Copyright 2013 Regents of the University of Minnesota

Transcription

1 Introdution to Glxy Tutoril Rsrh Informtis Support Systms Minnsot Supromputing Institut Univrsity of Minnsot Vrsion /15/2013 1

2 1 Introdution Sop of this tutoril Strting Glxy Assing Glxy Import Fstq fils for on smpl into urrnt history St fil ttriuts: dts/uild nd dttyp Evluting Fstq Fil Qulity Running fstqc Viwing FstQC Rsults Rviwing FstQC Clning Fstq Dtsts Introdution to Clning Simpl Rmovl of Low Qulity Tils FASTQ Qulity Trimmr Running FstQC on Trimmd Dt Chking th FstQC Rsults Simpl Rmovl of Adptr Squns Running Cutdpt Running FstQC Rsyning Fils Vrifying Clning Rsults Rviwing FstQC Workflows Extrt workflow from urrnt history Edit th workflow Running th Workflow Clning up Historis Dlting Intrmdit Fils Dlting Old Historis Shring Your Work Shring Workflows Shring Historis Appndix I: Itrtiv til/dptr rmovl

3 1 Introdution 1.1 Sop of this tutoril This is prtil, hnds-on tutoril with two primry ims: Giv prtiipnts xprin with th si funtionlity of Glxy o Strting Glxy o Glxy Lyout o Loding fils into urrnt history o Crting rusl workflows o Shring historis nd workflows with othrs Bsi prossing nd qulity ontrol on squning dtsts o Evluting rd qulity o Adptr rmovl o Low qulity rd rmovl o Rd trimming Rfrn mtrils Glxy srnsts: glxyst.org 3

4 2 Strting Glxy Glxy Intrf (St 2.1 on pg 5) Tools pn All of th softwr vill in Glxy is listd in th tools pn, groupd into tgoris. Clik on th first tool tgory Gt Dt to xpnd it nd show th individul tools in th tgory. Clik th Gt Dt tgory gin to ollps it. Historis pn Th history pn will show list of ll input nd output fils usd in th urrnt nlysis Cntr pn Th ntr pn displys informtion for spifi tools or fils sltd from th tools nd historis pns. Tutoril Dtst (St 2.2 on pg 7) This tutoril will go ovr si glxy fturs nd dsri som strtgis for lning up squning dtsts. Th smpl dtst usd in this tutoril ws rtd from n SRA sumission rprsnting shotgun r-squning of th humn gnom. Ths fstq fils wr rtifiilly dgrdd to provid singl xmpl ontining vrity of potntil qulity issus. Whil th FstQC rsults losly rsml prolms found in rl dtsts, not ll dtsts will s rovrl s th tutoril dtst. Dt Lirris (St 2.2 on pg 7) In Glxy dt fils r stord in Dt Lirris. Dt lirris n puli (vill to ll Glxy usrs) or privt (vill to th mmrs of your l). Squn dt gnrtd y th UMGC n lodd into Glxy y snding rqust to MSI, whr thy will vill in dt lirry. Additionl usrs n givn ss to dt lirry y snding rqust to MSI. If you hv lrg dtst lotd on n MSI fil systm it n lodd into Glxy dt lirry y snding rqust to MSI. Stndrd nming onvntion is to ll th forwrd (or lft) rd s R1 nd th rvrs (or right) rd s R2. Glxy Fil Attriuts (St 2.3 on pg 8) Glxy dos not rly on fil xtnsions to dtrmin fil typs. Instd, h fil in Glxy hs st of ttriuts tht dsri wht formt th fil is in nd wht rfrn gnom (if ny) it is ssoitd with. Fstq fils, for xmpl, om in svrl slightly diffrnt fil formts. Whn fstq fil is uplodd to Glxy it is idntifid s gnri fstq fil. Th Illumin fstq fils usd in this tutoril (s wll s thos urrntly gnrtd y th UMGC) r in th Sngr fstq formt. S n.wikipdi.org/wiki/fastq_formt for mor informtion. 4

5 2.1 Assing Glxy. Opn w rowsr nd nvigt to MSI Glxy wsit glxy.msi.umn.du. Log in with your MSI usrnm nd pssword. Th sid pnls n ollpsd vi rrows in th ottom ornrs to provid ttr viw of th ntr pnl d. Th totl quntity of dt you hv stord in glxy is displyd in th top right Glxy Intrf d Tools pn Cntr pn History pn 5

6 . You n mor sily find th tool you would lik to us y srhing for its nm nd kywords using th srh tools fild. Throughout th tutorils w will dirt you on how to find th tools mnully ut srhing is oftn th quikr option. 6

7 2.2 Import Fstq fils for on smpl into urrnt history Dt Lirris Tutoril Dtst. At th top of th srn slt Shrd Dt -> Dt Lirris. Slt RISS-tutoril-glxy101 from th list of dt lirris. Expnd th FstQ foldr nd hk th oxs nxt to th first two fils ( Tutoril_fil_R1.fstq nd Tutoril_fil_R2.fstq ) d. Nr th ottom of th pg lik th Go utton to import th sltd dtsts to th urrnt history d 7

8 2.3 St fil ttriuts: dts/uild nd dttyp Glxy Fil Attriuts. Viw th history pnl y liking on Anlyz Dt. In th history pn lik on th pnil ion nxt to th 2: Tutoril_fil_R2.fstq fil in ordr to st th fil ttriuts. This is humn dt so slt hg19_nonil in th Dts/Build ox. A list of ll vill dtss will ppr s you typ d. Clik sv. Clik th Dttyp t f. Entr fstqsngr in th Nw Typ ox. A list of vill dt typs will ppr s you typ. g. Clik sv h. Rpt this pross (stps -g) for 1: Tutoril_fil_R1.fstq d f g h. Rpt for Sond Fil 8

9 3 Evluting Fstq Fil Qulity Qulity Sors (St 3.3 on pg 11) Th qulity vlution disussd in this tutoril is grd towrds Illumin gnrtd rds. Othr squning mthods my produ rds with diffrnt pttrn of rrors or diffrnt formt of qulity fil. Othr squning mthods hv thir own sustions in th NGS: QC nd mnipultion stion Fstq fils inlud not only squn informtion, ut lso informtion out th stimtd hn of mislld s. This rror stimtion is rfrrd to s qulity sor. A qulity sor for spifi position is nodd s singl ASCII hrtr. Sin ASCII hrtrs hv stndrdizd numril ssoition (s th spifi hrtr shown n usd to omput n xptd rror rt. Th xt rror rt, P, is lultd s whr Q is th vlu of th ASCII hrtr Sin th first 32 ASCII hrtrs r wht r known s ontrol hrtrs nd don t produ visil hrtr on omputr srn th modrn vrsion of fstq trts th 33 rd ASCII hrtr s Q = 0 nd ounts up from thr. This is known s th Sngr phrd noding. Erlir Illumin mhins trtd th 64 th ASCII hrtr s Q = 0. As rsult r should tkn to dtrmin th fstq vrsion of oldr fils. A qulity sor of 10 indits n rror rt of 10%, 20 is 1%, 30 is 0.1% nd so on. FstQC Mtris (St 3.3 on pg 11) 1. Bsi Sttistis Givs th nm of th input fil, noding usd for th qulity sor (Sngr vs oldr nodings), totl squn ount, vrg squn lngth nd GC ontnt prntg. 2. Pr s squn qulity A prtiulrly importnt figur showing th vrg qulity sor t diffrnt positions ross ll rds. In gnrl, qulity is lowr t th strt nd nds of rds. Suddn dips in th middl of rd n signify fild yls in th squning run. 3. Pr squn qulity sors Histogrm hrting th vrg qulity ross rd. Bimodl distriutions my indit sust of rds tht r low qulity nd should rmovd. 4. Pr s squn ontnt Th frquny of prtiulr nulotids t diffrnt positions in th rds. Extrmly high nulotid is n sign of troul. Short strths with high is n usd y th prsn of linkrs, rods or dptrs. Thr is usully som minor is in th first 11-13p of RNA-sq xprimnt du to not-quit rndom hxmr squn priming. This is is ountd for in RNA-sq nlysis softwr. 5. Pr s GC ontnt Avrg GC ontnt y position in th rd 6. Pr squn GC ontnt Histogrm showing th frquny of rds with rtin GC%. Illumin squnrs tnd to undrrprsnt xtrmly high nd xtrmly low GC% squns. Lrg dvitions from th xptd distriution n sign tht th GC is is hving n fft on squning rsults. 7. Pr s N ontnt Rt of N (ny nulotid) lls y position in rd. 8. Squn Lngth Distriution Histogrm of squn lngths. 9. Squn Duplition Lvls Frquny of xt squn duplits in th dtst. High duplition rts n usd y PCR rtifts nd/or low lirry divrsity. 10. Ovrrprsntd squns Clls out spifi ovr-rprsntd squns. 11. Kmr Contnt Shows th rt of ovr-rprsntd k-mrs in th dtst. K-mrs ovr-rprsntd t th 5 nd/or 3 nds n n indition of dptr ontmintion. 9

10 3.1 Running fstqc. From th Tools pnl lik on th NGS: QC nd mnipultion group. Clik FstQC:Rd QC. Slt th fil to nlyz from th drop-down mnu, in this s Tutoril_fil_R2.fstq d. Rnm th output fil to somthing rognizl (W usd Prlning Right ). Clik Exut f. Rpt ths stps (-) on th Lft rd fil Tutoril_fil_R1.fstq d f. Rpt for Sond Fil 3.2 Viwing FstQC Rsults. Clik th y ion on 3: FstQCPrlningRight to viw th fstqc rsults 10

11 3.3 Rviwing FstQC In th following rviw of th FstQC rsults w will prsnt th rsults of oth th Lft nd Right rds sid y sid. W do this to ntut th diffrn twn th two dtsts nd to highlight th importn of hking th qulity of oth sts of rds. It is quit norml for on st of rds to onsidrly diffrnt in qulity from th othr. Usully th lft rds r of highr qulity du to th ft tht thy r sqund first. Th lft nd right rds r on th lft nd right rsptivly. Qulity Sors FstQC Mtris. Sroll to Pr s squn qulity. Low qulity 3 til to lrg numrs of rds. Likly fild yl (on position is fftd ut th visuliztion is vrging ovr 4 yls) d d. Sroll to Pr squn qulity sors.. Not th imodl distriution with popultion of low qulity rds. 11

12 f. Sroll to Squn Duplition Lvls g. Not th prsn of duplit rds, hr up to 5 opis. Som duplition is xptd nd this is rltivly low duplition. Thr my issus if th 10+ olumn is xtrmly high f g g h. Sroll down to Kmr Contnt i. Not th prsn of ovr nrihd k-mrs t th 3 nd. This is inditiv of 3 dptr ontmintion. Ths squns my lso idntifid s n Ovrrprsntd Squn h i i 12

13 4 Clning Fstq Dtsts 4.1 Introdution to Clning Low Qulity Tils/Cyls (St 5.1 on pg 14) For vrity of rsons, inluding dy of rgnts s thy sit on th squnr, th qulity of s lls tnds to drs s squning progrsss. As rsult th 5 nds will tnd to hv highr qulity thn th 3 nds nd forwrd rds will tnd to hv ttr qulity thn rvrs rds. Bus lowr qulity indits highr hn of mislld s, lrg numr of low qulity s pirs n impir th ury of mpping lgorithms. As rsult whn thr is onsidrl vidn of low qulity tils th tils r trimmd for furthr nlysis is prformd. A simpl nd fftiv mthod is to rmov fixd numr of s pirs from th nd of h rd. Howvr, rmoving th lst 20% of ll rds rsults in 20% rdution in gnom ovrg. Mor sophistitd mthods only rmov th tils tht show vidn of low qulity. Both mthods will disussd within this stion. A similr ut distint prolm is th issu of fild yls. On rr ourrns th squning mhins my simply fil to proprly inorport nulotids or fil to rd th fluorsn of th most rnt inorportion. This rsults in xtrmly low qulity sors t fixd position in ll rds in th ln. For gnrl lignmnt ths fild yls n ignord ut in spifi instns it my nssry to xlud tht position from th nlysis. Adptr Contmintion (St 6.1 on pg 17) Illumin DNA lirris onsist of th DNA of intrst (grn) with ligtd dptrs (rd + yllow) on th 5 nd 3 nds to provid priming sits for th Illumin squning rtions. Th Forwrd dptr (lft) provids rgion (distl) tht inds to th flow ll plt nd rgion (proximl) to whih th squning primr inds. Th Rvrs dptr (right) provids similr rgions with th ddition of rod squn (yllow) Adptr Adptr ontmintion ours whn th DNA frgmnt of intrst is too short nd th squning pross gins to squn th opposing primr rgion Hr you n s th distl rgion ound to th flow plt, th proximl rgion ound with primr nd n rrow showing th rsulting squn rd. In ordr to rmov dptr ontmintion th dptrs usd in th xprimnt nd to supplid. Dpnding on th xprimntl dsign dptr ontmintion n our on th 5 nd, 3 nd or oth. In th xmpl shown hr only th 3 nd is ontmintd. Th stndrd Illumin TruSq dptrs r: Forwrd 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Rvrs 5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 13

14 5 Simpl Rmovl of Low Qulity Tils 5.1 FASTQ Qulity Trimmr Low Qulity Tils/Cyls. Opn th NGS: QC nd mnipultion stion of th toolr. Clik FASTQ Qulity Trimmr. Undr FASTQ Fil: Slt th Right rd fil 2: Tutoril_fil_R2.fstq d. St Trim nds to 3 only. St Window siz to 3 f. St Qulity Sor to 20 g. Clik Exut h. Rpt prvious stps (-g) for 1: Tutoril_fil_R1.fstq d f g h. Rpt for Sond Fil 14

15 5.2 Running FstQC on Trimmd Dt. From th Tools pnl lik on th NGS: QC nd mnipultion group. Clik FstQC:Rd QC. Slt th fil to nlyz from th drop-down mnu, in this s 5: FASTQ Qulity Trimmr on dt 2 d. Rnm th output fil to somthing rognizl (W usd PostTrim R ). Clik Exut f. Rpt ths stps (-) on th Lft rd fil 6: FASTQ Qulity Trimmr on dt 1 d f. Rpt for Sond Fil 15

16 5.3 Chking th FstQC Rsults. Clik th y ion on 7: PostTrimR to viw th fstqc rsults. Sroll down to Pr s squn qulity. Not tht th qulity of th tils hs improvd signifintly d. Sroll down to Kmr Contnt. Osrv tht th high numr of Kmrs t th 3 nd hv not n fftd. d 16

17 6 Simpl Rmovl of Adptr Squns 6.1 Running Cutdpt Adptr ontmintion. Opn th Fst mnipultion stion. Clik Cutdpt to lod th dptr trimmr tool. Undr Fstq fil to trim: Slt th Right rdst 5: FASTQ Qulity Trimmr on dt 2 d. Clik Add nw 3 Adptrs d. In th ox lld Choos 3 dptr ntr th dptr squn tht would ontmint th R2 (rvrs/right) rds. For this tutoril nd for stndrd Illumin runs this would th TruSq Univrsl Adptr Rvrs Complmnt 17

18 f. St Minimum ovrlp lngth to 5 f g. St Output filtring options: to St Filtrs h. St Minimum Lngth to 25 g h i. Clik Exut to run th tool i j. To quikly st up th utdpt run for th R1 (forwrd/lft) rds w will pply nw thniqu. Clik on th nm of on of th utdpt rsults to xpnd its ox. k. Clik on th lu irulr rrow to lod utdpt with ll of th stting of th prvious run. j k 18

19 l. Chng th Fstq fil to trim: dropdown to 6: FASTQ Qulity Trimmr on dt 1 m. Chng th Choos 3 dptr: dropdown to th pproprit dptr ontminnt. For this tutoril nd for stndrd Illumin runs this is th TruSq Indx Adptr l m n n. Clik Exut o. Opn th Cutdpt rport y liking on th y ion p. Not th lngth distriution of rmovd squn, this givs n indition of th fls trimming rt. p o 19

20 6.2 Running FstQC. From th Tools pnl lik on th NGS: QC nd mnipultion group. Clik FstQC:Rd QC. Slt th fil to nlyz from th drop-down mnu, in this s 10: Cutdpt on dt 5 d. Rnm th output fil to somthing rognizl (W usd PostCutdptR ). Clik Exut f. Rpt ths stps (-) on th Lft rd fil 12: Cutdpt on dt 6 d f. Rpt for Sond Fil 6.3 Rsyning Fils Trimming nd othr qulity ontrol msurs n rsult in rds, usully thos of zro lngth, ing rmovd from th dtst. Additionlly, som prossing stps my shuffl rds within th dt fils. Mny progrms xpt to find th sm rd nms in th sm ordr for oth th lft nd right rdsts. To nsur tht th rd nms r in syn you n run th r-syn tool.. From th Tools pnl lik on th MSI group. Clik rsyn: Pird-nd rsynhroniztion. Slt s Input 1, 12: Cutdpt on dt 6 d. Slt s Input 2, 10: Cutdpt on dt 5. Clik on xut d 20

21 7 Vrifying Clning Rsults 7.1 Rviwing FstQC. Clik on th y ion nxt to 13: PostCutdptR to viw th rsults of dptr trimming. For illustrtion purposs w r showing th R1 nd R2 rds rsults djnt to on nothr.. Sroll down to Pr s squn qulity. Not th improvmnt in th vrg til qulity Lft Rd Right Rd Prlning Postlning 21

22 d. Sroll down to Pr squn qulity sors. Vrify rmovl of low qulity pk d Lft Rd Right Rd Prlning Postlning 22

23 f. Sroll down to Squn Lngth Distriution g. Not th dgr of trimming tht hs ourrd. f Lft Rd Right Rd Prlning g g Postlning 23

24 h. Sroll down to Kmr Contnt i. Not th sn of ovrrprsntd til kmrs h Lft Rd Right Rd Prlning i i i i Postlning 24

25 8 Workflows Glxy Workflows (St. 8.1 on pg 25) Glxy workflows provid n sy mthod to utomt n nlysis piplin. W will dmonstrt how to gnrt workflow, modify prts of th workflow nd us it to nlyz sond st of smpls. Also, workflows nd historis n shrd with othr Glxy usrs. Workflow Prmtrs (St. 8.2 on pg 27) Th workflow w st up in this stion will run FstQC, qulity trimming nd dptr trimming on oth th lft (R1) nd right (R2) rd sts. By dfult ll prmtrs in workflow will th sm is thos usd in th history. For stting, suh s th dptr s squns, tht my diffrnt for vry nlysis, you n mk thm sttl t run-tim. 8.1 Extrt workflow from urrnt history Glxy Workflows. At th top of th history pn lik on th smll gr ion nd slt Extrt Workflow from th pop-up mnu. In th Workflow nm ox ntr QC nd Clnup. Clik Crt Workflow 25

26 8.2 Edit th workflow Workflow prmtrs. Clik on Workflow t th top of th Glxy window. Clik on th workflow tht ws just rtd nd slt Edit from th drop-down mnu. By drgging th oxs round you n mk th workflow sir to intrprt. d. Find on of th input dtsts nd find nd lik on th FstQC:Rd QC run tthd to it. Look on th Dtils pnl, not whthr this is th Lft or Right rd f. Clik on th tthd Input dtst f d 26

27 g. Bsd on stp, Ll th input. W lld th input s Lft Rd Input do th sm for th othr input dtst nming it Right Rd Input g h. Susqunt runs my rquir diffrnt dptr squns. Thr is n option to llow th dptr to st whn th workflow is run. Clik on Cutdpt ox i. Clik on th smll downwrd djnt to Entr ustom 3 dptr squn j. Clik th St t runtim option k. Rpt ths stps (h-j) for th othr Cutdpt ox in th workflow. l. Clik th gr ion t th top of th workflow nd slt Sv h j i k. Rpt (h-j) 27

28 8.3 Running th Workflow. Clik Anlyz Dt to rturn to your history. Bfor finishing with this history giv it nm so you n find it gin. W nmd our history Glxy 101 History. Nm th history y liking on th titl lotion. (You must prss ntr to sv th hng. Cliking outsid th ox will not work). Crt nw history y liking on th gr ion t th top of th history pn nd slting Crt Nw from th pop-up mnu d. Nm th nw history Workflow Tst d. Import th Tutoril_fil_workflow_R1.fstq nd Tutoril_fil_workflow_R2.fstq fil y liking on Shrd Dt -> Dt Lirris t th top of th srn nd slting th fils from th RISS-tutoril-glxy101 dt lirry f. Lod workflow y liking on Workflow t th top of th srn f 28

29 g. Clik on th workflow tht ws just rtd nd slt Run from th dropdown mnu h. Slt th 1: Tutoril_fil_workflow_R1.fstq fil in th Lft Rd Input mnu i. Slt th 2: Tutoril_fil_workflow_R2.fstq fil in th Right Rd Input mnu g h i j. Sroll down to Stp 8: Cutdpt nd t Choos 3 dptr slt th pproprit dptr, in this s TruSq Indx Adptr k. Sroll down to Stp 10: Cutdpt nd t Choos 3 dptr slt th pproprit dptr, in this s TruSq Univrsl Adptr Rvrs Complmnt l. Sroll down to th ottom of th min viw nd lik Run Workflow m. Clik Anlyz Dt to rturn to th history viw. j l k 29

30 9 Clning up Historis Running tools nd workflows in Glxy uss hrd driv storg sp, t tims lot of storg sp. W stimt tht vn rltivly simpl RNA-sq nlysis will us 4-5 tims th storg of th rw squning fils. Th good nws is tht most of ths fils r tmporry fil tht n sfly dltd whn th nlysis is finishd. If you did ltr tht th fils r ndd thy n quikly rgnrtd y r-running th workflow. You urrnt glxy-wid storg usg is shown in th top right ornr of th glxy window Additionlly, h individul history will show its storg usg t th top of th pnl. Not tht if you r plnning to xtrt workflow from your urrnt history you should do so for dlting th intrmdit fils. 9.1 Dlting Intrmdit Fils W will dmonstrt dlting intrmdit fils on th Workflow Tst history you rtd s prt of th tutoril.. Clik on Anlyz Dt to rturn to th history viw. Clik th Gr ion to opn th options mnu nd slt Svd Historis 30

31 . Clik on th rrow nxt to Workflow Tst history nd hoos Swith d. Clik th X to dlt fil. W only nd th finl rsyn fils nd n dlt ll othrs. d. Not tht th siz of th history hs not hngd f. Clik on th gr ion nd slt Inlud Dltd Dtsts g. Clik th irld link to prmnntly purg th dtsts. h. Not tht th storg usg hs now n rdud. f g h 31

32 9.2 Dlting Old Historis If you hv historis you no longr nd thy n dltd from th svd historis mnu. Lik dlting th intrmdit fils, you must purg th historis in ordr to rmov thm from th storg sp. Hr w will dlt th Glxy 101 History w usd to mk our workflow. Clik on Anlyz Dt to rturn to th history viw. Clik th Gr ion to opn th options mnu nd slt Svd Historis. Clik th downwrd rrow nxt to Glxy 101 History nd slt Dlt Prmnntly. Th workflow w rtd from this history will unfftd y this tion. d. Clik Ok to prmnntly rmov th history d 32

33 10 Shring Your Work Glxy provids tools for privtly shring your historis with othr glxy usrs. All you nd to know is th mil ddrss of th usr with whih you wnt to shr. In this stion w will rt link to shr our QC nd Clnup workflow s wll s th finl fils in th Workflow Tst history Shring Workflows. Clik on Workflow to swith to th workflow list. Clik th Downwrd Arrow nxt to QC nd Clnup nd slt Shr nd Pulish. Clik Mk Workflow Assil vi Link d. Shr this link with your ollortors, lik th link to s wht thy would s. d. Shrd workflows n svd or importd into your Glxy ount y liking th ions in th top right ornr 33

34 10.2 Shring Historis. Clik on Anlyz Dt to swith to your history. Clik th Gr ion to opn th options mnu nd slt Svd Historis. Clik th Downwrd Arrow nxt to Workflow Tst nd slt Shr or Pulish d. Clik Mk History Assil vi Link d. Shr this link with your ollortors, lik th link to s wht thy would s. f. Shrd historis n importd into your Glxy ount y liking th ion in th top right ornr f 34

35 11 Appndix I: Itrtiv til/dptr rmovl This is n dvnd workflow for trimming low qulity dptrs nd rd tils. Whil produing lrgly th sm rsult s th min tutoril this workflow provids littl xtr snsitivity for trimming ss whr rd hs oth n dptr nd vry low qulity til. To illustrt th prolm, onsidr th rd low. Th rd stion is th gnomi squn, th grn stion is th dptr squn nd th grdint dnots drsing qulity. If th dptr trimming is ttmptd first, th low qulity my prvnt th squn from ing rognizd. As suh, w ttmpt to trim dptrs, trim th low qulity tils nd thn trim dptrs gin. This lns mintining suffiint squn for dptr rognition with rmoving low qulity s pirs tht my rrors.. Opn th FASTA Mnipultion stion. Clik Cutdpt to lod th dptr trimmr tool. Undr Fstq fil to trim: Slt th Right rd fil Tutoril_fil_R.fstq d. Clik Add nw 3 Adptrs. Undr Sour slt Entr ustom squn f. In th ox lld Entr ustom 3 dptr squn ntr AATGATACGGCGACCACCGAGATCTACACGCCTCCCTCGCGCCATCAGCTGATGGCGCG f d 35

36 g. St Minimum ovrlp lngth to 5 h. St Output filtring options: to St Filtrs i. St Minimum Lngth to 15 j. Clik Exut g ` h i j 36

37 k. Opn th NGS: QC nd mnipultion stion of th toolr l. Clik FASTQ Qulity Trimmr m. St FASTQ Fil to Cutdpt on dt 2 n. St Trim nds to 3 only o. St Window siz to 3 p. St Qulity Sor to 20 q. Clik Exut k m n o f g 20 l 37

38 r. Opn th FASTA Mnipultion stion s. Clik Cutdpt to lod th dptr trimmr tool t. Undr Fstq fil to trim: Slt th rsult from th prvious utdpt run, 7: FASTQ Qulity Trimmr on dt 6 u. Clik Add nw 3 Adptrs v. Undr Sour slt Entr ustom squn w. In th ox lld Entr ustom 3 dptr squn ntr AATGATACGGCGACCACCGAGATCTACACGCCTCCCTCGCGCCATCAGCTGATGGCGCG r t v w u s 38

39 x. St Minimum ovrlp lngth to 5 y. St Output filtring options: to St Filtrs z. St Minimum Lngth to 25. Clik Exut x ` y z 39