Supplementary Information
|
|
- Marjorie Welch
- 5 years ago
- Views:
Transcription
1 Supplementary Information Following evolutionary paths to high affinity an seletivity protein-protein interations Kalia Bernath Levin, Orly Dym, Shira Albek, Shlomo Magassi, Anthony H. Keeble, Colin Kleanthous an Dan S. Tawfik
2 a Im9 R5-4 R5-10 R5-11 R8-1 R8-6 R8-7 R8-4 R8-8 R12-2 R12-4 R12-13 Im7 b Supplementary Figure 1 Sequene alignment of Immunity proteins an oliins. (a) Amino-ai sequene alignment of the two wil types (Im9 an Im7) an nevim7 variants. (b) Amino-ai sequene alignment of ColE7 an ColE9 C-terminal region.
3 a b His-ColE7 H103A sr5-4 Im9 sr5-10 Im9 sr5-11 Im9 1:1 2:1 4:1 8:1 1:1 2:1 4:1 8:1 1:1 2:1 4:1 8:1 Supplementary Figure 2 Competition between Roun 5 variants an Im9 for bining to ColE7. Equimolar onentration (3µM) of his-cole7 with one of Roun 5 variants ((a) sr5-4, (b) sr5-10, an () sr5-11, eah arrying a strep-tag), an wil-type Im9. ColE7, the evolve variant, an wil-type Im9, an were mixe at varying molar ratios of 1:1:1, 1:1:2, 1:1:4 an 1:1:8, respetively, (in 50mM MOPS ph 7, 50 mm NaCl buffer). The proteins were equilibrate overnight at room temperature. The mix was further inubate for two hours with Ni-NTA resin, then loae onto a syringe olumn, rinse one with buffer, an the omplexes (his-e7-im protein) were elute with buffer plus 300mM imiazole. SDS-PAGE analysis reveale the ratio between the evolve Im9 variant an wil-type Im9. The evolve variants were foun to bin ColE7 with higher affinity ompare to Im9, as iniate by the isplaement of wil-type Im9, even when the latter was present at higher onentration. Variants R5-10 an R5-10 exhibit higher affinity than variant R5-4, sine at a ratio of 1:8 with wil-type Im9, they were able to isplae Im9.
4 Arg530 Tyr54 Lys528 Tyr/Trp55 Phe541 Phe513 Supplementary Figure 3 The Tyr55Trp mutation in the onserve hot spot. The figure shows an overlay of the two nevim7 variants R12-2 (green, R12-2 an R12-13 in orange). Tyr55 in R12-2 is well aligne to the 5-membere inole ring, both are able to sustain the hyrophobi ore an reate a hyrogen bon to Lys528 bakbone (2.35Å an 2.79Å in an 12-2 respetively). However, the aitional bulkiness of the Trp may ontribute in expaning its hyrophobi interations to Phe541 an Phe513 (istanes in the range of 4Å-4.7Å) also leaing to the small shift in the alkyl hain of Arg530. The overall strutures of the two variants align very well also in their boun onfiguration.
5 a b Glu/Gly41 Glu41 Glu41 Thr531 Lys97 Lys528 e f Gly41 Val42 Thr531 Thr531 Supplementary Figure 4 The orthogonal aquisition of seletivity. The seletive inhibitors evolve by aquiring a single mutation at resiue 41. The similarity in struture an ColE7 bining onfiguration show that seletivity ourre inepenently from ColE7 inhibition. (a) Overall strutural alignment of the two evolve variants (resiues 125 are missing for larity): variant R12-2 (in green) that arries the seletivity Glu41Gly mutation an oes not ross-reat with ColE9; an R12-13 that retains Glu41, an
6 inhibits ColE9 to a measurable egree (orange). The piture is a result of whole omplex alignment. Resiues 54 an 55 are shown in stiks as referene. (b) A zoom in for the region of resiue 41. Resiue 41 sie-hain is highlighte in stiks, whereas only the bakbone of neighboring resiues are showen. () The boun Im9 (magenta an ColE9 (green). Glu41 makes a salt brige to ColE9 s Lys97 (3.18Å). () The boun variant R12-13 (yan) an ColE7 (green). The losest ColE7 resiues ontating R12-13 s Glu41 are Thr531 (3.37Å) an Lys528 (8.85Å). (e) The boun variant R12-2 (blue) an ColE7 (green).the losest ColE7 resiues to R12-2 s Gly41 are Thr531 (9.48Å). (f) The boun Im7 (re) an ColE7 (green). The losest ColE7 resiue to Im7 is Thr531 (6.67Å).
7 a E7_sR8-1 b E7_sR8-8 E7_sR12-4 Supplementary Figure 5 Representative SPR sensograms. Bining of variants to hips oate with ColE7was etete at various immunity protein onentrations: variant sr8-1 (a, 300, 500, 600nM), variant sr8-8 (b, 100, 200, 400nM), an variant sr12-4 (, 100, 200, 300nM). Dissoiation urves fitte to a single exponential (inset).
8 Denaturation urve Im9 R5-4 R5-10 R8-1 R8-7 R8-4 R12-2 Im7 + a Urea onentration (M) b Fration fole Fration fole Fration fole Urea onentration (M) Urea onentration (M) Supplementary Figure 6 Urea enaturation urves. Unfoling of immunity proteins was followe by measuring their fluoresene at 355nm in the presene of variousonentrations of urea 4. (a) The wil-type Im9 is muh more stable than wiltype Im7, whereas the variants stability lay between them, starting from high stability of Roun 5 variants to low in variant of Roun 12. Data were fitte to a two-state transition moel as esribe 4 an the resulting D 50 an m values are provie in Supplementary Table 1. (b) The erease in stability is most apparent in two of the intermeiate variants that aumulate loop mutations: R5-11 (b) an R8-6 (). These variants (an variant R8-
9 1, that showe the lowest m value; panel a o not arry the stabilizing mutation V37I, an seem to unfol non-ooperatively. The loss of stability is also manifeste in low expression levels an onsequently in the low in-vivo inhibition potenies of these variants towars both ColE9 an ColE7 (Supplementary Table 1). Experimental etails: 500µM of the strep-tag proteins were resuspene in buffer (50mM phosphate buffer ph 7, 2mM DTT, 1mM EDTA) an mixe 1:10 with inreasing onentration of urea in the same buffer. Following two hours inubation at room temperature, fluoresene was measure at room temperature in a Cary elipse (Varian) fluoresene spetrophotometer using exitation at 280nm; an emission at 355 nm measure at room temperature.
10 His-ColE7 H103A a His-ColE7 H103A b sr12-4 Im7 Time: 22min 30min 45min 2hrs 20hrs % replae: sr12-13 Im7 Time: 22min 30min 45min 2hrs % replae: Supplementary Figure 7 Dissoiation kinetis by Im protein exhange. Slow issoiation kinetis were measure by a hase experiment. Pre-mae omplexes of ColE7 an Im variant arrying a strep-tag (sr12-4, a, or sr12-13, b, 1µM, in 50mM MOPS ph 7, 200mM NaCl) were hase with a ten-fol exess of wil-type Im7 without a tag (10 µm). At ifferent time points, Ni-NTA resin (Qiagen) was ae an the mix was inubate for 15 minutes while shaking. The unboun supernatant was rapily ispose by loaing the mix onto a syringe-olumn. The resin was rinse with the same buffer an the boun omplex was elute with buffer plus 300mM imiazole. The eluants were onentrate with a Nanosep 3K (Pall orporation) an analyse by 15% SDS- PAGE. The ratio between the protein bans orresponing to the strep-tagge Im-variant (MW= 11.3kDa) an wil-type Im7 (MW= 9.9kDa) were measure by ensitometry using the GeneQuant software. In aorane with the SPR results, the t 1/2 for E7 sr12-4 issoiation was between 22 to 30 mins (k off SPR= s -1, t 1/2 =14.4 mins), an the t 1/2 for E7 sr12-13 issoiation was 20 mins (k off SPR= s -1, t 1/2 =8.9 mins).
11 Supplementary Table 1. Inhibition poteny, bining, an stability of Im variants Variant a Stability Urea enatura tion m kal/m ol/m urea D 50 (M) 1mM IPTG In vivo protetion ColE7 (M) b 0.05 mm IPTG In vivo inhibition poteny an affinity ColE7 ColE9 Bining parameters Stoppe-flow In vivo protetion /SPR ColE9 (M) b Basal k on ( 10 6 M -1 s -1 ) k off (s -1 ) Wiltype Im e 5.34 Im9 V34D R K (M) 1mM IPTG 0.05 mm IPTG Basal Bining parameters Stoppe-flow /SPR k on ( 10 6 k off (s -1 ) K (M) M -1 s -1 ) >10-4 >10-4 > e >10-4 >10-4 > n. f >10-4 >10-4 >10-4 f R <10-8f >10-4 >10-4 >10-4 f i i R <10-8f >10-4 > f 10-8 R n. > R8-6 R8-6 E41G i i n. >10-4 > n R >> R8-7 E41G (±24) n. -4 > >10-4 >10-4 >> >10-4 > R8-8 h h >>10-4 >> R8-8 E41G R >> >10-4 >10-4 >10-4 >>10-4 >> > R >>10-4 >> R12-4 h h >>10-4 >>10-4 >>10-4 R12-13 h h >>10-4 >>10-4 >>10-4 Wiltype Im >10-4 >10-4 >10-4 ~ g > g > g >10-4 >10-4 > >>10-4 >>10-4 >> e n. ~ ~ g ~ g ~ g n. n. 10-4e a The numbering of the nevim7 variants (e.g. R8-7) iniates the roun of mutationseletion from whih it was isolate (e.g. Roun 8), an the sequential number of the
12 variant in the series analyze (e.g. the 7 th variant). The omplete sequenes are available in Supplementary Fig. 1. b The in vivo protetion levels were etermine with E. oli ells expressing the enote Im variant, treate with inreasing onentrations of either ColE7, or ColE9 omplex (10-4 to M). The table iniates the maximal onentration of ColE uner whih E. oli growth remaine unaffete. The test was performe at ifferent Im protein expression levels: basal in the absene of the IPTG inution; low inution levels (0.05M IPTG), an full inution (1M IPTG) 1., Bining parameters were etermine by stoppe-flow () 2, or SPR () 3 (see Supplementary Table 2 for ata an error ranges, whih were below 10%). The two measurements gave essentially the same k off values with ColE9, but the values measure by SPR for issoiation from ColE7 eviate onsistently by a fator of ~3. The k off values for Roun 12 variants were also onfirme by exhange an ompetition experiments (Supplementary Fig. 7). e Bining parameters from 1. f The issoiation rates for Roun 5 were off-range for SPR: issoiation from ColE7 was too fast, an from ColE9 too slow. Their higher affinity towars ColE7 relative to Im9 was onfirme by ompetition experiments. These iniate that variants R5-10 an R5-11 exhibit > 10-fol higher affinity than Im9, sine at a ratio of 1:8 with wil-type Im9, they were still able to isplae Im9 (Supplementary Fig. 2). g K values were eue assuming the average k on vales are measure in the stoppe flow for Roun 8 variants, an k off values measure by SPR (as is for ColE9, an orrete for ColE7 where ~3-fol slower rates were measure by stoppe-flow. h These variants arry the Trp55 mutation that prevente etetion of enaturation by fluoresene emission. i Denaturation appears to be non-ooperative an oul not be fitte to a sigmoial moel (Supplementary Fig. 5).
13 Supplementary Table 2. Surfae Plasmon Resonane (SPR) measurements ColE9 issoiation rates Averag Variant k off se k off se ColE7 issoiation rates Error range 10-3 k off se Averag k off se Error range 10-3 sr5-4 sr5-10 sr5-11 sr sr sr R8-7 * sr sr sr sr12-4 * sr The k off values etermine by SPR (BIAore) are a result of 2-3 inepenent measurements after reution of bakgroun signals (representative traes are given as Supplementary Fig. 6). Variants were mostly purifie with a sterp-tag (Novagen) labele with an s in front of the variant s annotation. However, variant R8-7 that was assaye with an without a tag iniate that the tag ha no effet on the bining parameters. Bakgroun signals were taken from either the wil-type sensograms (Im9 or Im7, whose k off is too slow for issoiation within the time sale of the experiment), or BSA in ases where in whih the wil-type an variant sensograms were not well synhronize uring the experiment s timesale (annotate with *). The variants onentration was between nm. Variants with issoiation rates beyon the measuring range of BIAore are marke as not etermine (). These rates were evaluate by other methos (Supplementary Fig. 2 & 7).
14 Referenes 1. Li, W. et al. Highly isriminating protein-protein interation speifiities in the ontext of a onserve bining energy hotspot. J Mol Biol 337, (2004). 2. Wallis, R. et al. Protein-protein interations in oliin E9 DNase-immunity protein omplexes. 2. Cognate an nonognate interations that span the millimolar to femtomolar affinity range. Biohemistry 34, (1995). 3. Kortemme, T. et al. Computational reesign of protein-protein interation speifiity. Nat Strut Mol Biol 11, (2004). 4. Ferguson, N., Capali, A.P., James, R., Kleanthous, C. & Rafor, S.E. Rapi foling with an without populate intermeiates in the homologous four-helix proteins Im7 an Im9. J Mol Biol 286, (1999).
Supplementary Materials for A universal data based method for reconstructing complex networks with binary-state dynamics
Supplementary Materials for A universal ata ase metho for reonstruting omplex networks with inary-state ynamis Jingwen Li, Zhesi Shen, Wen-Xu Wang, Celso Greogi, an Ying-Cheng Lai 1 Computation etails
More informationSome Useful Results for Spherical and General Displacements
E 5 Fall 997 V. Kumar Some Useful Results for Spherial an General Displaements. Spherial Displaements.. Eulers heorem We have seen that a spherial isplaement or a pure rotation is esribe by a 3 3 rotation
More informationPhysics of Relaxation. Outline
Physis of Relaxation Weiguo Li Outline Fundamental relaxation Mehanisms Magneti dipole-dipole oupling» Stati oupling» Dynami oupling Frequeny dependene of relaxation Rate Temperature dependene of relaxation
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationSupporting Information
Supporting Information Olsman and Goentoro 10.1073/pnas.1601791113 SI Materials Analysis of the Sensitivity and Error Funtions. We now define the sensitivity funtion Sð, «0 Þ, whih summarizes the steepness
More informationDissecting electrostatic interactions in Bacillus circulans xylanase through NMR-monitored ph titrations
J Biomol NMR (2011) 51:5 19 DOI 10.1007/s10858-011-9537-x ARTICLE Disseting eletrostati interations in Baillus irulans xylanase through NMR-monitore ph titrations Lawrene P. MIntosh Daigo Naito Simon J.
More informationChapter 9. There are 7 out of 50 measurements that are greater than or equal to 5.1; therefore, the fraction of the
Pratie questions 6 1 a y i = 6 µ = = 1 i = 1 y i µ i = 1 ( ) = 95 = s n 95 555. x i f i 1 1+ + 5+ n + 5 5 + n µ = = = f 11+ n 11+ n i 7 + n = 5 + n = 6n n = a Time (minutes) 1.6.1.6.1.6.1.6 5.1 5.6 6.1
More informationPerformance Evaluation of atall Building with Damped Outriggers Ping TAN
Performane Evaluation of atall Builing with Dampe Outriggers Ping TAN Earthquake Engineering Researh an Test Center Guangzhou University, Guangzhou, China OUTLINES RESEARCH BACKGROUND IMPROVED ANALYTICAL
More informationPN Code Tracking Loops
Wireless Information Transmission System Lab. PN Coe Traking Loops Institute of Communiations Engineering National Sun Yat-sen University Introution Coe synhronization is generally arrie out in two steps
More information1 - a 1 - b 1 - c a) 1 b) 2 c) -1 d) The projection of OP on a unit vector OQ equals thrice the area of parallelogram OPRQ.
Regter Number MODEL EXAMINATION PART III - MATHEMATICS [ENGLISH VERSION] Time : Hrs. Ma. Marks : 00 SECTION - A 0 = 0 Note :- (i) All questions are ompulsory. (ii) Eah question arries one mark. (iii) Choose
More informationThermodynamic measurements
Thermoynamic measurements When stuying protein structure an function, it is essential to measure various physical quantities, incluing: thermal an chemical stability bining affinity to a ligan solubility
More informationChapter 2: One-dimensional Steady State Conduction
1 Chapter : One-imensional Steay State Conution.1 Eamples of One-imensional Conution Eample.1: Plate with Energy Generation an Variable Conutivity Sine k is variable it must remain insie the ifferentiation
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationThe numbers inside a matrix are called the elements or entries of the matrix.
Chapter Review of Matries. Definitions A matrix is a retangular array of numers of the form a a a 3 a n a a a 3 a n a 3 a 3 a 33 a 3n..... a m a m a m3 a mn We usually use apital letters (for example,
More informationIn this assignment you will build a simulation of the presynaptic terminal.
9.16 Problem Set #2 In this assignment you will buil a simulation of the presynapti terminal. The simulation an be broken own into three parts: simulation of the arriving ation potential (base on the Hogkin-Huxley
More informationSimultaneous and Sequential Auctions of Oligopoly Licenses
Simultaneous an Sequential Autions of Oligopoly Lienses Georgios Katsenos Institut für Mikroökonomik, Leibniz Universität Hannover September 1, 2007 Abstrat This paper ompares two proeures for alloating
More informationChapter 2. Characterization of silver nanoparticles biosynthesized. using the selected fungi
Chapter 2 Charaterization of silver nanopartiles iosynthesize using the selete fungi INTRODUCTION There are a numer of tehniques that are availale for etetion an haraterization of silver nanopartiles an
More informationl. For adjacent fringes, m dsin m
Test 3 Pratie Problems Ch 4 Wave Nature of Light ) Double Slit A parallel beam of light from a He-Ne laser, with a wavelength of 656 nm, falls on two very narrow slits that are 0.050 mm apart. How far
More informationCompetitive adsorption of. Polyelectrolytes- A size exclusion chromatographic study. New York, N.Y
ompetitive adsorption of Polyeletrolytes A size exlusion hromatographi study RRamahandran and PSomasundaran, Henry Krumb Shool of Hines, olumbia University, ew York, Y 127 Abstrat ompetitive adsorption
More informationBacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
More informationSupplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two
Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for
More informationDetermination the Invert Level of a Stilling Basin to Control Hydraulic Jump
Global Avane Researh Journal of Agriultural Siene Vol. (4) pp. 074-079, June, 0 Available online http://garj.org/garjas/inex.htm Copyright 0 Global Avane Researh Journals Full Length Researh Paper Determination
More informationml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS
a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex
More informationCSIR-UGC NET/JRF JUNE - 6 PHYSICAL SCIENCES OOKLET - [A] PART. The raius of onvergene of the Taylor series epansion of the funtion (). The value of the ontour integral the anti-lokwise iretion, is 4z e
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More information= ν L. C ν L. = ν R. P ν L. CP ν L. CP Violation. Standard Model contains only left-handed neutrinos and right-handed anti-neutrinos
Phy489 Leture 9 1 CP iolation Stanar Moel ontains only left-hane neutrinos an right-hane anti-neutrinos C ν L = ν L harge onjugation not a symmetry of the weak interation P ν L = ν R parity also not onserve
More informationSampler-B. Secondary Mathematics Assessment. Sampler 521-B
Sampler-B Seonary Mathematis Assessment Sampler 51-B Instrutions for Stuents Desription This sample test inlues 15 Selete Response an 5 Construte Response questions. Eah Selete Response has a value of
More informationGLOBAL EDITION. Calculus. Briggs Cochran Gillett SECOND EDITION. William Briggs Lyle Cochran Bernard Gillett
GOBA EDITION Briggs Cohran Gillett Calulus SECOND EDITION William Briggs le Cohran Bernar Gillett ( (, ) (, ) (, Q ), Q ) (, ) ( Q, ) / 5 /4 5 5 /6 7 /6 ( Q, 5 5 /4 ) 4 4 / 7 / (, ) 9 / (, ) 6 / 5 / (Q,
More informationParamagnetic Effects BCMB/CHEM
Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationMillennium Relativity Acceleration Composition. The Relativistic Relationship between Acceleration and Uniform Motion
Millennium Relativity Aeleration Composition he Relativisti Relationship between Aeleration and niform Motion Copyright 003 Joseph A. Rybzyk Abstrat he relativisti priniples developed throughout the six
More informationSupporting information for
Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of
More informationEvaluation of effect of blade internal modes on sensitivity of Advanced LIGO
Evaluation of effet of blade internal modes on sensitivity of Advaned LIGO T0074-00-R Norna A Robertson 5 th Otober 00. Introdution The urrent model used to estimate the isolation ahieved by the quadruple
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationDynamic Progressive Buckling of Square Tubes
THE 7TH CONFERENCE ON THEORETICAL. AND ALIED MECHANICS Tainan,Taiwan,R.O.C., - Deeber Dynai rogressive Bukling of Square Tubes Chih-Cheng Yang Departent of Autoation Engineering Kao Yuan Institute of Tehnology
More informationDesigning Against Size Effect on Shear Strength of Reinforced Concrete Beams Without Stirrups
Designing Against Size Effet on Shear Strength of Reinfore Conrete Beams Without Stirrups By Zeněk P. Bažant an Qiang Yu Abstrat: The shear failure of reinfore onrete beams is a very omplex frature phenomenon
More informationSensitivity Analysis of Resonant Circuits
1 Sensitivity Analysis of Resonant Ciruits Olivier Buu Abstrat We use first-orer perturbation theory to provie a loal linear relation between the iruit parameters an the poles of an RLC network. The sensitivity
More informationPacking of Secondary Structures
7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary
More informationSupporting Information
Protein-Observed Fluorine NMR is a Complementary Ligand Discovery Method to 1 H CPMG Ligand- Observed NMR. Andrew K. Urick, 1,2 Luis Pablo Calle, 3 Juan F. Espinosa, 3 Haitao Hu, 2 * William C. K. Pomerantz
More informationSupplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
More informationELECTROMAGNETIC NORMAL MODES AND DISPERSION FORCES.
ELECTROMAGNETIC NORMAL MODES AND DISPERSION FORCES. All systems with interation of some type have normal modes. One may desribe them as solutions in absene of soures; they are exitations of the system
More informationAnnouncements. Office Hours Swap: OH schedule has been updated to reflect this.
SA Solving Announements Offie Hours Swap: Zavain has offie hours from 4-6PM toay in builing 460, room 040A. Rose has offie hours tonight from 7-9PM in Gates B26B. Keith has offie hours hursay from 2-4PM
More informationSupplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
More informationMcCreight s Suffix Tree Construction Algorithm. Milko Izamski B.Sc. Informatics Instructor: Barbara König
1. Introution MCreight s Suffix Tree Constrution Algorithm Milko Izamski B.S. Informatis Instrutor: Barbara König The main goal of MCreight s algorithm is to buil a suffix tree in linear time. This is
More informationSupporting Information. Chemo-enzymatic Synthesis of Isotopically Labeled Nicotinamide Ribose
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Chemo-enzymatic Synthesis of Isotopically Labeled
More informationOptical Emission Spectroscopy in HMDSO/O 2 RF Glow Discharge
WDS'5 Proeeings of Contriute Papers, Part II, 8, 5. ISBN 8-87-59- MATFYZPRESS ptial Emission Spetrosopy in HMDS/ RF Glow Disharge R. Šmí an L. Zajíčková Department of Physial Eletronis, Masaryk University,
More informationHeat exchangers: Heat exchanger types:
Heat exhangers: he proess of heat exhange between two fluids that are at different temperatures and separated by a solid wall ours in many engineering appliations. he devie used to implement this exhange
More informationFW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationProtocol for 2D-E. Protein Extraction
Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as
More informationSupplementary Materials
Supplementary Materials Neural population partitioning and a onurrent brain-mahine interfae for sequential motor funtion Maryam M. Shanehi, Rollin C. Hu, Marissa Powers, Gregory W. Wornell, Emery N. Brown
More informationThe Gravitational Potential for a Moving Observer, Mercury s Perihelion, Photon Deflection and Time Delay of a Solar Grazing Photon
Albuquerque, NM 0 POCEEDINGS of the NPA 457 The Gravitational Potential for a Moving Observer, Merury s Perihelion, Photon Defletion and Time Delay of a Solar Grazing Photon Curtis E. enshaw Tele-Consultants,
More informationQCLAS Sensor for Purity Monitoring in Medical Gas Supply Lines
DOI.56/sensoren6/P3. QLAS Sensor for Purity Monitoring in Medial Gas Supply Lines Henrik Zimmermann, Mathias Wiese, Alessandro Ragnoni neoplas ontrol GmbH, Walther-Rathenau-Str. 49a, 7489 Greifswald, Germany
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationComputing 2-Walks in Cubic Time
Computing 2-Walks in Cubi Time Anreas Shmi Max Plank Institute for Informatis Jens M. Shmit Tehnishe Universität Ilmenau Abstrat A 2-walk of a graph is a walk visiting every vertex at least one an at most
More informationReliability Optimization With Mixed Continuous-Discrete Random Variables and Parameters
Subroto Gunawan Researh Fellow Panos Y. Papalambros Professor e-mail: pyp@umih.eu Department of Mehanial Engineering, University of Mihigan, Ann Arbor, MI 4809 Reliability Optimization With Mixe Continuous-Disrete
More informationLinear Capacity Scaling in Wireless Networks: Beyond Physical Limits?
Linear Capaity Saling in Wireless Networks: Beyon Physial Limits? Ayfer Özgür, Olivier Lévêque EPFL, Switzerlan {ayfer.ozgur, olivier.leveque}@epfl.h Davi Tse University of California at Berkeley tse@ees.berkeley.eu
More informationTaste for variety and optimum product diversity in an open economy
Taste for variety and optimum produt diversity in an open eonomy Javier Coto-Martínez City University Paul Levine University of Surrey Otober 0, 005 María D.C. Garía-Alonso University of Kent Abstrat We
More informationH+ Disposal by Rabbit Gastric Mucosal Surface Cells
GASTROENTEROLOGY 1984;86:69875 H+ Disposal by Rabbit Gastri Muosal Surfae Cells EDWARD J. OLENDER, DAVD FROMM, TSUTOMU FURUKAWA, an MCHELE KOLS Department of Surgery. State University of New York, Upstate
More informationIEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY, VOL. 67, NO. 1, JANUARY Jin-Bae Park, Student Member, IEEE, and Kwang Soon Kim
IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY, VOL. 67, NO. 1, JANUARY 2018 633 Loa-Balaning Sheme With Small-Cell Cooperation for Clustere Heterogeneous Cellular Networks Jin-Bae Park, Stuent Member, IEEE,
More informationExam I Answer Key: Summer 2006, Semester C
1. Which of the following tripeptides would migrate most rapidly towards the negative electrode if electrophoresis is carried out at ph 3.0? a. gly-gly-gly b. glu-glu-asp c. lys-glu-lys d. val-asn-lys
More informationEdexcel GCSE Maths Foundation Skills Book Ratio, proportion and rates of change 1
Guidane on the use of odes for this mark sheme ethod mark A C P ao oe ft Auray mark ark awarded independent of method Communiation mark Proof, proess or justifiation mark Corret answer only Or equivalent
More informationIn this problem, we are given the following quantities: We want to find: Equations and basic calculations:
.1 It takes. million tons of oal per year to a 1000-W power plant that operates at a apaity fator of 70%. If the heating value of the oal is 1,000 /lb, alulate the plant s effiieny and the heat rate. In
More information16. Hydrogen Shell Burning
16. Hydrogen Shell Burning a) Chandrasekhar-Shönberg Limit After ignition of H-burning in shell, entral He-ore is inert : T too low for ignition of He ( 17) no nulear energy generation in ore dt/dr ~ 0
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More informationFINITE WORD LENGTH EFFECTS IN DSP
FINITE WORD LENGTH EFFECTS IN DSP PREPARED BY GUIDED BY Snehal Gor Dr. Srianth T. ABSTRACT We now that omputers store numbers not with infinite preision but rather in some approximation that an be paed
More informationPLANNING OF INSPECTION PROGRAM OF FATIGUE-PRONE AIRFRAME
Yu. aramonov, A. Kuznetsov ANING OF INSECTION ROGRAM OF FATIGUE RONE AIRFRAME (Vol. 2008, Deember ANNING OF INSECTION ROGRAM OF FATIGUE-RONE AIRFRAME Yu. aramonov, A. Kuznetsov Aviation Institute, Riga
More informationProblem set 6 for the course Theoretical Optics Sample Solutions
Karlsruher Institut für Tehnologie KIT) Institut für theoretishe Festkörperphysik SS01 Prof. Dr. G. Shön, Dr. R. Frank 15.06.01 http://www.tfp.kit.eu/stuium-lehre.php Tutorial: Group 1, Name: Group, Group
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationThe Computational Complexity of the Unrooted Subtree Prune and Regraft Distance. Technical Report CS
The Computational Complexit of the Unroote ubtree rune an egraft Distane Glenn Hike Frank Dehne Anrew au-chaplin Christian Blouin Tehnial eport C-006-06 Jul, 006 Fault of Computer iene 6050 Universit Ave.,
More information(c) Sketch the exit age distribution functions Et and Ea. To make the mathematics bearable only simple idealized curves are shown.
Chapter 61 Problems Al The following graphs show the traer output from a vessel for a partiular traer input. For eah ase (a) Show, if possible, whether the material balane is satisfied. (b) Find the quantities
More information1. A dependent variable is also known as a(n). a. explanatory variable b. control variable c. predictor variable d. response variable ANSWER:
1. A epenent variale is also known as a(n). a. explanatory variale. ontrol variale. preitor variale. response variale FEEDBACK: A epenent variale is known as a response variale. Definition of the Simple
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationThe Concept of Mass as Interfering Photons, and the Originating Mechanism of Gravitation D.T. Froedge
The Conept of Mass as Interfering Photons, and the Originating Mehanism of Gravitation D.T. Froedge V04 Formerly Auburn University Phys-dtfroedge@glasgow-ky.om Abstrat For most purposes in physis the onept
More information23.1 Tuning controllers, in the large view Quoting from Section 16.7:
Lesson 23. Tuning a real ontroller - modeling, proess identifiation, fine tuning 23.0 Context We have learned to view proesses as dynami systems, taking are to identify their input, intermediate, and output
More informationChapter 15: Chemical Equilibrium
Chapter 5: Chemial Equilibrium ahoot!. At eq, the rate of the forward reation is the rate of the reverse reation. equal to, slower than, faster than, the reverse of. Selet the statement that BEST desribes
More informationH=250 Oe. Supplementary Figure 1 Magnetic domains: Room temperature 4 x 4 µm 2 MFM phase
1 Supplementary Information Supplementary Figures (b) () 1.6± 1 µm 1 µm 1 µm H290 Oe (d) (e) (f) H410 Oe -1.5± 1 µm 1 µm H250 Oe 1 µm H590 Oe Supplementary Figure 1 Magneti domains: Room temperature 4
More informationThe influence of upstream weir slope on live-bed scour at submerged weir
The influene of upstream weir slope on live-be sour at submerge weir L. Wang, B.W. Melville & H. Frierih Department of Civil an Environmental Engineering, University of Auklan, New Zealan ABSTRACT: Shape
More informationModeling of Threading Dislocation Density Reduction in Heteroepitaxial Layers
A. E. Romanov et al.: Threading Disloation Density Redution in Layers (II) 33 phys. stat. sol. (b) 99, 33 (997) Subjet lassifiation: 6.72.C; 68.55.Ln; S5.; S5.2; S7.; S7.2 Modeling of Threading Disloation
More information1 Introduction
Publishe in IET Systems Biology eceive on 8th January 2010 evise on 13th July 2010 oi: 10.1049/iet-syb.2010.0010 Special issue on the Thir q-bio Conference on Cellular Information Processing Thermoynamic
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationRelativity fundamentals explained well (I hope) Walter F. Smith, Haverford College
Relativity fundamentals explained well (I hope) Walter F. Smith, Haverford College 3-14-06 1 Propagation of waves through a medium As you ll reall from last semester, when the speed of sound is measured
More informationInter-fibre contacts in random fibrous materials: experimental verification of theoretical dependence on porosity and fibre width
J Mater Si (2006) 41:8377 8381 DOI 10.1007/s10853-006-0889-7 LETTER Inter-fibre ontats in random fibrous materials: experimental verifiation of theoretial dependene on porosity and fibre width W. J. Bathelor
More informationSupplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
More informationNature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
More informationAmino Acid Side Chain Induced Selectivity in the Hydrolysis of Peptides Catalyzed by a Zr(IV)-Substituted Wells-Dawson Type Polyoxometalate
Amino Acid Side Chain Induced Selectivity in the Hydrolysis of Peptides Catalyzed by a Zr(IV)-Substituted Wells-Dawson Type Polyoxometalate Stef Vanhaecht, Gregory Absillis, Tatjana N. Parac-Vogt* Department
More informationHow Busy Are Bees - modelling the pollination of clover
How Busy Are Bees - modelling the pollination of lover Athole Marshall, Terry Mihaelson-Yeates and Ingrid Williams* Geneti markers 19 Where does the pollen effetive in fertilisation ome from? 2 How far
More informationCRITICAL EXPONENTS TAKING INTO ACCOUNT DYNAMIC SCALING FOR ADSORPTION ON SMALL-SIZE ONE-DIMENSIONAL CLUSTERS
Russian Physis Journal, Vol. 48, No. 8, 5 CRITICAL EXPONENTS TAKING INTO ACCOUNT DYNAMIC SCALING FOR ADSORPTION ON SMALL-SIZE ONE-DIMENSIONAL CLUSTERS A. N. Taskin, V. N. Udodov, and A. I. Potekaev UDC
More informationFluorescence Correlation
Theory setions of the leture Studying dynami proesses in ells and model membranes with Fluoresene Correlation Spetrosopy () and FCS-urves LSM (3D projetion) Confoal Laser Sanning Mirosopy presented at
More informationTransition from a simple yield stress fluid to a thixotropic material
Transition from a simple yield stress fluid to a thixotropi material A. Ragouilliaux 1,2, G. Ovarlez 1, N. Shahidzadeh-Bonn 1, Benjamin Herzhaft 2, T. Palermo 2, P. Coussot 1 1 Université Paris-Est, Laboratoire
More informationConstraint-free Analog Placement with Topological Symmetry Structure
Constraint-free Analog Plaement with Topologial Symmetry Struture Qing DONG Department of Information an Meia Sienes University of Kitakyushu Wakamatsu, Kitakyushu, Fukuoka, 808-0135, Japan e-mail: ongqing@env.kitakyu-u.a.jp
More informationMODELS FOR VARIABLE RECRUITMENT (continued)
ODL FOR VARIABL RCRUITNT (ontinue) The other moel ommonly use to relate reruitment strength with the size of the parental spawning population is a moel evelope by Beverton an Holt (957, etion 6), whih
More informationProtein structure. Protein structure. Amino acid residue. Cell communication channel. Bioinformatics Methods
Cell communication channel Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu SEQUENCE STRUCTURE DNA Sequence Protein Sequence Protein Structure Protein structure ATGAAATTTGGAAACTTCCTTCTCACTTATCAGCCACCT...
More informationStructural Integrity of Composite Laminates with Embedded Microsensors
Strutural Integrity of Composite Laminates with Embedded Mirosensors Yi Huang, Sia Nemat-Nasser Department of Mehanial and Aerospae Engineering, Center of Exellene for Advaned Materials, University of
More informationSerine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationReview Topic 4: Cubic polynomials
Review Topi : ui polynomials Short answer Fatorise Px ( ) = x + 5x + x- 9 into linear fators. The polynomial Px ( ) = x - ax + x- leaves a remainer of when it is ivie y ( x - ) an a remainer of - when
More informationSupplementary Figures
Supplementary Figures a Sample A Sample Sample B mm Sample A a Sample B Supplementary Figure : Laue patterns and piture of the single rystals. (a,) Laue patterns of sample A (a) and sample B (). () Piture
More information