Phylogenetic Analysis of Anabaena spp. (Cyanobacteria) Using Sequences of 16S rrna Gene.

Transcription

1 Australian Journal of Basic and Applied Sciences, 3(4): , 2009 ISSN Phylogenetic Analysis of Anabaena spp. (Cyanobacteria) Using Sequences of 16S rrna Gene. Anbalagan Ezhilarasi and Narayanaswamy Anand Centre for Advanced Studies in Botany, University of Madras, Guindy Campus, Chennai , India. Abstract: Molecular taxonomic studies were conducted in 8 isolates of freshwater filamentous heterocystous Anabaena spp. Those were morphologically discriminated two groups, each containing five Anabaena species based on the proximity of the akinetes to heterocyst, adjacent to or away from the spore in the trichome. Genetic diversity among strains tested was determined with the sequences were compared with those of representative heterocystous cyanobacteria (Anabaena) available in GenBank. Phylogenetic tree was inferred by NJ distance method. The clusters are well supported by bootstrap analysis and partly reflect the morphological similarity of the organisms. Key words: Anabaena, Cyanobacteria, Sequencing of the 16S rrna gene, Phylogeny, Taxonomy INTRODUCTION Cyanobacteria are among the most widespread, morphologically distinct and abundant prokaryotes known. They are oxygenic photosynthetic autotrophs with the unique ability to fix admospheric nitrogen, (Rippka, R., J. Deruelles, 1979; Whitton, B.A., 1992; Holt, J.G., N.R. Krieg., 1994) originally considered as a class of algae, the blue-green algae. They have an extraordinary biosynthetic potential and a repertoire of diverse metabolic activities. They are one of the dominant genera in various ecological habitats, especially in rice fields, where they are found as both free-living and symbiotic with the water fern, Azolla. The genus Anabaena was established by Bory in Geitler (1932) described 57 European species of Anabaena, while Desikachary (1959) designated 25 species in Cyanophyta. Morphology, developmental and biochemical parameters may vary with environmental or culture conditions. They can be classified on the basis of morphology, cellular differentiation, biochemical, physiological and genetic criteria. DNA base composition is a very important genetic character to study the taxonomy of cyanobacteria. Analysis of the DNA base composition (Mol % G+C) is one of the few molecular characters that have been determined for almost 200 cyanobacterial strains (Herdman, M., M. Janvier, 1979). Large differences in DNA base composition indicate that the strains cannot be closely related, whereas similar G+C percentages give no clue concerning genotyping relationships (Wilmotte, A., 1994). Grouping based on the sequence identity was supported by morphological features (size and morphology of vegetative cells, heterocyst and akinetes, and diameter and morphology of trichomes) (Bolch, C.J.S., S.L. Blackburn, 1996; Bolch, C.J.S., P.T. Orr, 1999). Phylogenetic characterizations of natural microbial communities of unknown diversity were done through analysis of 1 6S rrna gene sequence (Stackebrundt, E. and C.R.Woese, 1981). Oxygenic photosynthetic prokaryotes, cyanobacteria and prochlorophytes are genetically related on the basis of 1 6S rrna sequences (Woese, C.R., 1987). It has now been revealed that Prochlorococcus is closely related to the marine clustera Synechococcus, based on analyses using gene sequences from 16S rrna (16S rdna) and rpoc1, a subunit of DNA-dependent RNA polymerase (Palenik, B. and R. Haselkorn, 1992; Urbach, E., D.L. Robertson, 1992; Urbach, E., D.J. Scanlan, 1998; Toledo, G. and B. Palanik, 1997; Toledo, G., B. Palanik, 1997). Such studies have been performed using 16S rdna (SSU) sequences. A phylogenetic tree was constructed by Wilmotte (1994). 16S rrna has been frequently used to establish a gene based phylogeny of cyanobacteria (Giovannoni, S.J., S. Turner, 1988; Wilmotte, A., J.M. Neefs, 1994; Nelissen, B., R. De Baere, 1996; Turner, S., 1997; Lehtimaki, J., C. Lyra., 2000; Lyra, C., S. Suomalainen, 2001; Robertson, B.R., N. Tezuka, 2001). Cyanobacterial genera namely Anabaena, Nostoc, Phormidium, Microcystis, Synechococcus and Synechocystis have been analyzed using molecular techniques such as DNA sequencing (Neilan, B.A., D. Jacobs., 1997). Corresponding Author: Dr. A. Ezhilarasi, 26/2,F1,Priyadarsin Appartment, 8th Main Road, Kathuribai Nagar,Adyar, Chennai , India. Tel.: , Mob.: Fax: anbuezhilarasi@gmail.com 4026

2 The amplified 16S - 23S rdna spacer (ITS-1) of cyanobacteria has been used in several studies to genetically characterize strains by PCR-RFLP (West, N.J. and D.G. Adams, 1997) or by sequence analyses (Wilmotte, A., J.M. Neefs, 1994; Otsuka, S., S. Suda, 1999; Boyer, S.L., V.R. Flechtner, 2001; Rocap, G., D.L. Listel, 2002). A genotypic characteristic-dna base composition was examined for 50 planktonic strains of Anabaena assigned to 22 different morphological species (Li, R., M. Wantanabe, 2000). The genetic variability of the cosmopolitan, ubiquitous fresh water cyanobacterium Phormedium retzii was assessed using random amplified polymorphic DNA (RAPD) marker and 16S rdna sequences (Casamatta, D.A., M.L.Vis, 2003). 16S rrna and ITS-1 sequence analysis were determined in Synechococcus (Rocap, G., D.L. Listel, 2002; Ernst, A., S. Becker, 2003) and sequences for the 16S-23 S rdna internal transcribed spacer (ITS) region were determined in 32 Prochlorococcus isolates and 25 Synechococcus isolates (Rocap, G., D.L. Listel, 2002; Ernst, A., S. Becker, 2003). rrna gene sequences have now become the most widely used methods for identification, classification and phylogeny of cyanobacteria. In the present study the genus Anabaena Bory was chosen for taxonomic analysis. The morphological criteria traditionally used for identification of Anabaena species are: biometric characters of vegetative cells, heterocysts and spores. An important feature for species identity of the taxa is the proximity of the akinetes to heterocysts (Anand, N., 1978; Anand, N., 1979). In the investigation, our objective was to develop an easy and reliable method to analyze the morphological and genetic variations using sequencing of the 1 6S rrna gene fingerprinting, all of which are PCR based methods, have been employed for the species level variations of Anabaena. CLUSTAL W analysis (Thompson, J.D., D.G. Higgins, 1994) of the sequence results were carried out for the phenograms for the eight isolates used in the study. MATERIALS AND METHODS Organisms and Culture Conditions: Eight cultures of Anabaena were selected from the Culture Collection of Algae, Centre for Advanced Studies in Botany, University of Madras, India. The original habitats, taxonomic details and akinete positions of the strains are listed in Table 1. Axenic cultures of Anabaena species were grown in BG 11o medium (Rippka, R., J. Deruelles, 1979). Table 1: Strains used in this study Taxonomic designation of Position of heterocysts and akinetes Origin / Source Anabaena Bory (No. strains) A. torulosa (A525) heterocysts adjacent to akinetes M2/2 as2t2 Gif Sur Yvette from, France A. cylindrica (A621) heterocysts adjacent to akinetes Isolate175,Kantz(1403/2a),ICC, U.S.A A.augstumalis A802) heterocysts adjacent to akinetes Czech.Jahnke 4a A. sphaerica (A904) heterocysts adjacent to akinetes 1616 ICC, U.S.A A. inaequalis (A487) heterocysts away from the akinetes 1403/9 CCAP, UK A. variabilis (A514) heterocysts away from the akinetes 1403/12 CCAP, UK A. subtropica (A618) heterocysts away from the akinetes Isolate 45 Kantz Feb.71 ICC, U.S.A A. verrucosa (A622) heterocysts away from the akinetes ICC, U.S.A CCAP: Culture Collection of Algae and Protozoa, Cambridge, U.K. ICC: Indiana Culture Collection, U.S.A. Preparation of DNA Sample for Electrophoresis: DNA extraction was carried out according to standard procedures (Sambrook, J., E.F. Fritsch, 1989). Exponentially growing (50 ml) cells were pelletted by centrifugation and resuspended in 0.5 ml of lysis solution (25% sucrose, 50 mm Tris HCl, 100 mm EDTA). The cells were treated with 5 mg of lysozyme for 30 min at 37 C. Sodium dodecyl sulfate and proteinase K were added to final concentrations of 1% and μg ml, respectively and the samples were incubated at 45 C overnight. The DNA was extracted three times with Phenol: Chloroform: Isoamyl alcohol (25:24:1) and twice with Chloroform: Isoamyl alcohol (24:1). The DNA was precipitated, washed with 70% ethanol, resuspended in 100 μl of Tris EDTA buffer, and stored at -20 C. Polymerase chain reactions (PCRs) were performed on an ERICOMP, Delta cycler I system, Easy cycler PCR system. Oligonucleotides were purchased from DDT, UK. Amplification of the 16S rrna Gene: PCR amplification was performed on purified DNA of Anabaena spp. (Iteman, I., R. Rippka, 2000). Amplification of the 16S rrna gene was carried out by PCR using primers A2 (AGAGTTTGATCCTGGCTCAG) and S8 (TCTACGCATTTCACCGCTAC). The PCR mixture contained 10 μl Taq (10 X) commercial buffer, 10 μl purified DNA ( ng), 150 μm of each dntp, 500 ng of each 4027

3 primer and 2.5 U Taq polymerase. Total reaction volume was 100 μl after an initial cycle consisting of 3 min º º º º at 95 C, 2 min at 55 C and 30 s at 72 C, 30 cycles of amplification were started (1.5 min at 95 C, 2.5 min at º º º 55 C and 3 min at 72 C). The termination cycle was 7 min at 72 C. The PCR products were migrated either on 1.5 % (w/v) agarose gel containing 0.5 X TBE and visualized by staining with 0.5 μg/ml ethidium bromide. Sequencing of the 16S rrna Gene: After purification [PCR purification kit (Genei, Bangalore)] PCR products of the 16S rrna (1,500 bp PCR products were amplified) were directly sequenced at a commercial facility (Avestha Gengraine Technologies, Bangalore). The sequences (16S ribosomal RNA gene, partial sequence) determined have been deposited in Gene Bank with the following accession numbers: Anabaena torulosa (EF375610), Anabaena cylindrica (EF ), Anabaena augstumalis (EF488830), Anabaena sphaerica (EF ), Anabaena inaequalis (EF583842), Anabaena variabilis (EF488831), Anabaena subtropica (EF375613) and Anabaena verrucosa (EF375614). Phylogenetic Analyses: Sequences were aligned using the CLUSTAL W Multiple Sequence Alignment Program (Thompson, J.D., D.G. Higgins, 1994). Phylogenetic tree was constructed including the available cyanobacterial gene sequences along with the sequences determined in this study using the neighbor-joining method. In this program, bootstrap analysis was used to evaluate the tree topologies by performing 1000 resamplings. RESULTS AND DISCUSSION Species of the genus Anabaena Bory are distinguished based on morphological characters and one of the many characters is the position of the spore in relation to the heterocyst. This character is useful when identifying collected samples but in cultured strains it is likely that either sporulation could be delayed or heterocysts formation is in response to the nutrients availability in the medium. Moreover in culture the biometric characters of vegetative cells, heterocysts and spores (akinetes) can vary from that of natural specimens. The present attempt is to look into this aspect to know exactly whether morphological characters on which the taxonomic identity is based are genetically strong and stable. The sequence of the 16S rrna gene was determined for eight Anabaena spp. (Anabaena torulosa A525, A. cylindrica A621, A. augstumalis A802, A. sphaerica A904, A. inaequalis A487, A. variabilis A514, A. subtropica A618, and A. verrucosa A622). The sequences were compared with those of representative heterocystous cyanobacteria (Anabaena) available in GenBank. Phylogenetic tree was inferred by NJ distance method. The clusters are well supported by bootstrap analysis and partly reflect the morphological similarity of the organisms (Fig. 1 and Fig. 2).The cyanobacteria studied here were divided into two branches (Fig. 1). The first branch constituted the six of the eight sequences and included Anabaena forming heterocysts away from the akinetes. The second minor branch contained A. sphaerica and A. torulosa which form heterocysts adjacent to akinetes. The NJ tree resulted by the combination of the eight sequences determined in this study with other Anabaena spp. sequences also showed two major branches. Within the first major cluster the two morphoforms of Anabaena with respect to heterocysts position adjacent or away from akinetes were seen (Fig. 2).The results indicated that morphological differences within the Anabaena genus with respect to the positioning of heterocysts are not reflected at the 1 6S rrna gene level. In the present study, Neighbor-Joining method is used for analysis of the 16S rrna and for the phylogenetic tree constructions. Two branches of the Anabaena tested were found in 1 6S rrna gene sequence analysis. Though morphologically similar A. inaequalis, A. subtropica, A. variabilis and A. verrucosa formed the major first cluster, the other morphoform A. cylindrica and A. augustumalis were intermixed with the first major cluster. Previously, molecular taxonomic studies have indicated the grouping of Anabaena together with Aphanizomenon strains (Neilan, B.A., 1995; Rudi, K., O.M. Skulberg, 1997; Lu, W., H.E. Evans, 1997; Lyra, C., J. Hantula, 1997; Rudi, K. and K.S. Jakobsen, 1999). The 16S rrna sequences were combined with other selected Anabaena species available in the database and the CLUSTAL W (Thompson, J.D., D.G. Higgins, 1994) analysis showed the presence of distinct groups. A BLAST search performed on the 16S rrna primary sequences resulted in the highest similarity scores for cyanobacteria. 16S rrna gene sequence similarities of 98% within Anabaena cylindrica, Anabaena sphaerica, Anabaena variabilis and Anabaena verrucosa, 97% in Anabaena augstumalis, 96% in Anabaena torulosa, Anabaena subtropica and 93% in Anabaena inaequalis were observed. 4028

4 Fig. 1: Neighbor joining phylogenetic tree for the selected Anabaena spp. 16S rrna gene sequences. Bootstrap values are indicated in the point at nodes. Fig. 2: Neighbor joining phylogenetic tree for the tested Anabaena spp. 16S rrna gene sequences with other sequences available in public databases. Bootstrap values are indicated in the point at nodes. It needs mention that morphological characterization of unicellular Merismopedia and Microcystis strains was also unsuccessful in distinguishing genetic subcultures created by 1 6S rdna sequencing (Palinska, K.A., W. Liesack, 1996; Otsuka, S., S. Suda, 1998). Giovannoni et al. (1988) and Wilmotte (1994) have found grouping of Nodularia PCC with Anabaena cylindrica PCC 7122 and Prochlorococcus is phylogenetically related to cyanobacteria and closest to Synechococcus (Urbach, 1998). Hepatotoxic Anabaena strains were phylogenetically different from neurotoxin producing strains using 1 6S rdna sequence (Lyra, 2001). The 16S rdna sequence analysis data in this report confirm that heterocyst-forming cyanobacteria consist of a monophyletic group. Phylogenetic data do not correlate with the bacteriological and traditional classifications, which distinguish filamentous heterocystous cyanobacteria with or without true branching (Nostocales/Stigonematales) (Gugger, M.F. and L. Hoffmann, 2004). Sequence analysis of 16S rrna gene revealed that Nodularia is closely related to Nostoc, Aphanizomenon and Anabaena (Lehtimaki, 2000). It needs mention here that a new genus Spirirestis rafaelensis shared morphological characters with both 4029

5 Scytonemaceae and Microchaetaceae but was found to be closely related to Microchaetacea at the molecular level (Flechtner, V.R., S.L. Boyer, 2002). REFERENCES Anand, N., Role of heterocyst in sporulation of blue-green algae. Journal of Madras University, 41: Anand, N., Studies on the genus Anabaena Bory. II. A key to the identification of some Anabaena species in culture, Acta Botanica Indica, 7: Boyer, S.L., V.R. Flechtner and J.R. Johansen, Is the 16S-23S rrna Internal transcribed spacer region a good tool for use in molecular systematic and population genetics? A case study in cyanobacteria. Molecular and Biological Evolution, 18: Bolch, C.J.S., S.L. Blackburn, B.A. Neilan and P.M. Grewee, Genetic Charecterisation of Strains of cyanobacteria using PCR-RFLP of the cpcba intergenic spacer and flanking regions. Journal of Phycology, 322: Bolch, C.J.S., P.T. Orr, G.J. Jones and S.I. Blackburn, Genetic, morphological, and toxicological variation among globally distributed strains of Nodularia (cyanobacteria). Journal of Phycology, 35: Casamatta, D.A., M.L.Vis and R.G. Sheath, Cryptic species in cyanobacterial systematics: a case study of Phormidium retzii (Oscillatoriales) using RAPD molecular markers and 16S rdna sequence data. Aquatic Botany, 77: Desikachary, T.V., Cyanophyta. Indian Council of Agricultural Research. New Delhi, pp: 686. Ernst, A., S. Becker, U.I.A. Wollenzien and C. Postius, Ecosystem dependent adaptive radiations of picocyanobacteria inferred from 16S rrna and ITS-1 sequence analysis. Microbiology, 149: Flechtner, V.R., S.L. Boyer, J.R. Johansen and M.L. DeNoble, Spirirestis rafaelensis gen. et sp. nov. (Cyanophyceae), a new cyanobacterial genus from Arid Soils, Nova Hedwigia, 74: Geitler, L., Cyanophyceae. In Rabenhorst s Kryptogamenflora Leipzig, 14: Giovannoni, S.J., S. Turner, G.J. Olsen, S. Barns., D.J. Lane and N.R. Pace, Evolutionary relationships among cyanobacteria and green chloroplasts. Journal of Bacteriology, 170: Gugger, M.F. and L. Hoffmann, Polyphyly of the true branching cyanobacteria (Stigonematales). International Journal of Systematic and Evolutionary Microbiology, 54: Holt, J.G., N.R. Krieg., P.H.A. Sneath, J.T. Stanley and S.T. Williams, Bergey s 8manual of determinative bacteriology: group 11, oxygenic phototrophic bacteria, Herdman, M., M. Janvier, J.B. Waterbury, R. Rippka, R.Y. Stanier and M. Mandel, Deoxyribonucleic acid base composition of cyanobacteria. Journal of General Microbiology, 111: Iteman, I., R. Rippka, N. Tandeau de Marsac and M. Herdman, Comparison of conserved structural and regulatory domains within divergent 1 6S rrna-23 S rrna spacer sequences of cyanobacteria. Microbiology, 146: Lehtimaki, J., C. Lyra., S. Suomalainen, P. Sundman, L. Rouhiainen, L. Paulin, M. Salkinoja-Salonen and K. Sivonen, Characterization of Nodularia strains, cyanobacteria from brackish waters, by genotypic and phenotypic methods, International Journal of Systematic and Evolutionary Microbiology, 50: Lyra, C., S. Suomalainen, M. Gugger, C. Vezie, P. Sundman, L. Paulin and K. Sivonen, Molecular characterization of planktic cyanobacteria of Anabaena,1Aphanizomenon, Microcystis and Planktothrix genera. International Journal of Systematic and Evolutionary Microbiology, 51: Li, R., M. Wantanabe and M.M. Wantanabe, Taxonomic studies of Anabaena based on morphological charecteristics in cultured strains Hydrobiologia, 438: Lu, W., H.E. Evans, M. McColl and V.A. Saunders, Identification of cyanobacteria by polymorphisms of PCR-amplified ribosomal DNA spacer region. FEMS Microbiological Letter, 153: Lyra, C., J. Hantula, E. Vainio, J. Rapala, L. Rouhiainen and K. Sivonen, Characterization of cyanobacteria by SDS-PAGE of whole-cell proteins and PCR-RFLP of the 16S rrna gene, Archives of Microbiology, 168: Nelissen, B., R. De Baere, A. Wilmotte and R. De Wachter, Phylogenetic relationships of nonaxenic filamentous cyanobacterial strains based on16s rrna sequence analysis. Journal of Molecular Evolution, 42: Neilan, B.A., D. Jacobs., T. del Dot., L.L. Blackall., P.R. Hawkins., P.T.Cox and A.E. Goodman, rrna sequences and evolutionary relationships among toxic and 0nontoxic cyanobacteria of the genus Microcystis. International Journal of Systematic Bacteriology, 47:

6 Neilan, B.A., Identification and phylogenetic analysis of toxigenic cyanobacteria by multiplex randomly amplified polymorphic DNA PCR. Applied and Environmental Microbiology, 61: Otsuka, S., S. Suda, R. Li, M. Watanabe, H. Oyaizu, S. Matsumoto and M.M. Watanabe, Phylogenetic relationships between toxic and non-toxic strains of the genus Microcystis based on 16S to 23S internal transcribed spacer sequence, FEMS Microbiological Letters, 171: Otsuka, S., S. Suda, R. Li, M. Watanabe, H. Oyaizu, S. Matsumoto and M.M. Watanabe, S rdna sequences and phylogenetic analyses of Microcystis strains with and without phycoerythrin. FEMS Microbiological Letter, 164: Palenik, B. and R. Haselkorn, Multiple evolutionary origins of prochlorophytes, the chlorophyllcontaining prokaryotes. Nature, 355: Palinska, K.A., W. Liesack, E. Rhiel and W.E. Krumbein, Phenotype variability of identical genotypes: the need for a combined approach in cyanobacterial taxonomy demonstrated on Merismopedia-like isolates. Archives of Microbiology, 166: Rippka, R., J. Deruelles, J.B Waterbury, M. Herdman and R.Y Stanier, Generic assignments, strain histories and properties of pure cultures of cyanobacteria. Journal of General Microbiology, 111: Robertson, B.R., N. Tezuka and M.M. Watanabe, Phylogenetic analyses of Synechococcus strains (cyanobacteria) using sequences of 1 6S rdna and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. International Journal of Systematic and Evolutionary Microbiology, 51: Rocap, G., D.L. Listel, J.B. Waterbury and S.W. Chisholm, Resolution of Prochlorococcus and Synechococcus ecotypes by using 16S 23S ribosomal DNA internal transcribed spacer sequences. Applied and Environmental Microbiology, 68: Rudi, K., O.M. Skulberg and K.S. Jakobsen, Strains charecterization and classification of oxyphotobacteria in clone cultures on the basis of 16S rrna sequences from the variable regions V6, V7 and V8. Applied Environmental Microbiology, 63: Leu Rudi, K. and K.S. Jakobsen, Complex evolutionary patterns of trna (UAA) group I introns in cyanobacterial radiation. Journal of Bacteriology, 181: nd Sambrook, J., E.F. Fritsch and T. Maniatis, Molecular cloning laboratory manual 2 ed. Cold Spring Harbor Laboratory Press Cold Spring Horbor, N.Y. Stackebrundt, E. and C.R.Woese, Towards a phylogeny of the actinomycetes and related organisms. Current Microbiology, 5: Toledo, G. and B. Palanik, Synechococcus diversity in the California current as seen by RNA polymerase (rpoc1) gene sequences of isolated strains. Applied Environmental Microbiology, 63: Toledo, G., B. Palanik and B. Brahamsha, Swimming marine Synechococcus strains with widely different photosynthetic pigment ratios from a monophyletic group. Applied Environmental Microbiology, 63: Turner, S., Molecular systematics of oxygenic photosynthetic bacteria. Plant Systematic and Evolution, 11: Thompson, J.D., D.G. Higgins and T.J. Gibson, CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: Urbach, E., D.L. Robertson and S.W. Chisholm, Multiple evolutionary origin of prochlorophytes within the cyanobacterial radiation. Nature, 355: Urbach, E., D.J. Scanlan, D.L. Distel, J.B.Waterbury and S.W. Chisholm, Rapid diversification of marine picophytoplankton with dissimilar light-harvesting structures inferred from sequences of Prochlorococcus and Synechococcus. Journal of Molecular Evolution, 16: West, N.J. and D.G. Adams, Phenotypic and genotypic comparison of symbiotic and free-living cyanobacteria from a single field site. Applied and Environmental Microbiology, 63: Whitton, B.A., Diversity, ecology and taxonomy of the cyanobacteria. In: N.H. Mann and N.G. Carrs (eds.). Photosynthetic prokaryotes. Plenum. Wilmotte, A., Molecular evolution and taxonomy of the cyanobacteria. In D.A.Bryant (ed.), The molecular biology of cyanobacteria Kluwer Academic Publishers, Dordrecht, The Netherlands, pp: Wilmotte, A., J.M. Neefs and R. de Wachter, Evolutionary affiliation of the marine nitrogen-fixing cyanobacterium Trichodesmium sp. strain NIBB 1067, derived by 16S 9ribosomal RNA sequence analysis. Microbiology, 140: Woese, C.R., Bacterial evolution. Microbiological Reviews, 51: