caused by single mrp1 disruption. To test this hypothesis, relative transcript levels of the three other antiporters in the mrp1 mutant versus wild-type strain, were analyzed under high salt and alkaline ph conditions. As shown in Fig. 3, loss of the mrp1 gene had no significant influence on the expression levels of the three other antiporters under normal neutral ph conditions. Salt stress elevated the transcript levels of both mrp2 and nhap when the mrp1 gene was absent, whereas the expression of chaa antiporter was not affected. Furthermore, the relative levels of gene expression for all three other antiporters in the mrp1 mutant were clearly higher than those of wild-type strain under alkaline conditions. 2.4 Overexpression of the mrp1 gene improves salt tolerance under specific stress conditions. Given to the importance of Mrp-type antiporters in efficient Na + -resistance, we attempted to improve salt tolerance of C. glutamicum strain by altering its gene expression. The native promoter of either the mrp1 or mrp2 was exchanged by C. glutamicum promoters with different strengths, including a strong promoter of sod gene (encoding for superoxide dismutase) and a relatively weak promoter of ilva gene (encoding for threonine dehydratase) (36). As shown in Fig. 4, although the replacement of native mrp1 promoter by the Psod or PilvA promoter significantly improved growth performance in response to high LiCl stress (another substrate molecule for the Mrp-type antiporter), there was no obvious effect on cell growth in the presence of added NaCl at ph 7.0. However, the overexpression of mrp1 12

13 slightly improved growth ability under mixed salt-alkaline stress conditions. Moreover, the overexpression of mrp2 gene under the control of PilvA promoter had little influence on growth phenotypes, whereas the exchange of strong Psod promoter resulted in an unexpected deleterious effect under salt stress conditions. 2.5 Site-specific mutagenesis of C. glumacium Mrp1 antiporter reveals several conserved residues conferring Na + resistance. We further performed multiple sequence alignment among C. glutamicum Mrp1 subunits and other Mrp-related subunits, attempting to investigate residues that are required for Na + resistance. The Mrp antiporter-like NADH dehydrogenase subunits NuoL, NuoK, and NuoM/N from E. coli and Thermus thermophilus were also aligned. Nine different conserved sites were selected for point mutations, and were shown in Fig. 5A and Fig. S2. Six highly conserved residues across all tested Mrp-type subunits were chosen, including Mrp1A-K 299, Mrp1C-I 76, Mrp1D-E 136, Mrp1E-P 61, Mrp1F-R 35 and Mrp1G-R 28. These conserved residues were replaced by amino acids showing similar chemical or structural properties. The other three additional replacements were chosen based on the combination of conserved motif and functional prediction. The Mrp1A-H 230 residue was inferred to be a potential quinone binding site based on a published report showing that the corresponding histidine-224 site of E. coli NuoN might participate in proton translocation (37). The Mrp1A-H 499 residue was deemed to be a potential quinone-binding site, meeting the criteria of a putative quinone-binding motif ( 495 -LX 3 HX 3 T- 503 ) proposed for the respiratory complex by Fisher and Rich 13

14 (38). The Mrp1A-G 378 was included because of the finding that the corresponding BhMrp1A-G 393 residue of alkaliphilic Bacillus halodurans C-125 was required for Na + /H + antiporter activity (23). The complementation assay of Na + -sensitive E. coli KNabc strain was performed to determine relative importance of these residues. The E. coli KNabc strain lacking three major Na + /H + antiporters is highly sensitive to the presence of Na + and fails to grow at 200 mm NaCl (34). As shown in Fig. 5B, in the presence of 200 mm NaCl, several point mutants showed remarkably impaired growth in comparison with the control strain carrying the original mrp1 operon. In particular, the mrp1a-k299h mutated plasmid did not allow E. coli KNabc growth with NaCl treatment. The mrp1c-i76f mutated plasmid led to an approximately 50% reduction in the capacity to confer Na + resistance. In addition, two other point mutants, mrp1a-h230k and mrp1d-e136d, also exhibited reduced capacity to rescue growth deficiency. As shown in Fig 5C, at the higher NaCl concentrations up to 400 mm, growth defects of these above mutants were more severe, and nearly all point mutants showed clear growth retardation, suggesting that most residues had different degrees of effects on bacterial growth in response to high salt stresses. 2.6 Lys-299 was essential for Na + resistance and ph homeostasis. To further characterize residues required for Mrp1 activity, four point mutations were introduced into the chromosomal gene of interest, and growth assays were carried out under different stress conditions. As shown in Fig. 6A, C. glutamicum Mrp1A-K299H mutant strain exhibited remarkable growth defects 14

15 under high NaCl or alkaline conditions. These defects were more severe than the mrp1 single mutant but quite similar to the mrp1mrp2 double mutant. Complementation assays confirmed that the reverse mutation of the Mrp1A-K299H strain completely restored all phenotypes to wild-type levels under tested conditions (Fig. S3). As also shown in Fig. 6A, increased ph exacerbated the growth defects with the addition of high NaCl. The Mrp1D-E136D mutant strain had growth phenotypes similar to those of the Mrp1C-I76F mutant strain, which almost lost the capacity to grow in the presence of 0.6 M NaCl at ph 9.0 or 1.0 M NaCl at ph 8.0. The Mrp1A-H230K mutant strain displayed relatively high NaCl tolerance, only showing a defective phenotype when the concentration of NaCl reached 1.0 M at ph 9.0. Consistent with growth phenotypes, the Mrp1A-K299H mutant strain showed a significantly elevated ph i compared to the wild-type strain at alkaline ph, implying that it lost its capacity to maintain ph i homeostasis (Fig. 6B). Although the point mutation of Mrp1A-H 230 residue had no obvious effect on cell growth in the range of ph 7.0 to 9.0, the ph i of the mutant strain is more alkaline when exposed to ph 9.0, suggesting a potential contribution of the residue to proton transfer. In addition, two other site mutants showed equal ph i levels with the wild-type strain. As shown in Fig. 6C, the Mrp1A-K299H mutant strain had highest intracellular Na + content when confronted with NaCl treatments at either neutral or alkaline ph, which was approximately three-fold higher than the wild-type strain. Site mutations in Mrp1C-I 76 and Mrp1D-E 136 also resulted in an increased accumulation of intracellular Na +, which was almost the same as that of the mrp1 15

16 mutant. However, the replacement of histidine with lysine in Mrp1A-H 230 had no significant effect on intracellular Na + content. The effects of these point mutations on gene expression of Na + /H + antiporters were also determined. As shown in Fig. S4A, under normal neutral ph conditions, the mutations of Mrp1A and Mrp1C subunits showed similar expression patterns with the wild-type strain, whereas residue replacement in Mrp1D-E 136 slightly increased expression levels of mrp2 and nhap. Under high NaCl or alkaline ph conditions, the residue replacements in Mrp1A-K 299 or Mrp1D-E 136 enhanced gene expression of the mrp1, mrp2 and nhap to different degrees (Fig. S4B and S4C). The increased transcription of these Na + /H + antiporters still failed to rescue growth defects of the Mrp1A-K 299 H mutant, ruling out the possibility that the effects of Mrp1 point mutations on Na + /H + antiport activity were exerted at the transcriptional levels. 2.7 Homology molecular model of the Mrp1 antiporter provided a possible ion translocation mechanism. The modelled structure of Mrp1 antiporter was constructed based on the homologous structure of T. thermophilus respiratory complex I. As shown in Fig. S5, the Mrp1A, Mrp1C and MrpD form a functional antiporter unit, which is quite similar to the NuoL-NuoJ-NuoK membrane domain of respiratory complex I. Based on sequence alignment and structure prediction, the Mrp1A or Mrp1D model reveals a putative ion translocation pathway (Fig. 7). The pathway is continuous from the cytoplasm to the periplasm and has two half-closed symmetry-related channels. The cytoplasm-facing channel of Mrp1A subunit is 16

17 surrounded by S113, E142, S148, T170 and K223. The periplasm-facing channel of Mrp1A subunit contains S305, S308, H331, S393, K394, E395, T425, Y428 and S429. Several highly conserved charged or polar residues exist to connect these two channels, including H248, T306, H335 and K339, which are required for intact ion translocation pathway. The Mrp1D subunit also has a similar ion translocation pathway. The cytoplasm-facing channel of Mrp1D subunit is formed by Y108, E136, S142, Y143, N165, S169 and K215. The periplasm-facing channel of Mrp1D subunit contains Q298, Y327, S377, G389, K390, S416 and S422. The channels are connected by many essential polar residues, including G242, T245 and K246. The modelled structure of Mrp1 sub-complex provides new insights into the underlying mechanisms of ion antiport and ph regulation. The lysine-299 is located near the middle of transmembrane (TM) segment 8 and TM9 segments in Mrp1A subunit, and forms an intermolecular hydrogen bond with methionine-237 in the loop between TM6 and TM7 segments (Fig. 7, left). Given that the key residue H248 involved in the coupling of Na + or proton translocation locates at TM7 segment (39, 40), we speculate that loss of hydrogen bonding interaction might affect conformational changes and intrinsic flexibility of the Mrp1A subunit, causing an unanticipated ion leakage during salt-alkaline stress responses. The glutamate-136 is located at the cytoplasmic-facing channel of Mrp1D subunit (Fig. 7, right). The growth defects of the Mrp1D-E 136 D mutant might be attributed to the disturbance of the ion translocation pathway caused by residue substitution (39). In addition, the histidine-230 lies in the TM6 segment of Mrp1A subunit, and the isoleucine-76 is located at a highly conserved 17

18 transmembrane region of Mrp1C subunit. However, the potential roles of these two residues in the catalytic activity of Mrp1 antiporter were still unclear Discussion The industrial organisms, including C. glutamicum, are often subjected to diverse stress challenges during industrial fermentation, which could be caused by nutrient limitations or environmental stresses such as the alterations in external ph, osmolality, temperature and oxygen availability, as well as increased toxic salt concentrations. Apart from the accumulation of so-called compatible solutes in the cytoplasm, the Na + /H + antiporters also play an important role in enhancing bacterial stress tolerance (4, 7, 30). In this study, our results demonstrate that the Mrp-type antiporters, especially the Mrp1 antiporter, play a predominant role in C. glutamicum Na + -resistance and alkali-tolerance, and the Mrp2 antiporter is critical for mediating cellular K + tolerance at alkaline ph. These observations are consistent with previous findings in many Bacillus alkaliphiles (7, 18, 19). Besides, the mrp1mrp2 double mutant exhibited more severe growth defects as compared to each single mutant. These growth properties are consistent with previous finding that the Mrp2 antiporter also has a small but clear Na + /H + antiport activity (34), indicating that the Mrp2 antiporter might function as a great substitute in response to high NaCl or alkaline ph challenges, particularly when the Mrp1 antiporter is overwhelmed. In addition, growth experiments performed with E. coli mutants suggest that the Mrp2 and NhaP antiporters might be major 18

19 contributors to intracellular K + efflux, while growth assays performed with C. glutamicum mutants reveal that the Mrp-type antiporters, in particular the Mrp2 antiporter, were primary resistance determinants under high KCl stresses. One possible explanation for this discrepancy is that the Mrp-type antiporters play a leading role in reducing the cytoplasmic toxic KCl concentration, which could mask the adverse effects due to the absence of NhaP antiporter. As for the Mrp1 antiporter, its heterologous expression has no significant impact on the growth of potassium transport-deficient E. coli TK2420 strain, which could be attributed to the fact that the Mrp1 antiporter exhibits both obvious Na + /H + and K + /H + antiport activities, leading to the alleviation of intracellular Na + toxicity (34). Our results show the physiological importance of the Mrp-type antiporters in C. glutamicum stress adaptation. Although functional characterization of the Na + /H + antiporters has made great progress over the past few years, relatively little work has focused on gene expression patterns of these Na + /H + antiporters (2, 3, 7). Several reports have shown that alkaline ph or salt stresses affect the expression of certain Na + /H + antiporters, such as E. coli nhaa gene and the Bacillus subtilis mrp operon (41-43). In accord with growth phenotypes, our study also indicates that C. 418 glutamicum Na + /H + antiporters are differentially expressed under high salt or alkaline ph stress conditions. Further investigations confirmed that the loss of Mrp1 antiporter has a profound effect on gene expression levels of other 19

20 antiporters when exposed to high salt or alkaline ph stress. The mrp1 mutant exhibited a higher intracellular Na + content under salt-stress conditions, and a slightly elevated ph i level at alkaline ph. Thus, we proposed a simple model about physiological roles of C. glutamicum Na + /H + antiporters in the adaptation to environmental stresses (Fig. 8). In wild-type cells, salt stress typically results in the accumulation of intracellular Na + or K +, thereby differentially increasing the transcription of the mrp-type and nhap genes through as yet uncharacterized regulatory pathways, which eventually contribute to pumping of toxic Na + or K + out of cells. Interestingly, NaCl stress also has a slight effect on the expression of the chaa gene. Additionally, an alkaline stimulus leads to a disturbance of cytoplasmic ph homeostasis, and then significantly up-regulates transcription levels of the mrp-type gene in C. glutamicum. In the mrp1 cells, there might be an alternative regulatory strategy to rescue negative effects caused by the absence of Mrp1 antiporter. As shown in Fig 2, deletion of Mrp1 antiporter clearly led to intracellular Na + accumulation under NaCl stress, and caused a more alkaline phi at higher ph (i.e. ph 9.0). The increase of intracellular Na + and phi could directly and/or indirectly trigger higher expression levels of mrp2 and nhap in response to salt stress, or elevate transcript levels of the three other antiporters to various degrees to protect from alkaline damages. In short, the diverse expression patterns and overlapping roles of C. glutamicum Na + /H + antiporters 441 would help the strain cope with multiple environmental challenges. 20

21 Previous reports have revealed that there is a close evolutionary link between the Mrp antiporter and complex I subunits (17, 39). The subunits MrpA and MrpD of the Mrp antiporter share similar ion translocation pathways with complex I subunits NuoL and NuoM, respectively. Sazanov et al (39) proposed a model in which both MrpA and MrpD subunits of Bacillus subtilis Mrp antiporter harbor proton transport channels, whereas the interface of MrpA and MrpD forms a Na + transport pathway. Highly conserved glutamic acid residues at the MrpA-MrpD interface function as putative cation binding sites. In addition, experimental evidence suggested that the individual NuoL subunit of complex I has an obvious Na + /H + antiporter activity, and could restore the defective phenotypes of an mrpa-deficient strain (44-46). In the absence of NuoL subunit, E. coli complex I still translocates H + but does not transport Na +, suggesting its dual relation with H + and Na + as the coupling ions (47, 48). In this study, we presented a homology model of the subunits of Mrp antiporters using T. thermophilus respiratory complex I as templates, which show very similar ion translocation pathways with the model of B. subtilis Mrp antiporter. Many key residues, including E132, K223, H248, K394 of MrpA subunit, and E136, K215, K246, K390 of MrpD subunit, are also located in or near ion translocation pathways. However, although the MrpA subunit from C. glutamicum Mrp1 antiporter reveals a possible ion channel, more direct experimental evidence is needed to determine whether the pathway 462 transports Na +. 21

22 The important roles of lysine residues in antiport activity in the Mrp-type and proton-pumping complex have also been explored in multiple previous studies (28, 37, 39, 49). In this study, we found that the lysine-299 residue of Mrp1A subunit plays essential roles in Na + -resistance and alkali-tolerance. Although the Mrp1A-K299H mutant strain showed obvious increased transcription of mrp1, mrp2 and nhap, the mutant still lost the capacity to survive in high NaCl or alkaline conditions, ruling out the effects of compensatory regulatory strategies. We speculate that the lysine-299 residue might be involved in Na + or proton transfer. The replacement of lysine with histidine might affect the conformational freedom of ion translocation pathway, resulting in an unanticipated ion leakage of the Mrp1A subunit. This site mutation of lysine-299 renders Mrp1A subunit nonfunctional, and thus results in a deleterious effect on the roles of the Mrp-type antiporter. Further work will be needed to fully address this hypothesis. In general, although several conserved residues among the Mrp1 complex have been shown to be important for optimal Na + resistance, the precise molecular mechanism is still not clear. Further elaboration of this underlying mechanisms will provide new insights into our understanding of the relationships between amino acid residue and functional properties of the Mrp-type antiporters. 4. Materials and Methods 4.1 Strains and growth conditions Bacterial strains and plasmids used in this study are listed in Table 2. E. coli 22

23 DH5α or HST02 was used as host cell for general cloning. E. coli KNabc lacking three major Na + /H + antiporters (NhaA, NhaB and ChaA) was used as the Na + /H + antiporter-deficient background strain (50). E. coli TK2420 lacking three major K + uptake systems (Trk, Kup and Kdp) was used as the K + transport-deficient background strain (35). C. glutamicum ATCC was used as the wild-type strain in the functional analysis and as the parental strain for gene disruption. The plasmids used for heterologous expression in E. coli cells were pmw118 derivatives. E. coli KNabc and its derivatives were routinely grown at 37 C in LBK medium (0.5% yeast extract, 1% tryptone, 0.6% KCl) supplemented with indicated NaCl concentrations. E. coli TK2420 and its derivatives were routinely grown at 37 C in Ko medium (46 mm Na 2 HPO 4, 23 mm NaH 2 PO 4, 8 mm (NH 4 ) 2 SO 4, 0.4 mm MgSO 4, 6 μm FeSO 4, 1 mm sodium citrate, 1 mg L -1 thiamine, 2 g L -1 glucose) supplemented with indicated KCl concentrations. For growth assay experiments, C. glutamicum was pre-grown in A-rich medium (2 g L -1 yeast extract, 7 g L -1 casamino acids, 2 g L -1 urea, 7 g L -1 (NH 4 ) 2 SO 4, 0.5 g L -1 KH 2 PO 4, 0.5 g L -1 K 2 H 2 PO 4, 0.5 g L -1 MgSO 4 7H 2 O, 6 mg L -1 Fe 2 SO 4 7H 2 O, 4.2 mg L -1 Mn 2 SO 4 H 2 O, 0.2 mg L -1 biotin, 0.2 mg L -1 thiamine) with 4% glucose at 32 C (51), washed and resuspended to fresh LBO medium (0.5% yeast extract, 1% tryptone) containing indicated NaCl or KCl concentrations and buffered with 50 mm Bis-Tris-Propane (BTP) to different ph values. When appropriate, antibiotics were added to a final concentrations of 100 μg ml -1 ampicilin, 25 μg ml -1 kanamycin or 5 μg ml -1 chloramphenicol, and 10 μm IPTG was used for induction of gene expression. 23

24 Strain construction and complementation of markerless deletions The primers used in this study are listed in Table 3. C. glutamicum mutant strains were achieved by a two-step homologous recombination using the temperature-sensitive plasmid pcrd206 as described previously (51). To avoid polar effects, markerless chromosomal in-frame deletions were constructed. For example, the mrp1 mutant was constructed as follows: the mrp1a upstream flanking region, including the first ten codons of mrp1a gene, and the mrp1g downstream flanking region, including the last eight codons of mrp1g gene were amplified with the Phusion High-Fidelity DNA Polymerase (Thermo Scientific, USA) using the primer pairs mrp1-1-for/mrp1-2-rev and mrp1-3-for/mrp1-4-rev, respectively. These two fragments were then fused by overlap extension PCR using the primer pairs mrp1-1-for/mrp1-4-rev. The final PCR product was digested with BamHI and XbaI, ligated into the same sites of pcrd206, and directly transformed into E. coli HST02 host cells to yield the pcrd206-mrp1 plasmid. The resulting plasmid was then transformed into C. glutamicum ATCC by the electroporation method. The mrp1 deletion mutant was obtained through the first temperature-selection and the second sucrose-selection steps. The correct mutants were confirmed by colony-pcr with the primer pairs mrp1-uf/mrp1-dr. In addition, the mrp1mrp2 double mutant was obtained by transformation of the pcrd206-mrp2 plasmid into C. glutamicum mrp1 single 527 mutant, and the screening of double-crossover candidates was performed 24

25 through the above procedure. Other C. glutamicum strains containing gene disruption, point mutation or reverse mutation at the chromosomal level were also generated according to a similar strategy. Chromosomal replacement of native mrp1 promoters by the strong sod promoter was performed as follows: a part of the upstream sequence of the mrp1 gene containing an overlapping sequence with the sod promoter at the 3 -end was amplified with the primers mrp1-1-for and mrp1-psod-2-rev, a part of the mrp1 gene containing the start codon and overlapping sequence with the sod promoter at the 5 -end was amplified with the primers mrp1-psod-5-for and mrp1-6-rev, and the sod-promoter containing the overlapping sequence was amplified using primers Psod-3-For and mrp1-psod-4-rev. These three PCR products were mixed together and used as a template for a fusion fragment with the primers mrp1-1-for and mrp1-6-rev. The final PCR product was digested with BamHI and XbaI, ligated into the same sites of pcrd206 to yield the pcrd206-psod-mrp1 plasmid. This resulting plasmid was then transformed into C. glutamicum ATCC by the electroporation method. The Psod-mrp1 strain was obtained by a two-step homologous recombination. Similar procedures were employed to generate other promoter replacements in C. glutamicum. The plasmids for complementation of the markerless deletions were built using the shuttle vector pxmj19. The mrp1 full-length encoding fragments was 548 amplified from genomic DNA template with the primer pairs mrp1-5comp and 25

26 mrp1-3comp. The PCR product was digested with XbaI and SmaI, and ligated into the same sites of pxmj19 to generate inducible expression vector pxmj19-mrp1. The pxmj19-mrp2 vector was generated according to the similar strategy. The inducible expression vector was transformed into the mrp1 or mrp2 mutant to obtain the complemented strain. All the constructs in this study were confirmed by DNA sequencing. 4.3 Growth experiments The cultures of C. glutamicum were grown for 16 hours at 32 C with shaking at 200 rpm prior to growth experiments. Overnight cultures were then washed, and resuspended in fresh LBO medium to OD 600 of µl of cell suspensions was inoculated into 190 μl of corresponding medium in the 96-well microtiter plates, and incubated with shaking at 800 rpm at 32 C in a Microtron shaking incubator (INFORS-HT, Switzerland). OD 600 readings were collected every two hour. Growth curves are averages of at least three independent experiments done in duplicate repeats. The potassium uptake-deficient E. coli TK2420 cells carrying the empty vector pmw118 or its derivatives were pre-grown overnight in LB medium at 37 C. The cultures were harvested, washed, and resuspended in standard minimal Ko medium with OD 600 of μl of cell suspensions was respectively inoculated into 4 ml Ko medium containing the indicated KCl concentrations. Growth was 569 determined by measuring the optical density after 24 h incubation in a 37 C 26

27 shaking incubator. 4.4 Nucleic acid extraction and purification Chromosomal DNA isolation from C. glutamicum cells was performed using the E.Z.N.A. bacterial DNA kit (Omega Bio-tek, USA) according to the manufacturer's instructions. Before RNA preparation, cells were harvested, snap-frozen in liquid nitrogen and immediately stored at -80 C. The pellets were resuspended in 100 μl of TE buffer (10 mm Tris-Cl, ph 7.5, 1 mm EDTA) with 10 mg ml -1 lysozyme, and mechanically disrupted with glass beads by three 2-min pulses in the Biospec Mini-beadbeater. Total RNA from indicated C. glutamicum cells was isolated using the RNAprep Pure Cell/Bacteria Kit and DNaseI on-column treatment (Tiangen Biotech, China). The quality and quantity of isolated total RNA were assessed using the Nanodrop ND-1000 spectrophotometer (Thermo Scientific, USA) and formaldehyde denaturing agarose gel electrophoresis. The isolated total RNA was used as template for the amplification of PCR controls to rule out DNA contamination (data not shown). For cdna synthesis procedure, 1 μg of total RNA was reverse transcribed with the RevertAid First Strand cdna synthesis kit (Thermo Scientific, USA), and the First strand cdna can be directly used as the template in the subsequent PCR assay. 4.5 Quantitative real-time reverse transcription PCR (qpcr) The absolute and relative qpcr were performed to calculate the expression 590 levels of target genes. Overnight cultures of C. glutamicum strains were 27

28 pre-grown to mid-exponential phase (OD ) in rich medium at 32 C. Then, cells were respectively harvested, shifted to the corresponding medium buffered with 50 mm BTP, and incubated for a further 2 h before RNA extraction. For the relative qpcr analysis, the reaction mixtures were prepared with SYBR Green Real time PCR Master Mix (Toyobo, Japan) according to the manufacturer s instructions. The primers used in this procedure are listed in Table 4. The relative qpcr was usually performed in triplicate for samples, and repeated in three independent experiments using an Applied Biosystems 7500 fast real-time PCR system (Thermo Scientific, USA). Thermocycling conditions were as follows: 1 min at 95 C; 40 cycles of 95 C for 15 s, 60 C for 15 s and 72 C for 45 s; a final step of 95 C for 15 s, 60 C for 15 s and 95 C for 15 s. The relative fold changes in gene expression were calculated according to the delta delta threshold cycle method after normalization using 16S rrna or gyrb as the reference gene (52). Similar results were obtained for the two different reference genes, and 16S rrna was used as the reference gene for normalization in the following results. For the absolute qpcr analysis, the standards for target and reference gene transcripts were obtained by PCR using C. glutamicum chromosomal DNA as the template, and the primers used in this procedure are listed in Table 4. After gel extraction, the concentrations of standards were measured in ng μl -1 using the Nanodrop spectrophotometer, and converted to copies μl -1 based on the molecular weight of PCR products. Individual standards were diluted to produce stocks at

29 copies μl -1, and then combined to produce a master mix of standards for all genes of interest at 10 8 copies μl -1. The standards for absolute quantitation were generated for concentrations ranging from 10 7 to 10 1 copies μl -1 by ten-fold serial dilutions. Standard curves were constructed by plotting threshold cycle values against log template concentrations of each gene. The absolute transcript copies of target genes were analyzed based on standard curves by the qpcr assays. 4.6 Site-directed mutagenesis Site-directed mutagenesis of the conserved amino acid residues from Mrp1 antiporter was generated by PCR using oligonucleotide primers pairs with the desired mismatching nucleotides (53). The primers used in this study are listed in Table 5. The pmw118-mrp1a-h 230 K mutated plasmid was constructed as follows: The pmw118-mrp1 plasmid, containing all six genes of mrp1acdefg, was used as the parental template. The primer pairs Mrp1A-H230K-5F/ Mrp1A-H230K-3R were designed with mutated bases at the center of the oligonucleotides. The PCR products were digested with DpnI to remove methylated parental plasmid, and transformed into E. coli DH5α to screen correct transformants. Similar strategies were performed for the construction of other site mutated plasmids. All constructs were confirmed by DNA sequencing, and the correct mutations were respectively transformed into E. coli KNabc host cells for further experiments. 4.7 Measurement of cytoplasmic ph and intracellular Na + content 632 Cytoplasmic ph was determined by using the ph-sensitive fluorescent probe 29

30 ,7 -bis-(2-carboxyethyl)-5-6-carboxyfluorescein (BCECF) as previously described with some modification (54). The pre-cultures of indicated strains were harvested at the mid-exponential growth phase (OD ), washed and resuspended in LBO medium buffered to the indicated ph values, and then incubated with 2.0 μm BCECF-acetoxymethylester (Sigma-Aldrich, Germany) at 32 C for 30 min in the dark. For analysis of intracellular ph (ph i ) values, cells were washed with fresh medium, and 100 μl of cell suspension was transferred to 96-well microplates. The fluorescence was measured using the SpectraMax M5 Microplate Reader at 535 nm emission wavelength after the dual excitation at 440 nm and 490 nm. The ph-dependent spectral shifts exhibited by BCECF allow the calibration of ph response in terms of the ratio of fluorescence intensities measured at two different excitation wavelengths. An in situ calibration curve for BCECF excitation ratio was performed by incubating cells at various external ph values between ph 6.0 and ph 9.0, in the presence of a mixture of 150 μm KCl, 10 μm nigericin, 50 μm carbonyl cyanide-3-chlorophenylhydrazone, 20 μg ml -1 valinomycin and 50 μg ml -1 gramicidin in order to equilibrate the intracellular with external ph values. The cytoplasmic ph was estimated using a standard calibration curve obtained from the normalized emission values correlated with the controlled external ph values. Intracellular Na + content was quantified by the inductively coupled plasma 653 optical emission spectrometer (ICP-OES) analysis as described previously (55). 30

31 Briefly, C. glutamicum cells were harvested at the mid-exponential growth phase (OD ), resuspended directly in an equal volume of LBO M NaCl medium at the indicated ph, and incubated for a further 60 min at 32 C. The strains were then pelleted by centrifugation, washed six times with distilled-deionized water to remove any exogenous sodium in the medium, and finally digested with a mixture of HNO 3 -HClO 4 (3:1) solution. The quantification of Na + content in the indicated sample was analyzed using a Perkin Elmer Optima 8300 ICP-OES, and shown as ng/10 8 cells. The total number of cells in the sample was calculated by counting the number of colonies in the gradient dilution plates. 4.8 Homology molecular modeling Multiple sequence alignment among C. glutamicum Mrp1 subunits and other Mrp homologs derived from alkaliphiles, neutralophiles, and pathogens were performed by Clustal Omega and ESPript 3.0 server (56, 57). The molecular models of N-terminal (Mrp1A_N) and C-terminal (Mrp1A_C) domains of Mrp1A antiporter were respectively built using the crystal structures of homologous subunits NuoL (PDB ID: 4HEA) and NuoJ (PDB ID: 4HEA) from Thermus thermophilus respiratory complex I as the templates (20). The Mrp1C model was generated using a template based on homologous structure of NuoK subunit (PDB ID: 4HEA) from T. thermophilus respiratory complex I, and the Mrp1D model 674 was obtained using templates of homologous subunit NuoM/N (PDB ID: 3RKO) 31

32 from E. coli respiratory complex I (40). The homology models were built using the Phyre 2 molecular modeling server (58), and checked with the RAMPAGE server (59). The combinations of the ø and ψ angles of residues in favored, allowed and outlier regions of Ramachandran plot were qualified (Table S1 and Fig. S6), and the assessment indicated that the homology models were reliable for structural analyses. The tentative structure of Mrp1 sub-complex was constructed by merging independent models of Mrp1A_N, Mrp1A_C, Mrp1C and Mrp1D using the PyMOL Molecular Graphics System based on the template of T. thermophilus NuoLJKMN model (PDB ID: 4HEA). Acknowledgements We are grateful to Prof. Masayuki Inui (Research Institute of Innovative Technology for the Earth, Japan) for generously providing plasmids. We also thank David B. Hicks for carefully proofreading our manuscript. This study was supported by the National Natural Science Foundation of China (No ), the Natural Science Foundation of Tianjin (No. 17JCQNJC09600, No. 17JCYBJC24000), and the National Institute of Health (R01 GM ), as well as Hundred Talents Program of the Chinese Academy of Sciences Reference 1. Rangel DEN Stress induced cross-protection against environmental 32

33 challenges on prokaryotic and eukaryotic microbes. World J Microb Biot 27: Krulwich TA, Sachs G, Padan E Molecular aspects of bacterial ph sensing and homeostasis. Nat Rev Microbiol 9: Padan E, Bibi E, Ito M, Krulwich TA Alkaline ph homeostasis in bacteria: new insights. Biochim Biophys Acta 1717: Vyrides I, Stuckey DC Adaptation of anaerobic biomass to saline conditions: Role of compatible solutes and extracellular polysaccharides. Enzyme Microb Tech 44: Spanheimer R, Muller V The molecular basis of salt adaptation in Methanosarcina mazei Go1. Arch Microbiol 190: Kramer R Bacterial stimulus perception and signal transduction: response to osmotic stress. Chem Rec 10: Krulwich TA, Hicks DB, Ito M Cation/proton antiporter complements of bacteria: why so large and diverse? Mol Microbiol 74: Chanroj S, Wang G, Venema K, Zhang MW, Delwiche CF, Sze H Conserved and diversified gene families of monovalent cation/h + antiporters from algae to flowering plants. Front Plant Sci 3: Padan E, Venturi M, Gerchman Y, Dover N Na + /H + antiporters. Biochim Biophys Acta 1505: Swartz TH, Ikewada S, Ishikawa O, Ito M, Krulwich TA The Mrp system: a giant among monovalent cation/proton antiporters? Extremophiles 9: Albers SV, Van de Vossenberg JL, Driessen AJ, Konings WN Bioenergetics and solute uptake under extreme conditions. Extremophiles 5: Krulwich TA, Ito M, Guffanti AA The Na + -dependence of alkaliphily in 33

34 Bacillus. Biochim Biophys Acta-Bioenergetics 1505: Uzdavinys P, Coincon M, Nji E, Ndi M, Winkelmann I, von Ballmoos C, Drew D Dissecting the proton transport pathway in electrogenic Na + /H + antiporters. Proc Natl Acad Sci U S A 114:E1101-E Saier MH, Jr., Tran CV, Barabote RD TCDB: the Transporter Classification Database for membrane transport protein analyses and information. Nucleic Acids Res 34:D Morino M, Suzuki T, Ito M, Krulwich TA Purification and functional reconstitution of a seven-subunit mrp-type Na + /H + antiporter. J Bacteriol 196: Kajiyama Y, Otagiri M, Sekiguchi J, Kosono S, Kudo T Complex formation by the mrpabcdefg gene products, which constitute a principal Na + /H + antiporter in Bacillus subtilis. J Bacteriol 189: Jasso-Chavez R, Diaz-Perez C, Rodriguez-Zavala JS, Ferry JG Functional role of MrpA in the MrpABCDEFG Na + /H + antiporter complex from the archaeon Methanosarcina acetivorans. J Bacteriol 199:e Ito M, Morino M, Krulwich TA Mrp antiporters have important roles in diverse bacteria and archaea. Front Microbiol 8: Cheng B, Meng Y, Cui Y, Li C, Tao F, Yin H, Yang C, Xu P Alkaline response of a halotolerant alkaliphilic halomonas strain and functional diversity of its Na + (K + )/H + antiporters. J Biol Chem 291: Baradaran R, Berrisford JM, Minhas GS, Sazanov LA Crystal structure of the entire respiratory complex I. Nature 494: Nakamaru-Ogiso E, Kao MC, Chen H, Sinha SC, Yagi T, Ohnishi T The membrane subunit NuoL (ND5) is involved in the indirect proton pumping mechanism of Escherichia coli complex I. J Biol Chem 285: Bayer AS, McNamara P, Yeaman MR, Lucindo N, Jones T, Cheung AL, 34

35 Sahl HG, Proctor RA Transposon disruption of the complex I NADH oxidoreductase gene (snod) in Staphylococcus aureus is associated with reduced susceptibility to the microbicidal activity of thrombin-induced platelet microbicidal protein 1. J Bacteriol 188: Hamamoto T, Hashimoto M, Hino M, Kitada M, Seto Y, Kudo T, Horikoshi K Characterization of a gene responsible for the Na + /H + antiporter system of alkalophilic Bacillus species strain C-125. Mol Microbiol 14: Seto Y, Hashimoto M, Usami R, Hamamoto T, Kudo T, Horikoshi K Characterization of a mutation responsible for an alkali-sensitive mutant, 18224, of alkaliphilic Bacillus sp. strain C-125. Biosci Biotechnol Biochem 59: Kajiyama Y, Otagiri M, Sekiguchi J, Kudo T, Kosono S The MrpA, MrpB and MrpD subunits of the Mrp antiporter complex in Bacillus subtilis contain membrane-embedded and essential acidic residues. Microbiology 155: Kosono S, Kajiyama Y, Kawasaki S, Yoshinaka T, Haga K, Kudo T Functional involvement of membrane-embedded and conserved acidic residues in the ShaA subunit of the multigene-encoded Na + /H + antiporter in Bacillus subtilis. Biochimica Biophysica Acta-Biomembranes 1758: Morino M, Natsui S, Swartz TH, Krulwich TA, Ito M Single gene deletions of mrpa to mrpg and mrpe point mutations affect activity of the Mrp Na + /H + antiporter of alkaliphilic Bacillus and formation of hetero-oligomeric Mrp complexes. J Bacteriol 190: Morino M, Natsui S, Ono T, Swartz TH, Krulwich TA, Ito M Single site mutations in the hetero-oligomeric Mrp antiporter from alkaliphilic Bacillus 775 pseudofirmus OF4 that affect Na + /H + antiport activity, sodium exclusion, 776 individual Mrp protein levels, or Mrp complex formation. J Biol Chem 35

36 : Zahoor A, Lindner SN, Wendisch VF Metabolic engineering of Corynebacterium glutamicum aimed at alternative carbon sources and new products. Comput Struct Biotechnol J 3:e Franzel B, Trotschel C, Ruckert C, Kalinowski J, Poetsch A, Wolters DA Adaptation of Corynebacterium glutamicum to salt-stress conditions. Proteomics 10: Follmann M, Ochrombel I, Kramer R, Trotschel C, Poetsch A, Ruckert C, Huser A, Persicke M, Seiferling D, Kalinowski J, Marin K Functional genomics of ph homeostasis in Corynebacterium glutamicum revealed novel links between ph response, oxidative stress, iron homeostasis and methionine synthesis. BMC Genomics 10: Varela C, Agosin E, Baez M, Klapa M, Stephanopoulos G Metabolic flux redistribution in Corynebacterium glutamicum in response to osmotic stress. Appl Microbiol Biotechnol 60: Wick LM, Egli T Molecular components of physiological stress responses in Escherichia coli. Adv Biochem Eng Biotechnol 89: Xu N, Wang L, Cheng H, Liu Q, Liu J, Ma Y In vitro functional characterization of the Na + /H + antiporters in Corynebacterium glutamicum. FEMS Microbiol Lett 363:fnv Ito T, Uozumi N, Nakamura T, Takayama S, Matsuda N, Aiba H, Hemmi H, Yoshimura T The implication of YggT of Escherichia coli in osmotic regulation. Biosci Biotech Bioc 73: Nesvera J, Holatko J, Patek M Analysis of Corynebacterium glutamicum promoters and their applications. Subcell Biochem 64: Amarneh B, Vik SB Mutagenesis of subunit N of the Escherichia coli complex I. Identification of the initiation codon and the sensitivity of mutants to 36

37 decylubiquinone. Biochemistry 42: Fisher N, Rich PR A motif for quinone binding sites in respiratory and photosynthetic systems. J Mol Biol 296: Sazanov LA A giant molecular proton pump: structure and mechanism of respiratory complex I. Nat Rev Mol Cell Biol 16: Efremov RG, Sazanov LA Structure of the membrane domain of respiratory complex I. Nature 476: Shijuku T, Saito H, Kakegawa T, Kobayashi H Expression of sodium/proton antiporter NhaA at various ph values in Escherichia coli. Biochimica Biophysica Acta-Bioenergetics 1506: Wiegert T, Homuth G, Versteeg S, Schumann W Alkaline shock induces the Bacillus subtilis σ W regulon. Mol Microbiol 41: Dover N, Padan E Transcription of nhaa, the main Na + /H + antiporter of Escherichia coli, is regulated by Na + and growth phase. J Bacteriol 183: Sperling E, Gorecki K, Drakenberg T, Hagerhall C Functional differentiation of antiporter-like polypeptides in complex I; a site-directed mutagenesis study of residues conserved in MrpA and NuoL but not in MrpD, NuoM, and NuoN. PLoS One 11:e Gemperli AC, Schaffitzel C, Jakob C, Steuber J Transport of Na + and K + by an antiporter-related subunit from the Escherichia coli NADH dehydrogenase I produced in Saccharomyces cerevisiae. Arch Microbiol 188: Moparthi VK, Kumar B, Mathiesen C, Hagerhall C Homologous protein subunits from Escherichia coli NADH:quinone oxidoreductase can functionally replace MrpA and MrpD in Bacillus subtilis. Biochim Biophys Acta 1807:

38 Castro PJ, Silva AF, Marreiros BC, Batista AP, Pereira MM Respiratory complex I: a dual relation with H + and Na +? Biochim Biophys Acta 1857: Marreiros BC, Batista AP, Pereira MM Respiratory complex I from Escherichia coli does not transport Na + in the absence of its NuoL subunit. FEBS Lett 588: Torres-Bacete J, Nakamaru-Ogiso E, Matsuno-Yagi A, Yagi T Characterization of the NuoM (ND4) subunit in Escherichia coli NDH-1: conserved charged residues essential for energy-coupled activities. J Biol Chem 282: Nozaki K, Inaba K, Kuroda T, Tsuda M, Tsuchiya T Cloning and sequencing of the gene for Na + /H + antiporter of Vibrio parahaemolyticus. Biochem Biophys Res Commun 222: Okibe N, Suzuki N, Inui M, Yukawa H Efficient markerless gene replacement in Corynebacterium glutamicum using a new temperature-sensitive plasmid. J Microbiol Meth 85: Liu J, Hicks DB, Krulwich TA Roles of AtpI and two YidC-type proteins from alkaliphilic Bacillus pseudofirmus OF4 in ATP synthase assembly and nonfermentative growth. J Bacteriol 195: Li FS, Liu SL, Mullins JI Site-directed mutagenesis using uracil-containing double-stranded DNA templates and DpnI digestion. Biotechniques 27: Follmann M, Becker M, Ochrombel I, Ott V, Kramer R, Marin K Potassium transport in Corynebacterium glutamicum is facilitated by the putative channel protein CglK, which is essential for ph homeostasis and growth at acidic ph. J Bacteriol 191: Si M, Zhao C, Burkinshaw B, Zhang B, Wei D, Wang Y, Dong TG, Shen X. 38

39 Manganese scavenging and oxidative stress response mediated by type VI secretion system in Burkholderia thailandensis. Proc Natl Acad Sci U S A 114:E2233-E Robert X, Gouet P Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res 42:W Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Soding J, Thompson JD, Higgins DG Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7: Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10: Lovell SC, Davis IW, Arendall WB, 3rd, de Bakker PI, Word JM, Prisant MG, Richardson JS, Richardson DC Structure validation by Calpha geometry: phi, psi and Cbeta deviation. Proteins 50: Figures and Figure legends: Figure 1 Roles of C. glutamicum Na + /H + antiporters in response to high salt and alkaline ph. (A) Schematic diagram of the four putative Na + /H + antiporters in C. glutamicum ATCC Gene arrangements of these operon clusters are also shown. (B) Effects of ph, NaCl and KCl on growth of C. glutamicum wild-type strain or its putative Na + /H + antiporter-deficient mutants. Each panel shows the growth curves of the corresponding strain in the indicated LBO medium buffered with BTP to different ph values. A concentration of 0.6 M NaCl or 0.6 M KCl was added into the medium, respectively. The growth curves are presented as means ± standard deviation (sd) from three independent experiments. (C) The effects of 39

40 Na + /H + antiporters on the growth of potassium uptake-deficient E. coli TK2420 cells. Growth of TK2420 recombinantst in K0 medium at various KCl concentrations was determined by measuring the optical density at 600 nm (OD 600 ) after 24 h incubation. Asterisks indicate significant differences between E. coli control with empty plasmid and its derivatives (**p < 0.01). Figure 2 Deletion of Mrp-type antiporters affected intracellular Na + (A) and cytoplasmic ph levels (B). Intracellular Na + content was determined by ICP-OES analysis, and intracellular ph values were measured by using the ph-sensitive fluorescent probe BCECF as described in Materials and Methods. The data are presented as means ± sd from three independent experiments. Asterisks indicate significant differences between C. glutamicum wild-type and mrp1-derivative mutants by a two-tailed unpaired Student s t-test (*p < 0.05, **p < 0.01). Figure 3 Disruption of mrp1 affected the transcript levels of other Na + /H + antiporters. Relative transcript levels of target genes were quantified by real-time PCR and normalized to the 16S rrna reference gene. The data are presented as means ± sd from three independent experiments. Asterisks indicate significant differences between C. glutamicum wild-type and mrp1-deficient mutant under indicated stress conditions by a two-tailed unpaired Student s t-test (*p < 0.05, **p < 0.01). Figure 4 Effect of overexpression of Mrp-type antiporters by different promoters on salt resistance. Ten-fold serial dilutions of each cell suspension were spotted on the indicated plates, and incubated at 32 C for 3 days before being photographed. Figure 5 Diverse point mutations of Mrp1 antiporter attenuated its capacity to rescue the growth defects of the Na + -sensitive E. coli KNabc strain. (A) 40

41 Schematic representation of amino acid positions corresponding to single site mutations. Note: CgMrp1 and CgMrp2 from C. glutamicum ATCC 13032, BpMrp from Bacillus pseudofirmus OF4, BhMrp from Bacillus halodurans C-125, BsMrp from Bacillus subtilis 168, SaMnh from Staphylococcus aureus Newman, PaMrp from Pseudomonas aeruginosa PAO1, SfPha2 from Sinorhizobium fredii, HyMrp from Halomonas sp. Y2, VcMrpA from Vibrio cholerae O395, EcNuoL/M/N/K from Escherichia coli MG1655, TtNuoL/M/N/K from Thermus thermophilus HB8. The accession number of each homolog was shown in supplemental Figure S2. (B-C) Growth of E. coli KNabc strains carrying the original pmw118-mrp1 plasmid or its site-mutated derivatives in LBK medium supplemented with 200 mm or 400 mm NaCl. The data are presented as mean values from three independent experiments, and the standard deviations are less than 10% of the mean values. Figure 6 Effects of point mutations in the Mrp1 antiporter on Na + -resistance and alkali-tolerance in vivo. (A) Growth assay of C. glutamicum mutant cells under different stress conditions. Ten-fold serial dilutions of each cell suspension were spotted on the indicated plates, and incubated at 32 C for 3 days before being photographed. (B) Intracellular ph levels were measured by using the ph-sensitive fluorescent probe BCECF as described in Materials and Methods. (C) Intracellular Na + content was determined by ICP-OES analysis as described in Materials and Methods, and presented as ng/10 8 cells. Asterisks indicate significant differences between C. glutamicum wild-type and Mrp1-derivative mutants by a two-tailed unpaired Student s t-test (*p < 0.05, **p < 0.01). Figure 7 Homology molecular model of Mrp1 sub-complex reveals two possible ion translocation pathways. Polar residues forming the putative transmembrane channel are shown as stick models, with carbons shown in orange for the cytoplasmic-facing cavity, in green for the periplasmic-facing cavity, and in 41

42 magentas for the connecting zone. The selected conserved residues of Mrp1 antiporter for point mutation in this study were also shown as sticks, with carbon shown in yellow. The proposed ion translocation channels are indicated by blue arrows.? symbol indicates that the substrate binding or transport direction is unclear. Figure 8 A simple model for C. glutamicum putative Na + /H + antiporters in the adaptation to environmental NaCl and alkaline stresses in (A) wild-type and (B) mrp1-deficient strains. Solid blue or purple arrows indicate separate, positive regulation or activation, and dotted blue or purple arrows indicate unknown or as yet uncharacterized regulatory pathways. Solid pink arrows show secondary effects caused by the mrp1 deficiency. The orange arrows represent the transport of Na +, the brown arrows represent the transport of K +, and the green arrows represent the transport of proton. + symbol means positive regulation, and X symbol means gene deficiency. Tables: Table 1 Absolute transcript levels of C. glutamicum Na + /H + antiporters under different stress conditions Copies/ng total RNA mrp1a mrp1g mrp2a mrp2g nhap chaa gyrb ph ± ± ± ± ± ± ± 57 ph ± 47 ** 581 ± 23 ** 1112 ± 138 ** 717 ± 129 ** 228 ± ± ± M NaCl 314 ± 44 ** 325 ± 42 ** 1401 ± 174 ** 726 ± 169 ** 847 ± 114 ** 368 ± 3 * 818 ± M KCl 258 ± 36 * 265 ± 31 * 618 ± 125 ** 347 ± 37 * 518 ± 36 ** 184 ± ± 63 Note: Asterisks indicate significant differences between the normal ph 7.0 condition and other environmental stresses by a two-tailed unpaired Student s t-test (* p < 0.05, ** p < 0.01). 42

43 Table 2 Plasmids and strains used in this study Plasmid or Strain Description Source Plasmids pcrd206 Temperature-sensitive replicon and B. subtilis sacb gene, Kan R (35) pcrd206-mrp1 pcrd206 derivative; contains C. glutamicum mrp1 flanking region This study pcrd206-mrp2 pcrd206 derivative; contains C. glutamicum mrp2 flanking region This study pcrd206-nhap pcrd206 derivative; contains C. glutamicum nhap flanking region This study pcrd206-chaa pcrd206 derivative; contains C. glutamicum chaa flanking region This study pcrd206-mrp1a-h 230 K pcrd206 derivative; contains C. glutamicum Mrp1A-H 230 K flanking region This study pcrd206-mrp1a-k 299 H pcrd206 derivative; contains C. glutamicum Mrp1A-K 299 H flanking region This study pcrd206-mrp1c-i 76 F pcrd206 derivative; contains C. glutamicum Mrp1C-I 76 F flanking region This study pcrd206-mrp1d-e 136 D pcrd206 derivative; contains C. glutamicum Mrp1D-E 136 D flanking region This study pcrd206-psod-mrp1 pcrd206 derivative, contains C. glutamicum sod-mrp1 overlapping sequence This study pcrd206-pilva-mrp1 pcrd206 derivative, contains C. glutamicum ilva-mrp1 overlapping sequence This study pcrd206-psod-mrp2 pcrd206 derivative, contains C. glutamicum sod-mrp2 overlapping sequence This study pcrd206-pilva-mrp2 pcrd206 derivative, contains C. glutamicum ilva-mrp2 overlapping sequence This study pmw118-mrp1 pmw118 derivative; contains the full C. glutamicum mrp1a-g gene (32) pmw118-mrp2 pmw118 derivative; contains the full C. glutamicum mrp2a-g gene (32) pmw118-nhap pmw118 derivative; contains the full C. glutamicum nhap gene (32) pmw118-chaa pmw118 derivative; contains the full C. glutamicum chaa gene (32) pmw118-mrp1a-h 230 K pmw118-mrp1 derivative; contains point mutation at the H230 site of mrp1a This study 43

44 pmw118-mrp1a-k 299 H pmw118-mrp1 derivative; contains point mutation at the K299 site of mrp1a This study pmw118-mrp1a-g 378 T pmw118-mrp1 derivative; contains point mutation at the G378 site of mrp1a This study pmw118- mrp1a -H 499 K pmw118-mrp1 derivative; contains point mutation at the H499 site of mrp1a This study pmw118-mrp1c-i 76 F pmw118-mrp1 derivative; contains point mutation at the I76 site of mrp1c This study pmw118-mrp1d-e 136 D pmw118-mrp1 derivative; contains point mutation at the E136 site of mrp1d This study pmw118-mrp1e-p 61 L pmw118-mrp1 derivative; contains point mutation at the P61 site of mrp1e This study pmw118-mrp1f-r 35 H pmw118-mrp1 derivative; contains point mutation at the R35 site of mrp1f This study pmw118-mrp1g-r 28 H pmw118-mrp1 derivative; contains point mutation at the R28 site of mrp1g This study pxmj19-mrp1 pxmj19 derivative; contains the full C. glutamicum mrp1a-g gene This study pxmj19-mrp2 pxmj19 derivative; contains the full C. glutamicum mrp2a-g gene This study Strains DH5α E. coli derivative; competent cells for general cloning Promega HST02 E. coli derivative; competent cells for general cloning Takara KNabc E. coli derivative; TG1( nhaa nhab chaa) (33) TK2420 E. coli derivative; (ΔkdpFAB)5 Δ(trkA-mscL') trkd1 (34) ATCC Representative wild-type C. glutamicum strain Lab stock mrp1 C. glutamicum derivative; lacks the Mrp1 antiporter This study mrp2 C. glutamicum derivative; lacks the Mrp2 antiporter This study nhap C. glutamicum derivative; lacks the NhaP antiporter This study chaa C. glutamicum derivative; lacks the ChaA antiporter This study mrp1mrp2 C. glutamicum derivative; lacks both the Mrp1 and Mrp2 antiporters This study Psod-mrp1 C. glutamicum derivative; expression of Mrp1 under the control of sod promoter This study PilvA-mrp1 C. glutamicum derivative; expression of Mrp1 under the control of ilva promoter This study Psod-mrp2 C. glutamicum derivative; expression of Mrp2 under the control of sod promoter This study PilvA-mrp2 C. glutamicum derivative; expression of Mrp2 under the control of ilva promoter This study Mrp1A-H230K C. glutamicum derivative; contains point mutation at the H230 site of Mrp1A protein This study Mrp1A-K299H C. glutamicum derivative; contains point mutation at the K299 site of Mrp1A protein This study Mrp1C-I76F C. glutamicum derivative; contains point mutation at the I76 site of Mrp1C protein This study Mrp1D-E136D C. glutamicum derivative; contains point mutation at the E136 site of Mrp1D protein This study Table 3 Primers used for gene disruption, point mutation and promoter exchange Primers Sequence (5-3 ) a mrp1-1-for CAGGGATCCGTAGTTGATCGAGTTGGTC mrp1-2-rev TACGATATCAACTTAAACAACAGCAAGCGCCACAACAAATAG mrp1-3-for GTTGTTTAAGTTGATATCGTAGTGGATAACAGACGATC mrp1-4-rev TAGTCTAGATGCCTAAGATTTCACCCTTG mrp1-uf GTCGCATTTGGGTTGGATCG mrp1-dr CTGGAACCAGCACCTTAAGC mrp2-1-for mrp2-2-rev mrp2-3-for mrp2-4-rev mrp2-uf TGACGGATCCCACCTTCACCAACACCTAC CTCGGATCCAACTTAAACAACATCCTTGAAAGTGCCTTTG GTTGTTTAAGTTGGATCCGAGTTGAAGCCGAAGAAGTC TAGTCTAGATGGAGTGGCGTTGGAAATTG CTGCTGATGTACGTCTTCTG 44

45 45 mrp2-dr TGTTCGCCAGTGATCAAAGC nhap-1-for TGACGGATCCACCTATTCACGTTGGCTCAG nhap-2-rev CATGGATCCAACTTAAACAACCAATGTAATGAGCATGAAC nhap-3-for GTTGTTTAAGTTGGATCCATGCTTGTTGCGGCTGAAC nhap-4-rev TACTCTAGACTATGGATACCTCGACTGTG nhap-uf GTGTTGTTGGTGTTCGTGAC nhap-dr TCGCACCCTTCTTATCGATC chaa-1-for TGACGGATCCCACGTGCAATAGGTTATGAC chaa-2-rev CATCTCGAGAACTTAAACAACAATGAGCATGAACAATATCGTC chaa-3-for GTTGTTTAAGTTCTCGAGATGCTTGTTGCGGCTGAACG chaa-4-rev TACTCTAGAATACCTCGACTGTGTTGTTC chaa-uf GGTAGGAACCATCAAGATCAC chaa-dr CTACATTCTT GGCCGGATTG mrp1a-h230k-1-for TGACGGATCCATGGCGGAGGCGTAGATGGTACCTGCGATG mrp1a-h230k-2-rev CGCCTCAGGCAGCCAGAACTTGAACGGGAACTGTGCGGAC mrp1a-h230k-3-for GTCCGCACAGTTCCCGTTCAAGTTCTGGCTGCCTGAGGCG mrp1a-h230k-4-rev TACTCTAGAATCAGCCATGCGACCGAAGAATTTACCCAG mrp1a-k299h-1-for TAGCGGATCCGGGTAAATGCCCTCCCGTGTCACTGAAATC mrp1a-k299h-2-rev GGAATATGCCGTGAGCTTGTGCAGATCGGTCTTCTGCAC mrp1a-k299h-3-for GTGCAGAAGACCGATCTGCACAAGCTCACGGCATATTCC mrp1a-k299h-4-rev TACTCTAGAGTGAGCAGGCCGAAGACAGATAGCGCGATG mrp1c-i76f-1-for TAGCGGATCCCCGTCACGAACGTTCTGAGCTGGCCATGTG mrp1c-i76f-2-rev GGTGGCCATCGCGATGACGAAGGCGGTGAGGACGAAGGC mrp1c-i76f-3-for GCCTTCGTCCTCACCGCCTTCGTCATCGCGATGGCCACC mrp1c-i76f-4-rev TACTCTAGAGCGTGGCAGCCATGTGTGCACTGGGAATAC mrp1d-e136d-1-for TGACAGATCTCCGAAGTGGCCCACTGCCAGCAACGCCAAC mrp1d-e136d-2-rev GGAAGGCAGCAGCATCACGTCGATGAACACAAAGAAGTTG mrp1d-e136d-3-for CAACTTCTTTGTGTTCATCGACGTGATGCTGCTGCCTTCC mrp1d-e136d-4-rev TACTCTAGACGATAAGCGGGCCCGCGAAGATGAACATGC mrp1a-h299backmutk-2-rev GTGCAGAAGACCGACCTGAAGAAGCTCACGGCATATTCC mrp1a-h299backmutk-3-for GGAATATGCCGTGAGCTTCTTCAGGTCGGTCTTCTGCAC mrp1-1-for TGACGGATCCATGGAGTCTAATCGGTTTGC mrp1-psod-2-rev CAGCTAAGTAGGGTTGAAGGCTAAACCTCGAAACAATAAC Psod-3-For CCTTCAACCCTACTTAGCTG mrp1-psod-4-rev GCCACAACAAATAGCAAACTCATGGGTAAAAAATCCTTTCGTA mrp1-psod-5-for TACGAAAGGATTTTTTACCCATGAGTTTGCTATTTGTTGTGGCGCTTGC mrp1-6-rev TCAGTCTAGATACCCATGCCGACGATAATCAGC mrp1-pilva-2-rev GTACTTTGACCCTTGTTACACTAAACCTCGAAACAATAAC PilvA-3-For TGTAACAAGGGTCAAAGTAC mrp1-pilva-4-rev GCCACAACAAATAGCAAACTCATGGTTGACTAGTGTAATCTTC mrp1-pilva-5-for GAAGATTACACTAGTCAACCATGAGTTTGCTATTTGTTGTGGC on November 20, 2018 by guest Downloaded from

46 mrp2-1-for mrp2-psod-2-rev mrp2-psod-4-rev mrp2-psod-5-for mrp2-6-rev mrp2-pilva-2-rev TGACGGATCCGTCACTCCACCATCATCGAG CAGCTAAGTAGGGTTGAAGGGAGCCACACCAAACAACAAC GAGCGCGAGAAAAAGAATGAGCATGGGTAAAAAATCCTTTCGTA TACGAAAGGATTTTTTACCCATGCTCATTCTTTTTCTCGCGCTC TCAGTCTAGAAAGGAGTGCGCAACGGTCAGTG GTACTTTGACCCTTGTTACAGAGCCACACCAAACAACAAC mrp2-pilva-4-rev GAGCGCGAGAAAAAGAATGAGCATGGTTGACTAGTGTAATCTTC mrp2-pilva-5-for GAAGATTACACTAGTCAACCATGCTCATTCTTTTTCTCGCGCTC mrp1-5comp GAGTCTAGAAGAAGGAGATACATCATGAGTTTGCTATTTGTTGTG mrp1-3comp GTATCCCGGGTTATTTGGATCGTCTGTTATC mrp2-5comp GAGTCTAGAAGAAGGAGATACATCGTGCTTTCGGAGTTCATCAAAG mrp2-3comp GTATCCCGGGTCAAGACTTCTTCGGCTTCAAC a Restriction sites are shown in underlined italics, and the mutated sites are shown in bold. Table 4 Primers used for qpcr analyses Primers Sequence (5-3 ) mrp1a-qpcr-5f CGTGCTTGCCGATGATGTC mrp1a-qpcr-3r TCACCAGAAGAACCCGAACG mrp1c-qpcr-5f CGAACTTGACCATCCTGTAC mrp1c-qpcr-3r TGCTGCCAAGGCCAACATG mrp1d-qpcr-5f TCAACGGTGCTCTGCTGACT mrp1d-qpcr-3r GTGGAGGCAGAGAGATTGAC mrp1g-qpcr-5f TCTCCATACCGCTGCTCATC mrp1g-qpcr-3r TGACCCAGACGCCGATGATG mrp2a-qpcr-5f CCTGCTGATGTACGTCTTCTG mrp2a-qpcr-3r TGCAGAGCGACGTGAAGATG mrp2c-qpcr-5f GCGCGATGACCAAAATGATC mrp2c-qpcr-3r mrp2d-qpcr-5f mrp2d-qpcr-3r mrp2f-qpcr-5f mrp2f-qpcr-3r mrp2g-qpcr-5f TCACGATGGCGGTCAGGATC TCAACGGTGCTCTGCTGACT GTGGAGGCAGAGAGATTGAC TGCTGTCGTTCATCTTCACC TGTCGAGTGTCCAGCAGATG AAACAACCGGCCTTATCCTC 46

47 mrp2g-qpcr-3r nhap-qpcr-5f nhap-qpcr-3r chaa-qpcr-5f chaa-qpcr-3r gyrb-qpcr-5f AGTACGAGGAGAACAAGGAC GCTTCCTGGCATTGGTCTTG TGTGCAAAGTGGTGGTGATG TTACTATCCCGGCCGATCTG GACATCTGCGACCTAATCACC ATGGTGGCGTTCAAGTTGTC gyrb-qpcr-3r AACGGCGTAAGAATCGGAGT 16S-5F ACCTGGAGAAGAAGCACCG 16S-3R TCAAGTTATGCCCGTATCG mrp1a-str-5f ACTGTTGGCGCTGGTTATCG mrp1a-str-3r TCTCCGCCCAGAAATCAGAG mrp1g-str-5f TCATCGTCTCCATCCTCGTG mrp1g-str-3r GTTATCCACTACGGTCACAC mrp2a-str-5f GCCTTTGGTGCTGAACTGGT mrp2a-str-3r AGAAGTGGGTTGGTGCGATAG mrp2g-str-5f GTCATTCTCCGCATCCATCG mrp2g-str-3r GACTTCTTCGGCTTCAACTCC nhap-str-5f CGATGTCGGTGTTGTTGGTG nhap-str-3r CAGCAAGACACGACCACAAG chaa-str-5f CCTGGCCTGCTTTGATGAC chaa-str-3r GACAAATCCTCACCAGCGAC gyrb-str-5f TCTGGAAGATGGTGGCGTTC gyrb-str-3r GGCGTTCACCACAGAAATACC Table 5 Primers used for site-directed mutagenesis Primers Sequence (5'-3') a Mrp1A-H230K-5F GTCCGCACAGTTCCCGTTCAAGTTCTGGCTGCCTGAGGCG Mrp1A-H230K-3R CGCCTCAGGCAGCCAGAACTTGAACGGGAACTGTGCGGAC Mrp1A-K299H-5F GTGCAGAAGACCGATCTGCACAAGCTCACGGCATATTCC Mrp1A-K299H-3R GGAATATGCCGTGAGCTTGTGCAGATCGGTCTTCTGCAC Mrp1A-G378T-5F GTTTGTGTCTGTATTAATAACTGCGTTGTCGATGGCATCGG Mrp1A-G378T-3R CCGATGCCATCGACAACGCAGTTATTAATACAGACACAAAC Mrp1A-H499K-5F CATGCACCTGGCATTGTGGAAGGGCATCAACACCCCACTG Mrp1A-H499K-3R CAGTGGGGTGTTGATGCCCTTCCACAATGCCAGGTGCATG Mrp1C-I76F-5F Mrp1C-I76F-3R Mrp1D-E136D-5F Mrp1D-E136D-3R GCCTTCGTCCTCACCGCCTTCGTCATCGCGATGGCCACC GGTGGCCATCGCGATGACGAAGGCGGTGAGGACGAAGGC CAACTTCTTTGTGTTCATCGACGTGATGCTGCTGCCTTCC GGAAGGCAGCAGCATCACGTCGATGAACACAAAGAAGTTG 47

48 Mrp1E-P61L-5F Mrp1E-P61L-3R Mrp1F-R35H-5F Mrp1F-R35H-3R Mrp1G-R28H-5F AACGTGCATCACCGCGACTCTTTCCACCCTGTCCCTTGG CCAAGGGACAGGGTGGAAAGAGTCGCGGTGATGCACGTT ACCAAAGATTTCCTCACCCACGTGGTGCTTTCCGACATG CATGTCGGAAAGCACCACGTGGGTGAGGAAATCTTTGGT TACTGCAATCGCTTTGTGGCACGCACCGGATCCGCTCACC 1007 Mrp1G-R28H-3R a The mutated sites are shown in bold and underlined. GGTGAGCGGATCCGGTGCGTGCCACAAAGCGATTGCAGTA Downloaded from on November 20, 2018 by guest 48

49

50

51

52

53

54

55

56