3.9-kb subfragment which contains two cob genes. It is. shown that they are implicated in the transformation of

Transcription

1 JOURNAL OF BACTERIOLOGY, Oct. 1991, p Vol. 173, No /91/ $02.00/0 Copyright 1991, American Society for Microbiology Genetic Analysis, Nucleotide Sequence, and Products of Two Pseudomonas denitrificans cob Genes Encoding Nicotinate- Nucleotide:Dimethylbenzimidazole Phosphoribosyltransferase and Cobalamin (5'-Phosphate) Synthase B. CAMERON,1 F. BLANCHE,2 M.-C. ROUYEZ,1t D. BISCH,2 A. FAMECHON,2 M. COUDER,2 L. CAUCHOIS,1 D. THIBAUT,2 L. DEBUSSCHE,2 AND J. CROUZET1* Unite de Biologie Moleculaire, Institut des Biotechnologies,1 and De'partement Analyse,2 Rhone-Poulenc Rorer S.A., Centre de Recherche de Vitry-Alfortville, 13 Quai Jules Guesde B. P. 14, Vitry-sur-Seine Cedex, France Received 11 March 1991/Accepted 24 July 1991 TnS Spr transposons have been inserted into the 8-kb Pseudomonas denitrificans DNA fragment from complementation group D, which carries cob genes. Genetic analysis and the nucleotide sequence revealed that only two cob genes (cobu and cobv) were found on this cob genomic locus. Nicotinate-nucleotide:dimethylbenzimidazole phosphoribosyltransferase (EC ) was assayed and purified to homogeneity from a P. denitrificans strain in which cobu and cobv were amplified. The purified enzyme was identified as the cobu gene product on the basis of identical molecular weights and N-terminal sequences. Cobalamin (5'-phosphate) synthase activity was increased when cobv was amplified in P. denitrificans. The partially purified enzyme catalyzed not only the synthesis of cobalamin 5'-phosphate from GDP-cobinamide and a-ribazole 5'-phosphate but also the one-step synthesis of cobalamin from GDP-cobinamide and a-ribazole. Biochemical data provided evidence that cobv encodes cobalamin (5'-phosphate) synthase. Conversion of cobinamide into cobalamin requires four enzymatic steps in Propionibacterium shermanii (17, 24). First, phosphorylation of the hydroxyl group of the (R)-1- amino-2-propanol residue of cobinamide leads to cobinamide phosphate (reaction A). Second, addition of the GMP moiety of a molecule of GTP onto cobinamide phosphate generates GDP-cobinamide (reaction B). Third, exchange of GMP with a-ribazole 5'-phosphate within GDP-cobinamide yields cobalamin 5'-phosphate (reaction C). Fourth, dephosphorylation of cobalamin 5'-phosphate gives cobalamin (reaction D). These reactions can be written as follows: (A) cobinamide + ATP -* cobinamide phosphate + ADP (B) cobinamide phosphate + GTP -- GDP-cobinamide + PPi (C) GDP-cobinamide + a-ribazole 5'-phosphate -+ cobalamin 5'-phosphate + GMP (D) cobalamin 5'-phosphate -* cobalamin + Pi Reactions C and D are also presented on Fig. 1 (reactions 1 and 4, respectively). Reaction C involves a-ribazole 5'- phosphate, which is synthesized from dimethylbenzimidazole and P-nicotinic acid mononucleotide (Fig. 1, reaction 2). A bifunctional enzyme catalyzing reactions A and B has been purified from Pseudomonas denitrificans and was shown to be encoded by cobp located in complementation group C (5). At least one other gene involved in the conversion of cobinamide into cobalamin was identified by complementation; it is located in complementation group D (8). We report here a genetic analysis of the 8-kb fragment from complementation group D and the nucleotide sequence of a * Corresponding author. t Present address: INSERM U. 152, Hopital Cochin, Paris Cddex 14, France kb subfragment which contains two cob genes. It is shown that they are implicated in the transformation of GDP-cobinamide into cobalamin (Fig. 1). The corresponding enzymes, nicotinate-nucleotide:dimethylbenzimidazole phosphoribosyltransferase (EC ) and cobalamin (5'-phosphate) synthase, have been purified, and their kinetic parameters are reported. MATERIALS AND METHODS Abbreviations. Ado, 5'-deoxy-5'-adenosyl; DBI, dimethylbenzimidazole; a-ribazole, 1-a-D-ribofuranosyl-5,6-dimethylbenzimidazole; HPLC, high-performance liquid chromatography; NaMN, P-nicotinic acid mononucleotide; NN:DBI PRT, nicotinate-nucleotide:dimethylbenzimidazole phosphoribosyltransferase; SDS-PAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; IPTG, isopropyl-p-dthiogalactopyranoside. Bacterial strains and plasmids. Bacterial strains and plasmids used in this study are described in Table 1. Plasmid inserts are presented in Fig. 3. Plasmid pxl1954 was constructed in two steps: first, the 0.9-kb Hinfl fragment from pxl698 was blunt ended and introduced into the pmtl23 SmaI restriction site to generate pxl1939, and then the 0.9-kb insert was excised from pxl1939 at the BamHI and BglII restriction sites and cloned into the pet-3c BamHI site. The fusion between cobv and T7 gene 10 was verified by sequencing at the cloning sites. Media, bacteriological techniques, DNA manipulation, and sequencing. Techniques used in this study are described in the accompanying paper (9). Mutagenesis. Two mutagenesis strategies were used to identify the cob genes on the sequenced DNA fragment. First, random chromosomal TnS Sp' insertions were obtained on SBL27 Rif' (12). Two of the 30 cob::tns Spr

2 VOL. 173, 1991 P. DENITRIFICANS cobu AND cobv GENES 6067 GMP m 0 0 Ew GMP-O)O DP-cobinamideD Ado NaMN + DBI D k, W o» nicotinate DBI-ribose 5' P e DBI-ribose AUU Ain Ir (E0 le 5'P-rib'ose-6BI cobalamin 5-phosphate Pi Pi I - MP E ) : ribose-6bi c cobalamin FIG. 1. Biosynthesis of cobalamin from GDP-cobinamide. The boxlike structure represents the fully amidated corrin ring. Reactions were catalyzed by CobV [cobalamin (5'-phosphate) synthase] (reactions 1 and 1*), CobU (NN:DBI PRT) (reaction 2), a-ribazole 5'-phosphatase (reaction 3), and cobalamin 5'-phosphatase (reaction 4). DBI-ribose, a-ribazole; DBI-ribose 5' P, a-ribazole 5'-phosphate. -I TABLE 1. mutants had their transposon insertions, 1003 and 1147, mapped in the pxl519 insert (see Fig. 3). Second, TnS Spr was inserted into the 9-kb HindIII-EcoRI fragment from pxl519 (cloned into pxl1557) by the procedure described in the accompanying paper (9). Twenty Tn5 Spr insertions were mapped on the HindlIl-EcoRI insert (see Fig. 3). Plasmid pxl1557::tns spr, which contained the transposon on the HindIII-EcoRI insert, was introduced into SC510 Rif' by bacterial mating for double homologous recombination as described elsewhere (9). It was verified by Southern blot analysis that strain SC510 Rif: :TnS Spr contained the transposon insertion at the previously mapped position (see Fig. 3). Chemicals. NaMN and DBI were purchased from Sigma Chemical Co., St. Louis, Mo. Ado-GDP-cobinamide was prepared by incubating 20,umol of Ado-cobinamide (6) in 1 liter of 0.1 M Tris hydrochloride (ph 8.7) containing 1 mm EDTA, 5 mm ATP, 12.5 mm MgCl2, 1 mm GTP, and 114 mg of crude cell extract of strain SC510 Rif(pXL622) for 18 h at 30 C. Cobinamide kinase and cobinamide phosphate guanylyltransferase activities are amplified with this strain (5). It was purified under subdued light by chromatography on an Amberlite XAD-2 column (Serva, Heidelberg, Germany), eluted with a linear gradient of methanol in water (yield, 18.9,umol; 94.5%), and identified by its UV-visible spectrum and its HPLC behavior after conversion to the cyano form (7). diaqua-gdp-cobinamide was prepared from Ado-GDP-cobinamide by aerobic sunlight photolysis (32). a-ribazole 5'- phosphate was prepared enzymatically by the following procedure. A crude cell extract of strain SC510 (approximately 8 g of protein) was incubated at 30 C for 23 h in 1 liter of 0.1 M glycine-sodium hydroxide buffer (ph 9.7) containing 300,uM NaMN, 400,uM DBI, 5 mm ATP, 12.5 mm MgCl2, and 850,uM GTP. The solution was heated to 80 C for 20 min, and after centrifugation (10,000 x g for 15 min), Bacterial strains and plasmids used Bacterial strain Markers and Relevant properties Reference or plasmid replicons or source E. coli BL21(DE3) hsds gal(xcits857 Sam7 nin5 indl lacuv5-t7 gene 1) 31 P. denitrificans SC510 Rifr Rif isolate (100 jig/ml) of SC510 6 SBL27 Rif Rift isolate (100 jig/ml) of SBL27; SC510 derives 6 from SBL27 by numerous mutageneses Plasmids pet-3c Ampr ColEl Carries T7 (10 promoter 27 pkt230 Kmr RSF1010 Carries Mob locus of RSF plyss Cmr pacyc184 Contains T7 lysozyme gene 10 prk290 Tetr RK2 Carries Mob locus of RK2 15 pxl435 KmrRSF1010 Carries Mob locus of RSF pxl519 Kmr RSF kb P. denitrificans Sau3AI fragment cloned into 8 BamHI site of pxl59 pxl698 Kmr RSF kb BglII fragment from pxl519 cloned into 8 BamHI site of pxl435 pxl1286 Kmr RSF kb BglII-EcoRI insert of pxl519 cloned into This study BamHI-EcoRI sites of pkt230 pxl1303 Kmr RSF kb SstI insert of pxl519 cloned into SstI site of This study pkt230 pxl1324 Kmr RSF kb SstI-EcoRI insert of pxl519 cloned into SstI- This study EcoRI sites of pkt230 pxl1490 Kmr RSF kb SstI-BamHI insert of pxl519 cloned into SstI- This study BamHI sites of pkt230 pxl1557 Tetr RK2 9-kb HindIII-EcoRI insert of pxl519 cloned into This study EcoRI site of prk290

3 6068 CAMERON ET AL. J. BACTERIOL. GAGCTCATAGAGCAGTTCCTCGATCGACTTCAGCAGTCGCATGAAATCCATGCCGTGCTCCCCTTGCTTCTATGCGTGGCACGACCGCGCGCCGGGGCCG * DR LR L E DTR MOQLM EL T SLF SM G LL S QD LK G K A AV T AG I N R R T IP G I S I E Q L M V P A A QOAR G N AT M V T VI F NL NA P DL GI K EA DE YT LAI N SAG TDV L M TARGP GD L T ALLRNGFFHG ENLMKQLEFR VYASVLALVVFL D I G FQ DN AL GM TR G TD H NI I LL ILG IA L I SL L IA L <- ORFi * V T L A L A G L V A I E T L Q Q T AG I T D G TOQG G I1K R MA L R A F G K V T A L F A V E P EG A S A A VG S S R AP P L S S W H W V MA A R S L C A A G L I A MAA G LP S F LP L I SA FA SV R LGF S LI L AV AA Y T GI R S D KMI ALA A ER DRG GG FG DA T DG LG DE H L A G T V LAOQ I A V V V F A A F L S S V Q L AM L A MA V AA S P L A IAL GA FP FA RV AR SL RG D YG EF H RA P MP I R SL V A AL R AL R AP AG AL A AC V KGL GK M <- orf2 S AS GL PF D DFR EL L R NLP GP DA AA LV AA RE R DA F3 -> QOL TKP PG AL GR L EE IA F WLA A WTG KA PV V NRP L V A I F A G N M G V T R Q G V T P F P SS V TAOQ M V E N F A A G G CGTCACACGTTCTACAGCCCGCGAGCTGCTGATGAACCCGCVCGDLGLTATCACCGAGGAAGCCGCG L SE RD C AA TM AF GM EA IA GG T DL LC I GE M GI G N OR FIG. 2. Nucleotide sequence of the 3.9-kb fragment from complementation group D (8). The beginning of each open reading frame is indicated along with the predicted amino acid sequence of the gene. Amino acids corresponding to the ORF2 potential initiation codons are in bold letters. ot-ribazole 5'-phosphate was extracted from the supernatant by preparative ion-exchange chromatography on DEAE- Sephadex A-25 (Pharmacia) followed by Amberlite XAD-2 chromatography. It was finally purified by HPLC as described below and desalted with a Sep-Pack C-18 cartridge (Waters). It was identified by fast atom bombardment-mass spectrometry and UV-visible spectroscopy (18, 19). oa-ribazole was isolated from cultures of strain SC510 Rif' by chromatography on Amberlite XAD-2 and obtained in the pure state by HPLC. It was identified by fast atom bombard-

4 VOL. 173, 1991 P. DENITRIFICANS cobu AND cobv GENES 6069 GATCGCCGCGGTCGAAAAGGCCGTGGCGCTGCATCGCGATCACCTGTCCGATCCGCTCGAACTGATGCGTCGCCTCGGCGGTCGTGAGATCGCGGCCATG I A A V E K A V A L H R D H L S D P L E L M R R L G G R E I A A M GCTGGCGCCATCCTGGCCGCCCGCGTCCAGAAGGTACCTGTCATCATCGACGGCTACGTGGCGACCGCTGCGGCTTCGATCCTGAAGGCGGCCAACCCGT A G A I L A A R V Q K V P V I I D G Y V A T A A A S I L K A A N P CGGCCCTCGACCATTGCCTGATCGGCCATGTTTCGGGCGAACCGGGGCATCTGCGCGCGATCGAGAAGCTCGGCAAGACGCCGCTGCTGGCACTCGGCAT S A L D H C L I G H V S G E P G H L R A I E K L G K T P L L A L G M GCGGCTTGGCGAAGGCACGGGCGCGGCCCTTGCCGCCGGTATCGTCAAGGCGGCGGCCGCTTGCCACAGCGGCATGGCGACCTTTGCCCAGGCCGGCGTC R L G E G T G A A L A A G I V K A A A A C H S G M A T F A Q A G V AGCAACAAGGAATAGTGAAGTTCCGGCCGGGC SNGQEGAAGGCCGGCCGGTTTCTGTCCAAGGCCTGTCACGGGCGCGAAGCTGTCGCGTGCCGGGCC S N K E* TTGATGGATGCGTCCTTCTCGCCTATCCAAAGCGCAAATGCGCGCCCTAGCTATAGTCTTGGGTGCCTGCAACCGAGACCGCCTTGCATTCGCCTCAATC M D A K N T T H R I G Q T G P V E K Q ORF4 -> ACCGGCATTCGGCATCTCTTTGCCGCTGCGAGCTATTCGCTCGGCGGCGCCAAGCGGCTGATCGGCGAGGCTGCCTTTCGCCACGAGCTGATCGCCTTTG T G I R H L F A A A S Y S L G G A K R L I G E A A F R H E L I A F CCGCCGCGATGATCGCTTTCATCATCGTCGGCGCAACCTTCTTCCAATATGTGGCGATGGCGATCCTGTTCCTGCTGATGATGGCCTTCGAGGCGATCAA A A A M I A F I I V G A T F F Q Y V A M A I L F L L M M A F E A I N CACGGCAATCGAGGAAATTGTCGATCGCGTTCTCCCGAAATCTCGGAAATGGGTAAGAACGCCAAGGATCTCGGCTCCTTCGCCTGCCTCTGCCTGATT T A I E E I V D R V S P E I S E M G K N A K D L G S F A C L C L I GTCGCCAACGGTGTCTATGCCGCCTATGTCGTGATCTTCGACGGCTTCATGAACTGACCGGCTAGCGGGCCGGCGCCTTCACCCGATAAAGCACATGCGG V A N G V Y A A Y V V I F D G F MN * ACGCAGCGGGTTGCCCCCGGGTACCGTGACGTCGTCGAAATCATCAGCCGGATCC FIG. 2-Continued. ment-mass spectrometry and 'H nuclear magnetic resonance spectroscopy. Biochemical methods. a-ribazole 5'-phosphate and a-ribazole were purified and assayed by HPLC on a Nucleosil C-8 5-,um column (4.6 by 150 mm; Macherey-Nagel, Duren, Germany) eluted with 0.1 M potassium phosphate (ph 2.9)-acetonitrile (93:7) at a flow rate of 1 ml- min-'. They were detected and quantitated with a Kratos Spectroflow 980 fluorescence detector set at 260 nm for excitation and with an emission cutoff at 370 nm. Analytical and biochemical methods included published procedures (6, 13). Native PAGE of cobalamin (5'-phosphate) synthase was performed with 8-25 PhastGel gradient gels and a PhastSystem instrument (Pharmacia). After migration, the gel was sliced in 10 pieces perpendicularly to the migration direction. Each slice was dispersed in incubation buffer and assayed for cobalamin (5'-phosphate) synthase activity. Kinetic parameters for NN:DBI PRT and cobalamin (5'-phosphate) synthase were calculated from the intercept and slope replots of the primary Lineweaver-Burk plots versus the reciprocal of the fixed substrate concentrations. MgCl2 concentration was kept constant at 12.5 mm throughout the study of cobalamin (5'-phosphate) synthase. The appropriate equations were fitted to weighted experimental data with the computer program Enzfitter (6). Assay of NN:DBI PRT (EC ). A sample of enzyme source (5 to 10 U) was incubated at 30 C for 8 min in 0.1 M glycine-sodium hydroxide buffer (ph 9.7) containing 1 mm NaMN and 10,uM DBI in a total volume of 500,uJ. The solution was heated to 80 C for 10 min to stop the reaction, 4 volumes of water were added, and the mixture was centrifuged at 5,000 x g for 5 min. ot-ribazole 5'-phosphate present in the supematant was quantitated by HPLC. Assay of cobalamin (5'-phosphate) synthase. A sample of enzyme source (5 to 10 U) was incubated in the dark at 30 C in 0.3 M Tris hydrochloride (ph 9.0) containing 1 mm EDTA, 12.5 mm MgCl2, 50,uM ot-ribazole 5'-phosphate, and 20,uM Ado-GDP-cobinamide in a total volume of 500 Rl. After 15 min of incubation, 500,l of 20 mm potassium cyanide was added, and the solution was heated to 80 C for 10 min and then centrifuged (5,000 x g for 10 min) to remove precipitated material. Cyanocobalamin 5'-phosphate was assayed by HPLC with the system II described elsewhere (7). One unit of NN:DBI PRT [cobalamin (5'-phosphate) synthase] activity was defined as the amount of enzyme necessary to form 1 nmol of ot-ribazole 5'-phosphate [cobalamin (5'-phosphate)] per h in the conditions described above. Purification of NN:DBI PRT. (i) Step 1: preparation of a crude cell extract. Frozen cell paste [10 g (wet weight) of SC510 Rifr(pXL1490)] was thawed and suspended in 25 ml of 0.1 M Tris hydrochloride (ph 7.2). Cells were broken at 4 C by ultrasonic treatment, and cell debris was separated by centrifugation at 50,000 x g for 1 h. The supernatant was passed through a column of DEAE-Trysacryl M (500 pal of swollen gel) previously equilibrated with 0.1 M Tris hydrochloride (ph 7.2). (ii) Step 2: first anion-exchange fast protein liquid chromatography. A sample of the clear eluate (120 mg of proteins) was applied to a Mono Q HR 10/10 column (Pharmacia) equilibrated with 30 mm Tris hydrochloride (ph 7.2)-0.12 M potassium chloride. Proteins were eluted with a linear gradient of to 0.60 M potassium chloride in Tris hydrochloride. Fractions containing NN:DBI PRT activity were pooled and concentrated to 2 ml with a Centriprep 10 concentrator (Amicon). (iii) Step 3: second anion-exchange fast protein liquid chromatography. The concentrate was mixed with 1 volume of 30 mm Tris hydrochloride (ph 7.6; buffer A) and loaded on a Mono Q HR 5/5 (Pharmacia) column equilibrated with buffer A-0.1 M potassium chloride. Proteins were eluted with a linear gradient of 0.1 to 0.5 M potassium chloride in buffer A. After concentration to 1 ml, the active fraction was mixed with 1 volume of 0.1 M Tris hydrochloride (ph 7.6)-2 M ammonium sulfate. (iv) Step 4: hydrophobic interaction chromatography. The solution was applied to a Phenyl-Superose HR 5/5 column (Pharmacia) equilibrated with buffer A-1.0 M ammonium

5 6070 CAMERON ET AL. sulfate. Elution of proteins was achieved with a linear decreasing gradient of 1.0 to 0 M ammonium sulfate. Fractions containing NN:DBI PRT activity were pooled and concentrated to 500,ul. (v) Step 5: gel permeation chromatography. To remove a minor contaminant protein of high molecular weight, final purification was performed on a Bio-Sil SEC 250 column (7.5 by 300 mm; Bio-Rad) eluted at 0.5 ml min-' with 20 mm sodium phosphate-50 mm sodium sulfate (ph 6.8). Partial purification of cobalamin (5'-phosphate) synthase. (i) Step 1: preparation of a crude cell extract. Frozen cell paste [10 g (wet weight) of SC510 Rif(pXL1490)] was thawed and suspended in 25 ml of 0.1 M Tris hydrochloride (ph 8.3)-i mm EDTA (buffer A). Cells were broken at 4 C by ultrasonic treatment, and cell debris was separated by centrifugation at 50,000 x g for 1 h. The supernatant was passed through a column of Sephadex G-25 equilibrated with buffer A, and the protein fraction was collected. (ii) Step 2: gel permeation chromatography. A sample of the protein fraction (300 RI1; 7.5 mg of protein) was chromatographed on a Superose 12 HR 10/30 column (Pharmacia) eluted at 0.4 ml. min-1 with buffer A. Cobalamin (5'-phosphate) synthase activity was recovered in the void volume. This chromatographic step was done 10 times, and the 10 active fractions were pooled and concentrated to 4 ml with a Centriprep 10 concentrator. (iii) Step 3: hydrophobic interaction chromatography. After the addition of 1 volume of buffer A-1.0 M ammonium sulfate, the solution was loaded on a Phenyl-Superose HR 5/5 column at 0.5 ml. min-1 and proteins were eluted with a linear decreasing gradient of ammonium sulfate from 0.5 to 0 M in buffer A followed by a plateau of 0 M ammonium sulfate to elute the enzyme. Fractions containing cobalamin (5'-phosphate) synthase activity were pooled and stored at -20 C until use. Exclusive labeling of plasmid proteins by using a T7 RNA polymerase-promoter system. Escherichia coli BL21(DE3) plyss cells transformed with either pxl1954 or pet-3c were grown at 37 C in 30 ml of M9 medium supplemented with ampicillin and chloramphenicol. At an A590 of 0.5, 0.4 mm IPTG was added, and the cells were then incubated for 30 min at 37 C. Rifampin (200 pig- ml-') was then introduced, and 30 min later, 25 puci of [35S]methionine (1,000 Ci. mmol-1; Amersham France S.A.) was added. After 10 minutes, the cells were centrifuged and suspended in sample buffer for SDS-PAGE. Nucleotide sequence accession number. The sequence reported here has been assigned GenBank accession number M RESULTS DNA sequence of the 3.9-kb fragment from complementation group D. A 3.9-kb SstI-SstI-BamHI fragment from TABLE 2. Open reading frames of the 3.9-kb fragment from complementation group D Open reading Position of: Mol wt of frame. encoded First codon Last codon polypeptide , , , ,802 J. BACTERIOL. pxl519 was sequenced on both strands. It was chosen because it contained the BglII subfragment which carried at least one cob gene involved in the transformation of cobinamide into cobalamin (8). The nucleotide sequence shown in Fig. 2 was analyzed by the program of Staden and McLachlan (29, 30) by using codon preference to identify the coding sequences (12). By this method, four open reading frames were identified. Two of them, ORF3 and ORF4, were on the same strand (Table 2) (going 5'-*3' from the SstI to the BamHI site), while ORF1 and ORF2 were on the other strand. ORF2 started at the AUG at position 1971, but other putative initiation codons are present downstream on the sequence. ORF2 and ORF3 were separated by an intergenic region of 127 bp. The mean G+C content of this 3.9-kb fragment was 64.6%, which is similar to that of already sequenced P. denitrificans DNA (11). Genetic analysis of the 9-kb HindIH-EcoRI fragment. A genetic analysis was performed on the 9-kb HindIII-EcoRI insert from pxl519 to determine if the four open reading frames were cob genes and if other cob genes were present on this fragment. Twenty Tn5 Spr insertions were mapped on the 9-kb HindIll-EcoRI fragment cloned into pxl1557 (Fig. 3). These insertions were introduced into the SC510 Rif' chromosome by double homologous recombination to generate SC510 Rif::Tn5 Spr mutants. The phenotype was Cob- for only two mutants (insertions 1 and 23). When Tn5 Spr was used for carrying out transposon mutagenesis into P. denitrificans SBL27 Rif, two of the Cob mutants obtained (insertions 1003 and 1147) were mapped next to the other two insertions, leading to a Cob- phenotype. Plasmid pxl698, pxl1303, or pxl1324 was introduced by bacterial mating into SC510 Rif::Tn5 Spr 1 or SBL27 Rifr::TnS Spr 1003; complementation of the Cob- phenotype was observed with pxl698 only. Plasmid pxl698, pxl1286, or pxl1324 was introduced into SC510 Rif::Tn5 Spr 23 or SBL27 Rif::TnS Spr 1147, and complementation was observed with pxl1324 only. Tn5 Spr insertions 1 and 1003 were mapped in ORF2, whereas insertions 23 and 1147 were mapped in ORF3. It was concluded that both ORFs were cob genes; ORF2 was named cobv, and ORF3 was named cobu. ORF1 and ORF4 were found not to be cob genes because the TnS Spr mutants, which have the insertions mapped within these open reading frames, were Cob'. The proteins encoded by ORF1, ORF4, cobu, and cobv (named CobU and CobV) were analyzed with the Hopp and Woods program for hydrophilicity (22). The plots for cobv-, ORFl-, and ORF4-encoded polypeptides were typical of a hydrophobic protein or a cytoplasmic protein with hydrophobic domains. A search for homologous proteins in the GenBank data base by using Kanehisa's program did not reveal any significant identity with the cobu- or ORFl-encoded polypeptide (23). The best match for CobV was between the first 100 residues and the carboxy-terminal sequence of BtuC (27.7% match) (20). BtuC was proposed to belong to a cytoplasmic membrane transport system involved in the uptake of vitamin B12 in E. coli (14). The homology might reveal a protein domain responsible for cobalamin affinity. Identities were observed between ORF4-encoded protein and the E. coli diglyceride kinase (33.1% match on the entire 122-residue polypeptide) (25). On the basis of sequence homology, it is proposed that ORF4 encodes a diglyceride kinase activity. cobu is the structural gene encoding NN:DMBI PRT. Strain

6 VOL. 173,) 1991 P. DENITRIFICANS cobu AND cobv GENES t B Cob phenotype u F. I j a r+--+1 pxl pxl698 pxl I 324 pxl pxl1490 ORFI cobv ORF2 cobu ORF3 ORF4 1 kb FIG. 3. Genetic analysis of the 3.9-kb fragment from complementation group D. Chromosomal TnS Spr insertions in strains SC510 Rif' (boxes) and SBL27 Rif' (arrows) are presented. The sign under the insertion indicates the Cob phenotype (+ or -) of the corresponding mutant. Plasmid inserts studied for complementation or protein expression are shown. Signs above each insert indicate that the plasmid does (+) or does not (-) complement the Cob mutant. The position of each open reading frame is indicated. B, BamHI; Bg, BglII; C, ClaI; E, EcoRI; H, Hindlll; S, SstI; X, XhoI. SC510 Rif(pXL1490) was shown to exhibit a 25-fold increase of NN:DBI PRT activity over that of the parent strain. The enzyme was purified 15-fold to homogeneity from cell extracts of SC510 Rif(pXL1490) with a 24% yield (Table 3). The enzyme had molecular weights of 35,000 by SDS- PAGE and 71,000 by gel filtration, suggesting that the active enzyme is a homodimer. A steady-state kinetic analysis of NN:DBI PRT gave Kms of p.m for NaMN and nm for DBI. The purified enzyme had a specific activity of 40 ku * mg-1. It showed a typical protein spectrum with an absorption maximum at 281 nm and no absorbance in the visible region. The measured molar extinction coefficient in 30 mm Tris hydrochloride buffer (ph 7.6) at 281 nm was 2.4 x 104 M-1. c-1. The sequence of the first 15 amino acids at the N terminus of the enzyme was identical with the N-terminal sequence predicted from the cobu gene product except for the aminoterminal methionine. The estimated molecular weight of the denatured protein agreed with the molecular weight predicted for CobU (34,640). These data indicate that cobu encodes NN:DBI PRT. Amplification and partial purification of cobalamin (5'- phosphate) synthase. An assay of cobalamin (5'-phosphate) activity was set up with Ado-GDP-cobinamide and a-ribazole 5'-phosphate as substrates. Mg2+ was essential for activity. This activity was found entirely in the soluble fraction of crude cell extracts of P. denitrificans (50,000 x g for 1 h). SC510 Rifr(pXL1490) and SC510 Rif(pXL698) were shown to exhibit a 90-fold increase of this activity over that of the parent strain. Attempts at chromatographing this activity indicated rapidly that the enzyme was tightly associated with a high-molecular-weight fraction. This activity was excluded from size exclusion chromatographic gels such as Superose 6 HR 10/30 or Bio-Sil SEC 250, indicating an Mr of >106. The enzyme was purified 55-fold from SC510 Rift(pXL1490) by a two-column procedure (Table 4). Further purification steps resulted in poor recovery and no increase in specific activity. Addition of dissociation agents in buffers did not dissociate the 55-fold-enriched cobalamin (5'-phosphate) synthase activity from the high-molecularweight complex, since this activity was quantitatively recovered at the void volume of size exclusion chromatographic gels. When the partially purified enzyme was analyzed by native PAGE, cobalamin (5'-phosphate) synthase activity was found at the boundary between the stacking and migration gels. The most-purified fraction showed six main bands of Mrs 26,000, 30,000, 40,000, 63,000, 80,000, and 100,000 of approximately equal intensity by SDS-PAGE analysis. Therefore, cobalamin (5'-phosphate) synthase appears to be tightly bound to a large complex of associated proteins which are separated under denaturing conditions. The partially purified enzyme showed Kms for ot-ribazole 5'-phosphate and Ado-GDP-cobinamide of 2.7 and 0.9,uM, respectively. The enzyme was not specific for the coenzyme form of GDP-cobinamide and could use monocyano- or diaqua- GDP-cobinamide equally well. Cobalamin (5'-phosphate) synthase also used a-ribazole as a substrate with a Km of 7.8 TABLE 3. Purification of NN:DBI PRT from P. denitrificans Purification Vol Amt of Sp act Recovery Purification step (ml) 1rtin ( f (mg) protein-' (%) (fold) Crude extract ,650 Mono Q 10/ , Mono Q 5/ , Phenyl-Superose , Bio-Sil SEC , TABLE 4. Partial purification of cobalamin (5'-phosphate) synthase from P. denitrificans Purification Vol Amt of Sp act Recovery Purification step (ml) protein (U -mg of (mg) protein-1) (% (fold) Crude extract Superose 12 HR , Phenyl-Superose ,

7 6072 CAMERON ET AL FIG. 4. Expression of the fused CobV protein. Samples for SDS-PAGE were prepared from E. coli BL21(DE3)pLysS harboring pxl1954 or pet-3c as described in the text. After electrophoresis, the 10% polyacrylamide gel was treated with sodium salicylate, dried under vacuum, and exposed to Kodak X-Omat film at room temperature. Lanes: 1, pxl1954; 2, pet-3c. Induction was with (+) or without (-) IPTG. The sizes of the molecular weight standards (in thousands) are on the left.,um and a relative maximum velocity of about 50% of that of the control with oa-ribazole 5'-phosphate. When the nucleoside was the substrate, the reaction product was indeed coenzyme B12. Expression and activity of truncated CobV protein in E. coli. A gene fusion between the 5'-truncated cobv, missing the first 20 codons, and the first codons of T7 gene 10 was constructed in plasmid pxl1954 by using the expression vector pet-3c. This plasmid and pet-3c were introduced into E. coli BL21(DE3)pLysS. The bacteriophage T7 expression system allowed the production of a protein which was visualized by SDS-PAGE analysis in the presence of pxl1954 only (Fig. 4). This protein had a molecular weight of 28,000, which was in agreement with the molecular weight predicted for the fused protein (31,000). Crude cell extracts were also assayed for cobalamin (5'-phosphate) synthase activity. This activity was nmol h-1 mg-' with pxl1954 in the presence of IPTG (20 times less in the absence of IPTG) and nmolh-1 mg-' with pet-3c. This activity was entirely found in the high-molecular-weight fraction. Therefore, cobalamin (5'-phosphate) synthase was amplified in E. coli by a factor of 200 when a truncated cobv gene was expressed. DISCUSSION P. denitrificans cob genes cobu and cobv were the only cob genes identified in complementation group D (8). These two genes are involved in the last step of the cobalamin pathway and are divergently transcribed. None of the other cob genes identified so far present this arrangement, although such an organization is common and is found for genes implicated in the same biosynthetic pathway (3). This arrangemenit might allow the transcription and regulation of expression of the two cob genes from a single control region. cobu is the gene coding for NN:DBI PRT (Fig. 1, reaction 2). This enzyme has been partially purified from P. shermanii (16), Clostridium sticklandii (21), and Propionibacterium arabinosum (28). This report describes the first purification of NN:DBI PRT to homogeneity. Cobalamin (5'-phosphate) synthase activity is increased by a factor of 90 when cobv is amplified in P. denitrificans. This activity is also significantly amplified when a fused gene 2 J. BACTERIOL. containing the cobv 3' end is expressed in a heterologous host (E. coli). These data argue for cobv being the cobalamin (5'-phosphate) synthase structural gene. The Cob proteins were analyzed on the basis of the corresponding gene sequences, and CobV was found to be the only hydrophobic protein. This hydrophobic character might be related to the tight binding of CobV to a large protein complex and could explain the difficulties encountered during enzyme purification. E. coli ribosomal protein L18 has been reported to be essential for cobalamin synthesis from Ado-GDP-cobinamide, NAD, and DBI by cytosol fractions of E. coli (26). However, a precise role for protein L18 in cobalamin synthesis has not been assigned. Comparison of the E. coli ribosomal protein L18 with CobV did not reveal any significant sequence identity. The present study indicates that CobV is associated with a large complex of proteins but is not a ribosomal protein by itself. A cobalamin (5'-phosphate) synthase activity acting on GDP-cobinamide and oa-ribazole 5'-phosphate to generate cobalamin 5'-phosphate was partially purified. Interestingly, the enzyme transferred cobinamide phosphate equally well to the nucleoside a-ribazole to make cobalamin (Fig. 1, reaction 1*). In addition, the nucleoside is intracellularly more abundant than the 5' nucleotide in P. denitrificans cobalamin-producing cells, with concentrations of 700 and 30,uM, respectively. The presence of a-ribazole is explained by an endogenous 5'-phosphatase (Fig. 1, reaction 3), which was detected in P. denitrificans (4) and has also been demonstrated in P. shermanii (19). Thierefore, the main route to cobalamin appears to be a single-step reaction of GDPcobinamide with ot-ribazole in P. denitrificans (Fig. 1). This route has already been suggested for Nocardia rugosa (2). However, the enzyme from P. denitrificans carries both cobalamin 5'-phosphate synthase and cobalamin synthase activities (Fig. 1, reactions 1 and 1*) and has been termed cobalamin (5'-phosphate) synthase throughout this report. ACKNOWLEDGMENTS We express our gratitude to J. Lunel and J.-F. Mayaux for their support during this work. We thank the CITI2 (Centre de Traitement Interuniversitaire d'informatique a Orientation Biomedicale, Paris, France) for nucleic and protein sequence analysis programs. We also thank D. Faucher for protein sequencing and M. Vuilhorgne and B. Monegier for obtaining nuclear magnetic resonance and mass spectra. REFERENCES 1. Bagdasarian, M., R. Lurz, B. Ruckert, F. C. Franklin, M. M. Bagdasarian, J. Frey, and K. Timmis Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host vector system for gene cloning in Pseudomonas. Gene 16: Barbieri, P., G. Boretti, A. Di Marco, A. Migliacci, and C. Spalla Further observations on the biosynthesis of vitamin B12 in Nocardia rugosa. Biochim. Biophys. Acta 57: Beck, C., and R. Warren Divergent promoters, a common form of gene organization. Microbiol. Rev. 52: Blanche, F. Unpublished results. 5. Blanche, F., L. Debussche, A. Famechon, D. Thibaut, B. Cameron, and J. Crouzet A bifunctional protein from Pseudomonas denitrificans carries cobinamide kinase and cobinamide phosphate guanylyltransferase activities. J. Bacteriol. 173: Blanche, F., L. Debussche, D. Thibaut, J. Crouzet, and B. Cameron Purification and characterization of S-adenosyl- L-methionine:uroporphyrinogen III methyltransferase from Pseudomonas denitrificans. J. Bacteriol. 171:

8 VOL. 173, Blanche, F., D. Thibaut, M. Couder, and J.-C. Muller Identification and quantitation of corrinoid precursors of cobalamin from Pseudomonas denitrificans by high-performance liquid chromatography. Anal. Biochem. 189: Cameron, B., K. Briggs, S. Pridmore, G. Brefort, and J. Crouzet Cloning and analysis of genes involved in coenzyme B12 biosynthesis in Pseudomonas denitrificans. J. Bacteriol. 171: Cameron, B., C. Guilhot, F. Blanche, L. Cauchois, M.-C. Rouyez, S. Rigault, S. Levy-Schil, and J. Crouzet Genetic and sequence analysis of a Pseudomonas denitrificans DNA fragment containing two cob genes. J. Bacteriol. 173: Chang, A. C., and S. N. Cohen Construction and characterization of amplifiable multicopy DNA cloning vehicle derived from the P15A cryptic miniplasmid. J. Bacteriol. 134: Crouzet, J., B. Cameron, L. Cauchois, S. Rigault, M.-C. Rouyez, F. Blanche, D. Thibaut, and L. Debussche Genetic and sequence analysis of an 8.7-kb Pseudomonas denitrificans fragment carrying eight genes involved in the transformation of precorrin-2 into cobyrinic acid. J. Bacteriol. 172: Crouzet, J., L. Cauchois, F. Blanche, L. Debussche, D. Thibaut, M.-C. Rouyez, S. Rigault, J.-F. Mayaux, and B. Cameron Nucleotide sequence of a Pseudomonas denitrificans 5.4-kb DNA fragment containing five cob genes and identification of structural genes encoding S-adenosyl-L-methionine:uroporphyrinogen III methyltransferase and cobyrinic acid a,c-diamide synthase. J. Bacteriol. 172: Debussche, L., D. Thibaut, B. Cameron, J. Crouzet, and F. Blanche Purification and characterization of cobyrinic acid a,c-diamide synthase from Pseudomonas denitrificans. J. Bacteriol. 172: DeVeaux, L., D. Clevenson, C. Bradbeer, and R. Kadner Identification of the BtuCED polypeptides and evidence for their role in vitamin B12 transport in Escherichia coli. J. Bacteriol. 167: Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77: Friedmann, H. C Partial purification and properties of a single displacement trans-n-glycosidase. J. Biol. Chem. 240: Friedmann, H. C Biosynthesis of corrinoids, p In B. M. Babior (ed.), Cobalamin. John Wiley & Sons, Inc., New York. 18. Friedmann, H. C., and D. L. Harris Benzimidazole P. DENITRIFICANS cobu AND cobv GENES 6073 riboside, a possible precursor of vitamin B12 in Propionibacterium shermanii. Biochem. Biophys. Res. Commun. 8: Friedmann, H. C., and D. L. Harris The formation of a-glycosidic 5'-nucleotides by a single displacement trans-nglycosidase. J. Biol. Chem. 240: Friedrich, M., L. DeVeaux, and R. Kadner Nucleotide sequence of the btuced genes involved in vitamin B12 transport in Escherichia coli and homology with components of periplasmic-binding-protein-dependent transport systems. J. Bacteriol. 167: Fyfe, J. A., and H. C. Friedmann Vitamin B12 biosynthesis. Enzyme studies on the formation of the ax-glycosidic nucleotide precursor. J. Biol. Chem. 244: Hopp, T. P., and K. R. Woods Prediction of protein antigenic determinants from amino acids sequences. Proc. Natl. Acad. Sci. USA 78: Kanehisa, M Use of statistical criteria for screening potential homologies in nucleic acids sequences. Nucleic Acids Res. 12: Leeper, F. J The biosynthesis of porphyrins, chlorophylls and vitamin B12. Nat. Prod. Rep. 6: Lightner, V., R. Bell, and P. Modrich The DNA sequences encoding pisb and dgk loci of Escherichia coli. J. Biol. Chem. 258: Pezacka, E., and W. Walerych Biosynthesis of vitamin B12. Part I. Role of the ribosomal proteins in vitamin B-12 biosynthesis. Biochim. Biophys. Acta 678: Rosenberg, A., B. Lade, D. Chui, S. Lin, J. Dunn, and F. Studier Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 6: Schneider, Z Biosynthesis of vitamin B12, p In Z. Schneider and A. Stroinski (ed.), Comprehensive B12. Walter de Gruyter, Berlin. 29. Staden, R Measurements of the effects that coding for a protein has on a DNA sequence and their use for finding genes. Nucleic Acids Res. 12: Staden, R., and A. D. McLachlan Codon preference and its use in identifying protein coding regions in long DNA sequences. Nucleic Acids Res. 10: Studier, F., and B. Moffatt Use of bacteriophage to direct selective high-level expression of cloned genes. J. Mol. Biol. 189: Weissbach, H., J. Ladd, B. Volcani, R. Smyth, and H. Barker Structure of the adenylcobamide coenzyme: degradation by cyanide, acid and light. J. Biol. Chem. 235: