Can protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU
|
|
- August Underwood
- 5 years ago
- Views:
Transcription
1 Can protein model accuracy be identified? Morten Nielsen, CBS, BioCentrum, DTU NO!
2 Identification of Protein-model accuracy Why is it important? What is accuracy RMSD, fraction correct, Protein model correctness/quality Procheck, Whatif, ProsaII, Verify3d Prediction of protein model accuracy ProQ server
3 Why is it so important Reliable fold recognition P-value, E-value, Z-score Tells you if you should believe in the fold!! Alignment (model construction) No obvious method to estimate reliability of alignment Number of gaps, length of gaps Amino acids in protein core and loops % id is too conservative Many low homology models are accurate, and some high homology model are wrong Correct fold, wrong alignment => Terrible model How to gain confidence in a protein model?
4 Model accuracy. Swiss-model models sharing 25-95% sequence identity with the submitted sequences (
5 What is protein model accuracy Model quality (correctness) Does the model look like a protein? Hydrophobic residues in core, hydrophilic on surface Backbone geometry (phi/psi angles, bond-length) Amino acid environment A correct model can be completely wrong Accuracy (if we know the answer) RMSD Fraction of correct modeled residues
6 Model accuracy Rmsd = sqrt(1/n S (d ij ) 2 ) Fraction correct = N c /N Nc = number correct Blue model Yellow structure d ij
7 Evaluation of model quality Check for proper protein stereochemistry ProCheck ( Ramachandran plot, bond-length, Whatif ( Packing quality Both web-servers Fitness of sequence to structure ProsaII ( Program runs on Linux and Unix Verify3D ( Web-server
8 Amino acid environment of different protein sequences different solved protein structures 600 different protein folds Typical amino acid environment Sequence space large Structure space small
9 CaNCCa y, f = -60 degrees b strand Dihedral angles y, f y, f = 180 degrees Peptide planes Peptide backbone geometry l l l l a helix From speedy.st-and.ac.uk/.../lectures/ 3014/lecture/dars1.htm
10 Ramachandran plot B. Beta strand A. Right handed helix L. Left handed helix Color coding White. Disallowed Red. Most favorable Yellow. Allowed region Glycine triangles A B L
11 Wrong structure 1RIP Ribosomal protein. NMR structure in PDB database 17- Aug, 1993
12 Procheck. Bond length
13
14 What-if. Fine packing Quality Statistical description of local chemical environment in high quality protein structures Superimpose tryptophans and find average local environment. Same for other amino acids Full atom model G. Vriend and C. Sander, 1992
15 Example. Casp Model T0133 T0133 Casp5 target Modeled by X3M (Lund, O., 2002) RMSD=7.3
16 Casp Model - Fine packing quality ---Residue----- State AllAll BB-BB BB-SC SC-BB SC-SC ILE ( 33 ) SER ( 34 ) ALA ( 296 ) GLU ( 297 ) HIS ( 298 ) ============================================================ All contacts : Average = Z-score = BB-BB contacts : Average = Z-score = BB-SC contacts : Average = Z-score = SC-BB contacts : Average = Z-score = SC-SC contacts : Average = Z-score = ============================================================ Average protein values ("Z-score for all contacts") can be read as follows: -5.0 Guaranteed wrong structure. Bad structure or poor model -3.0 Probably bad structure or unrefined model. Doubtful structure or model -2.0 Structure OK or good model. Good structures 0.0 Good structures. 2.0 Good structures. Unusually Good structures 4.0 Probably a strange model of a perfect helix Bad model
17 T0133 structure - Fine packing quality ---Residue----- State AllAll BB-BB BB-SC SC-BB SC-SC ILE ( 33 ) A SER ( 34 ) A ALA ( 296 ) A GLU ( 297 ) A HIS ( 298 ) A ============================================================ All contacts : Average = Z-score = BB-BB contacts : Average = Z-score = BB-SC contacts : Average = Z-score = 0.90 SC-BB contacts : Average = Z-score = SC-SC contacts : Average = Z-score = 0.02 ============================================================ Average protein values ("Z-score for all contacts") can be read as follows: -5.0 Guaranteed wrong structure. Bad structure or poor model -3.0 Probably bad structure or unrefined model. Doubtful structure or model -2.0 Structure OK or good model. Good structures 0.0 Good structures. 2.0 Good structures. Unusually Good structures 4.0 Probably a strange model of a perfect helix Good model
18 ProsaII (Potential of Mean Force) Likelihood of amino acid packing Exposure potential for D Method developed by Manfred Sippl., 1993 Works for Ca-models For high quality protein structure estimate nearest neighbor counts for all aa E = -log(p(n a)/p(n)) Hydrophobic residues tend to have many neighbors (buried) Hydrophilic residues tend to have fewer N (exposed) Sippl, J.M. (1990) J. Mol. Biol. 213, (1990).
19 ProsaII (Potential of Mean Force) Likelihood of amino acid packing Pair potential for D, E. s=3 E = - log(p(r abs)/p(r s)) s a b r Sippl, J.M. (1990) J. Mol. Biol. 213, (1990).
20 Verify 3D (Eisenberg et al. 1997) Closely related to ProsaII exposure potential. How well does aa fit its local environment (hydrophobic/hydrophilic) T0133 Casp5 target Modeled by X3M (Lund, O., 2002) RMSD=7.3 Red: Crystal structure, Blue: Model
21 Sequence has poor match to structure Model T0133. Verify 3D
22 ProQ. Prediction of Model accuracy Neural network to identify correct protein models. B. Wallner and Arne Elofsson, Input, a pdb structure/model Output, accuracy measure LGscore Maxsub score
23 ProQ Input to neural net Atom-atom contacts C, N, O How often is C in contact with N? Residue-residue contacts How ofter is E in contact with D? Solvent accessibility surface Average exposure of L s Secondary structure prediction How consistent is prediction with model?
24 Casp model T0113
25 Structure 1RIP
26 LifeBench data Models 220 targets Modeled by Pcons Incorrect model Lgscore <1.5 Maxsub < 0.1
27 Conclusions Correct protein models cannot reliably be identified!! Protein fold on the other hand can! Many methods from the protein crystallography world are useful to identify wrong models Bad models can pass all filters ProQ is a first attempt of an accurary prediction server Can integrate information from many sources Future will show if this approach can provide reliable prediction of model accuracy
Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationHOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.
HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationProtein Structure Prediction
Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on
More informationProtein Structures: Experiments and Modeling. Patrice Koehl
Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:
More informationIdentification of correct regions in protein models using structural, alignment, and consensus information
Identification of correct regions in protein models using structural, alignment, and consensus information BJO RN WALLNER AND ARNE ELOFSSON Stockholm Bioinformatics Center, Stockholm University, SE-106
More informationModeling for 3D structure prediction
Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing
More informationNeural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha
Neural Networks for Protein Structure Prediction Brown, JMB 1999 CS 466 Saurabh Sinha Outline Goal is to predict secondary structure of a protein from its sequence Artificial Neural Network used for this
More informationProtein Modeling. Generating, Evaluating and Refining Protein Homology Models
Protein Modeling Generating, Evaluating and Refining Protein Homology Models Troy Wymore and Kristen Messinger Biomedical Initiatives Group Pittsburgh Supercomputing Center Homology Modeling of Proteins
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationTHE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
More informationBuilding 3D models of proteins
Building 3D models of proteins Why make a structural model for your protein? The structure can provide clues to the function through structural similarity with other proteins With a structure it is easier
More informationSteps in protein modelling. Structure prediction, fold recognition and homology modelling. Basic principles of protein structure
Structure prediction, fold recognition and homology modelling Marjolein Thunnissen Lund September 2012 Steps in protein modelling 3-D structure known Comparative Modelling Sequence of interest Similarity
More informationProcheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.
Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond
More informationPhysiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
More informationProgramme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues
Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback
More informationProtein Structure Prediction, Engineering & Design CHEM 430
Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment
More informationAnalysis and Prediction of Protein Structure (I)
Analysis and Prediction of Protein Structure (I) Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 2006 Free for academic use. Copyright @ Jianlin Cheng
More information114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009
114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 9 Protein tertiary structure Sources for this chapter, which are all recommended reading: D.W. Mount. Bioinformatics: Sequences and Genome
More informationMolecular Modeling Lecture 7. Homology modeling insertions/deletions manual realignment
Molecular Modeling 2018-- Lecture 7 Homology modeling insertions/deletions manual realignment Homology modeling also called comparative modeling Sequences that have similar sequence have similar structure.
More informationHomology Modeling I. Growth of the Protein Data Bank PDB. Basel, September 30, EMBnet course: Introduction to Protein Structure Bioinformatics
Swiss Institute of Bioinformatics EMBnet course: Introduction to Protein Structure Bioinformatics Homology Modeling I Basel, September 30, 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute
More informationProtein structure analysis. Risto Laakso 10th January 2005
Protein structure analysis Risto Laakso risto.laakso@hut.fi 10th January 2005 1 1 Summary Various methods of protein structure analysis were examined. Two proteins, 1HLB (Sea cucumber hemoglobin) and 1HLM
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr
More informationStatistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics
Statistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics Jianlin Cheng, PhD Department of Computer Science University of Missouri, Columbia
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction
CMPS 6630: Introduction to Computational Biology and Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the
More informationCMPS 3110: Bioinformatics. Tertiary Structure Prediction
CMPS 3110: Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the laws of physics! Conformation space is finite
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationProtein Modeling Methods. Knowledge. Protein Modeling Methods. Fold Recognition. Knowledge-based methods. Introduction to Bioinformatics
Protein Modeling Methods Introduction to Bioinformatics Iosif Vaisman Ab initio methods Energy-based methods Knowledge-based methods Email: ivaisman@gmu.edu Protein Modeling Methods Ab initio methods:
More informationSecondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure
Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison
CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More informationProtein Structure Prediction and Display
Protein Structure Prediction and Display Goal Take primary structure (sequence) and, using rules derived from known structures, predict the secondary structure that is most likely to be adopted by each
More informationSummary of Experimental Protein Structure Determination. Key Elements
Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More information7.91 Amy Keating. Solving structures using X-ray crystallography & NMR spectroscopy
7.91 Amy Keating Solving structures using X-ray crystallography & NMR spectroscopy How are X-ray crystal structures determined? 1. Grow crystals - structure determination by X-ray crystallography relies
More informationProtein structure (and biomolecular structure more generally) CS/CME/BioE/Biophys/BMI 279 Sept. 28 and Oct. 3, 2017 Ron Dror
Protein structure (and biomolecular structure more generally) CS/CME/BioE/Biophys/BMI 279 Sept. 28 and Oct. 3, 2017 Ron Dror Please interrupt if you have questions, and especially if you re confused! Assignment
More informationMolecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007
Molecular Modeling Prediction of Protein 3D Structure from Sequence Vimalkumar Velayudhan Jain Institute of Vocational and Advanced Studies May 21, 2007 Vimalkumar Velayudhan Molecular Modeling 1/23 Outline
More informationProtein structure. Protein structure. Amino acid residue. Cell communication channel. Bioinformatics Methods
Cell communication channel Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu SEQUENCE STRUCTURE DNA Sequence Protein Sequence Protein Structure Protein structure ATGAAATTTGGAAACTTCCTTCTCACTTATCAGCCACCT...
More informationProtein Structure Determination
Protein Structure Determination Given a protein sequence, determine its 3D structure 1 MIKLGIVMDP IANINIKKDS SFAMLLEAQR RGYELHYMEM GDLYLINGEA 51 RAHTRTLNVK QNYEEWFSFV GEQDLPLADL DVILMRKDPP FDTEFIYATY 101
More informationPacking of Secondary Structures
7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary
More informationCS612 - Algorithms in Bioinformatics
Fall 2017 Protein Structure Detection Methods October 30, 2017 Comparative Modeling Comparative modeling is modeling of the unknown based on comparison to what is known In the context of modeling or computing
More informationProtein Structures. 11/19/2002 Lecture 24 1
Protein Structures 11/19/2002 Lecture 24 1 All 3 figures are cartoons of an amino acid residue. 11/19/2002 Lecture 24 2 Peptide bonds in chains of residues 11/19/2002 Lecture 24 3 Angles φ and ψ in the
More informationSCOP. all-β class. all-α class, 3 different folds. T4 endonuclease V. 4-helical cytokines. Globin-like
SCOP all-β class 4-helical cytokines T4 endonuclease V all-α class, 3 different folds Globin-like TIM-barrel fold α/β class Profilin-like fold α+β class http://scop.mrc-lmb.cam.ac.uk/scop CATH Class, Architecture,
More informationProtein structures and comparisons ndrew Torda Bioinformatik, Mai 2008
Protein structures and comparisons ndrew Torda 67.937 Bioinformatik, Mai 2008 Ultimate aim how to find out the most about a protein what you can get from sequence and structure information On the way..
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationTemplate Based Protein Structure Modeling Jianlin Cheng, PhD
Template Based Protein Structure Modeling Jianlin Cheng, PhD Professor Department of EECS Informatics Institute University of Missouri, Columbia 2018 Sequence, Structure and Function AGCWY Cell Protein
More information1-D Predictions. Prediction of local features: Secondary structure & surface exposure
1-D Predictions Prediction of local features: Secondary structure & surface exposure 1 Learning Objectives After today s session you should be able to: Explain the meaning and usage of the following local
More informationWeek 10: Homology Modelling (II) - HHpred
Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative
More informationProtein Secondary Structure Prediction
Protein Secondary Structure Prediction Doug Brutlag & Scott C. Schmidler Overview Goals and problem definition Existing approaches Classic methods Recent successful approaches Evaluating prediction algorithms
More informationIT og Sundhed 2010/11
IT og Sundhed 2010/11 Sequence based predictors. Secondary structure and surface accessibility Bent Petersen 13 January 2011 1 NetSurfP Real Value Solvent Accessibility predictions with amino acid associated
More informationCopyright Mark Brandt, Ph.D A third method, cryogenic electron microscopy has seen increasing use over the past few years.
Structure Determination and Sequence Analysis The vast majority of the experimentally determined three-dimensional protein structures have been solved by one of two methods: X-ray diffraction and Nuclear
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinff18.html Proteins and Protein Structure
More informationProtein structure alignments
Protein structure alignments Proteins that fold in the same way, i.e. have the same fold are often homologs. Structure evolves slower than sequence Sequence is less conserved than structure If BLAST gives
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationHomology Modeling. Roberto Lins EPFL - summer semester 2005
Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton,
More informationGet familiar with PDBsum and the PDB Extract atomic coordinates from protein data files Compute bond angles and dihedral angles
CS483 Assignment #2 Due date: Mar. 1 at the start of class. Protein Geometry Bedbug spit? Just say NO! Purpose of this assignment Get familiar with PDBsum and the PDB Extract atomic coordinates from protein
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationProperties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but not the only one!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids repeated
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Enhanced Recognition of Transmembrane Protein Domains with Prediction-based Structural Profiles Baoqiang Cao, Aleksey Porollo, Rafal Adamczak, Mark Jarrell and Jaroslaw Meller Contact:
More informationComputational Molecular Biology. Protein Structure and Homology Modeling
Computational Molecular Biology Protein Structure and Homology Modeling Prof. Alejandro Giorge1 Dr. Francesco Musiani Sequence, function and structure relationships v Life is the ability to metabolize
More informationModel Mélange. Physical Models of Peptides and Proteins
Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.
More informationContact map guided ab initio structure prediction
Contact map guided ab initio structure prediction S M Golam Mortuza Postdoctoral Research Fellow I-TASSER Workshop 2017 North Carolina A&T State University, Greensboro, NC Outline Ab initio structure prediction:
More information09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition
Sequence identity Structural similarity Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Fold recognition Sommersemester 2009 Peter Güntert Structural similarity X Sequence identity Non-uniform
More informationTemplate Free Protein Structure Modeling Jianlin Cheng, PhD
Template Free Protein Structure Modeling Jianlin Cheng, PhD Associate Professor Computer Science Department Informatics Institute University of Missouri, Columbia 2013 Protein Energy Landscape & Free Sampling
More informationProtein quality assessment
Protein quality assessment Speaker: Renzhi Cao Advisor: Dr. Jianlin Cheng Major: Computer Science May 17 th, 2013 1 Outline Introduction Paper1 Paper2 Paper3 Discussion and research plan Acknowledgement
More informationProtein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror
Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major
More informationProtein Structure Prediction
Protein Structure Prediction Michael Feig MMTSB/CTBP 2006 Summer Workshop From Sequence to Structure SEALGDTIVKNA Ab initio Structure Prediction Protocol Amino Acid Sequence Conformational Sampling to
More informationThe Structure and Functions of Proteins
Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science and Engineering 2003 The Structure and Functions of Proteins Dan E. Krane Wright State University
More informationBioinformatics Practical for Biochemists
Bioinformatics Practical for Biochemists Andrei Lupas, Birte Höcker, Steffen Schmidt WS 2013/14 03. Sequence Features Targeting proteins signal peptide targets proteins to the secretory pathway N-terminal
More informationDihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769
Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral
More informationSupersecondary Structures (structural motifs)
Supersecondary Structures (structural motifs) Various Sources Slide 1 Supersecondary Structures (Motifs) Supersecondary Structures (Motifs): : Combinations of secondary structures in specific geometric
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationSequence Bioinformatics. Multiple Sequence Alignment Waqas Nasir
Sequence Bioinformatics Multiple Sequence Alignment Waqas Nasir 2010-11-12 Multiple Sequence Alignment One amino acid plays coy; a pair of homologous sequences whisper; many aligned sequences shout out
More informationNumber sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence
Number sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence Naoto Morikawa (nmorika@genocript.com) October 7, 2006. Abstract A protein is a sequence
More informationHomology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana
www.bioinformation.net Hypothesis Volume 6(3) Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana Karim Kherraz*, Khaled Kherraz, Abdelkrim Kameli Biology department, Ecole Normale
More informationBioinformatics III Structural Bioinformatics and Genome Analysis Part Protein Secondary Structure Prediction. Sepp Hochreiter
Bioinformatics III Structural Bioinformatics and Genome Analysis Part Protein Secondary Structure Prediction Institute of Bioinformatics Johannes Kepler University, Linz, Austria Chapter 4 Protein Secondary
More informationProtein Structure Bioinformatics Introduction
1 Swiss Institute of Bioinformatics Protein Structure Bioinformatics Introduction Basel, 27. September 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute of Bioinformatics Klingelbergstr
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationViewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
More informationAlpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University
Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and
More informationPROTEIN SECONDARY STRUCTURE PREDICTION: AN APPLICATION OF CHOU-FASMAN ALGORITHM IN A HYPOTHETICAL PROTEIN OF SARS VIRUS
Int. J. LifeSc. Bt & Pharm. Res. 2012 Kaladhar, 2012 Research Paper ISSN 2250-3137 www.ijlbpr.com Vol.1, Issue. 1, January 2012 2012 IJLBPR. All Rights Reserved PROTEIN SECONDARY STRUCTURE PREDICTION:
More informationDATE A DAtabase of TIM Barrel Enzymes
DATE A DAtabase of TIM Barrel Enzymes 2 2.1 Introduction.. 2.2 Objective and salient features of the database 2.2.1 Choice of the dataset.. 2.3 Statistical information on the database.. 2.4 Features....
More informationSecondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationStructural Alignment of Proteins
Goal Align protein structures Structural Alignment of Proteins 1 2 3 4 5 6 7 8 9 10 11 12 13 14 PHE ASP ILE CYS ARG LEU PRO GLY SER ALA GLU ALA VAL CYS PHE ASN VAL CYS ARG THR PRO --- --- --- GLU ALA ILE
More informationReport of protein analysis
Report of protein analysis By the WHAT IF program 2010-09-19 1 Introduction what check is the name of the validation option in what if. It doesn t matter whether you use the what check program or the what
More informationPresentation Outline. Prediction of Protein Secondary Structure using Neural Networks at Better than 70% Accuracy
Prediction of Protein Secondary Structure using Neural Networks at Better than 70% Accuracy Burkhard Rost and Chris Sander By Kalyan C. Gopavarapu 1 Presentation Outline Major Terminology Problem Method
More informationPrediction and refinement of NMR structures from sparse experimental data
Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk
More informationProtein Structure Prediction
Protein Structure Prediction Michael Feig MMTSB/CTBP 2009 Summer Workshop From Sequence to Structure SEALGDTIVKNA Folding with All-Atom Models AAQAAAAQAAAAQAA All-atom MD in general not succesful for real
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationBioinformatics. Macromolecular structure
Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationSupplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two
Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for
More informationDesign of a Novel Globular Protein Fold with Atomic-Level Accuracy
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein
More informationDetails of Protein Structure
Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives
More information