Development and use of chloroplast microsatellites in Phaseolus spp. and other legumes

Transcription

1 Plant Biology ISSN RESEARCH PAPER in Phaseolus spp. and other legumes S. A. Angioi 1, F. Desiderio 2, D. Rau 1, E. Bitocchi 2, G. Attene 1 & R. Papa 2 1 Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria, Università degli Studi di Sassari, Sassari, Italy 2 Dipartimento di Scienze Ambientali e delle Produzioni Vegetali, Università Politecnica delle Marche, Ancona, Italy Keywords Domestication; genetic diversity; Leguminosae; molecular markers; Phaseolus. Correspondence R. Papa, Dipartimento di Scienze Ambientali e delle Produzioni Vegetali, Università Politecnica delle Marche, Via Brecce Bianche, Ancona, Italy. r.papa@univpm.it Editor M. Sugita Received: 19 May 2008; Accepted: 17 July 2008 doi: /j x ABSTRACT Chloroplast microsatellites (cpssrs) provide a powerful tool to study the genetic variation and evolution of plants. We have investigated the usefulness of 39 primer pairs tagging cpssr loci on a set of eight different genera of Leguminosae (Papilionoideae subfamily) and five species belonging to the genus Phaseolus. Thirty-six universal primer pairs were retrieved from the literature, one was re-designed and a further two were designed de novo. The cpssr loci analysed were highly polymorphic across the individuals examined. Twenty-seven primer pairs were polymorphic in the overall sample, 18 within Phaseolus, and 16 in both P. vulgaris and P. coccineus. Analysis of the plastome sequences of four Leguminosae species (obtained from GenBank) showed that in the loci targeted by universal primer pairs: (i) the originally tagged cpssrs can be lost; (ii) other cpssrs can be present; and (iii) polymorphism arises not only from differences in the numbers of cpssr repeats, but often from other insertion deletion events. Multilocus linkage disequilibrium analysis suggests that homoplasy is not a major problem in our dataset, and principal component analysis indicates intelligible relationships among the species considered. Our study demonstrates that this set of chloroplast markers provides a useful tool to study the diversity and the evolution of several legumes, and particularly P. vulgaris and P. coccineus. INTRODUCTION Chloroplast microsatellites (cpssrs) are highly polymorphic sequences (Powell et al. 1995; Vendramin et al. 1996; Petit et al. 2005). The repeats in the chloroplast genome of higher plants are generally made up of short poly (A) or poly (T) stretches, with a maximum size of about 20 bp (Wang et al. 1994). Studies using flanking PCR primers have shown that cpssrs are polymorphic among different species and accessions of Glycine (Powell et al. 1996; Xu et al. 2002), Hordeum (Provan et al. 1999a), Oryza (Provan et al. 1997; Ishii & McCouch 2000), Pinus (Cuenca et al. 2003), Solanum (Bryan et al. 1999; Sukhotu et al. 2006) and Vitis (Arroyo-García et al. 2002). CpSSRs have often revealed much higher levels of diversity when compared to chloroplast RFLP (Provan et al. 1997, 1999a). In angiosperms, the chloroplast genome is uniparentally inherited, which allows clarification of the relative contributions of seed and pollen flow to the genetic structure of populations, through a comparison of nuclear and chloroplast markers (Ennos et al. 1999). Moreover, cpdna markers have proven particularly useful for the identification of hybridisation (Palmé & Vendramin 2002). Although cpssrs are not particularly useful for interspecific analyses, their relatively high mutation rates mean that they are indicated for intraspecific analyses (Hale et al. 2004). Indeed, previous estimates of mutations per generation vary from 10 )3 in Pinus contorta (Marshall et al. 2002) to )5 in Pinus torreyana (Provan et al. 1999b). Mutations facilitate the formation of fragments that are identical in size, but that have different evolutionary histories, resulting in a more frequent homoplasy (identity in state, but not for descent). Thus, homoplasy might be a problem when analysing interspecific microsatellite datasets (e.g. see Doyle et al. 1998). However, cpssrs have a lower mutation rate when compared to nuclear microsatellites (Provan et al. 1999b), and 598 Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands

2 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa consequently for these markers, size homoplasy should not be a major problem when comparing different gene pools of the same species, or between closely related species. The flanking regions of cpssr loci are conserved among different related species (Olmstead & Palmer 1994). Weising & Gardner (1999) designed 10 universal cpssr primer pairs that identified microsatellite loci (n > 10) on the completely sequenced chloroplast genome of Nicotiana tabacum (Shinozaki et al. 1986), and aligned these sequences to the cpdna of other angiosperms. They showed that the primer pairs were able to amplify the target sequences across a broad range of plant families (including Leguminosae). To completely cover the N. tabacum chloroplast genome, Chung & Staub (2003) developed 23 universal primer pairs, with the redesigning of some of those of Weising & Gardner (1999). The primer pairs were tested with respect to members of other plant families, and in most cases they produced amplicons. These universal primer pairs have been used in several studies, including analyses of the genetic diversity in populations of Caesalpina echinata (Lira et al. 2003), the molecular phylogeny of Anthyllis spp. (Nanni et al. 2004), the diversity of landraces of Phaseolus spp. collected in central Italy (Sicard et al. 2005) and the domestication process of some cultivated species, i.e. Vitis vinifera (Arroyo-García et al. 2006) and Helianthus annuus (Wills & Burke 2006). The Leguminosae family includes 727 genera (19,325 species) (Lewis et al. 2005). The subfamily Papilionoideae consists of 28 tribes, including Phaseoleae [Phaseolus vulgaris L., Vigna unguiculata (L.) Walp. ssp. unguiculata and Glycine max (L.) Merr.], Dalbergiae (Arachis hypogaea L.), Cicereae (Cicer arietinum L.), Trifolieae (Medicago truncatula L.) and Fabaceae (Pisum sativum L.). Phaseolus is a large and diverse genus and includes five domesticated species: P. vulgaris L. (common bean), P. coccineus L. (runner bean), P. dumosus Macfad. (year-long bean), P. acutifolius A. Gray (tepary bean) and P. lunatus L. (lima bean). The relationships among Phaseolus species have been investigated using a large number of diverse molecular tools, e.g. cpdna (Delgado-Salinas et al. 1993; Schmit et al. 1993; Llaca et al. 1994), microsatellites (Hamann et al. 1995) and PCR-RFLP (Vekemans et al. 1998). The diversity and evolutionary history of P. vulgaris have been studied in detail (see Singh 2001; Papa et al. 2006; Acosta-Gallegos et al for a review) through morphological data (Evans 1976), phaseolin (e.g. Gepts & Bliss 1986; Koenig et al. 1990), isozymes (Koenig & Gepts 1989; Singh et al. 1991), RFLP (Becerra-Velásquez & Gepts 1994), AFLP (Tohme et al. 1996; Papa & Gepts 2003; Papa et al. 2005, 2007), ISSR (González et al. 2005), DNA sequence variation (phaseolin: Kami et al. 1995; dihydroflavonol 4-reductase intron 1: McClean et al. 2004), microsatellites (Gaitán-Solís et al. 2002; Masi et al. 2003; Blair et al. 2006), STS (Murray et al. 2002), including a few cpssrs (Sicard et al. 2005) and chloroplast RFLPs (Chacón et al. 2005, 2007). Our main objective was to develop and investigate the usefulness of cpssr primer pairs to study the genetic diversity of Phaseolus spp. and other legumes. To validate the potential of cpssrs to study the genetic diversity in legumes, and particularly in Phaseolus, a small set of individuals (comprising eight genera and five species of Phaseolus) belonging to the Leguminosae was analysed and compared to other data available in the literature. MATERIALS AND METHODS Plant materials In the present study we analysed 66 accessions (Table 1), each one represented by a single individual genotype. The sample represents the most important domesticated genera and tribes of the Leguminosae (Papilionoidae subfamily). The set included eight different genera (Lupinus, Arachis, Cicer, Medicago, Pisum, Glycine, Vigna and Phaseolus). Moreover, as we were mainly interested in the Phaseolus genus, we analysed several accessions for each of the five domesticated species. Twenty-five accessions of P. vulgaris were used, which represented two different gene pools (Andean and Mesoamerican) and forms (wild and domesticated), including also the putative ancestral gene pool (phaseolin I) and wild Colombian accessions. We also included 19 accessions of P. coccineus (wild and domesticated), two of P. acutifolius, four of P. dumosus, and nine of P. lunatus. The germplasm accessions were obtained from the United States Department of Agriculture (USDA), the Centro Internacional de Agricultura Tropical (CIAT), and the collection of the Agricultural Genetics Laboratory of the Università Politecnica delle Marche (UNIVPM). CpSSR analysis Young leaves were harvested for DNA extraction, which was carried out on a single plant basis using the DNeasy 96 Plant Kit and an MM300 Mixer Mill (Qiagen GmbH, Hilden, Germany). PCR was carried out in a 25 ll volume, containing 25 ng template DNA, 10 pmol of each primer, 20 lm dntps, 1 PCR buffer (20 mm Tris-HCl, ph 8.4, 50 mm KCl), 50 mm MgCl 2 and 1U Taq DNA polymerase (Invitrogen, Milan, Italy). The amplifications were done with a Perkin-Elmer 9700 thermocycler (Applied Biosystems, Foster City, CA, USA), with an initial 5 min at 94 C, followed by 35 cycles of: 1 min at 94 C, 1 min at 50 C, 1 min at 72 C, and a final extension step for 7 min at 72 C (ramping, 75%) (see Table 2 for modifications to this standard protocol). The molecular weights of the amplification products were estimated with the 3100-Avant Genetic Analyzer sequencer (Applied Biosystems). We tested 39 primer pairs on the set of accessions. Ten were universal primer pairs designed by Weising & Gardner (1999) (Table 2) that were tested on Pisum sativum. Three of them (ccmp1, ccmp2, ccmp3) were also Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands 599

3 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Table 1. Accessions analysed in this study: tribe, species, accession number, country of origin (GP gene pool, only for Phaseolus vulgaris: anc = putative ancestral, A = Andean, M = Mesoamerican), form (D = domesticated, W = wild) and donor. code tribe species accession country (GP) form donor - Genisteae Lupinus albus W62784 Spain D USDA - Dalbergineae Arachis hypogaea PI Brazil W USDA - Cicereae Cicer aretinum W Uzbekistan W USDA - Trifolieae Medicago truncatula AC W USDA - Fabeae Pisum sativum W69388 Pakistan W USDA - Phaseoleae Glycine max PI62204 China D USDA - Phaseoleae Vigna unguiculata Grif12330 China Weedy USDA 1 Phaseoleae Phaseolus vulgaris G19891 Argentina W CIAT 2 Phaseoleae Phaseolus vulgaris G19895 Argentina W CIAT 3 Phaseoleae Phaseolus vulgaris G21194 Argentina W CIAT 4 Phaseoleae Phaseolus vulgaris G21198 Argentina W CIAT 5 Phaseoleae Phaseolus vulgaris G21115 Colombia W CIAT 6 Phaseoleae Phaseolus vulgaris G21117 Colombia W CIAT 7 Phaseoleae Phaseolus vulgaris G23426 Perú W CIAT 8 Phaseoleae Phaseolus vulgaris G23418 Costa Rica W CIAT 9 Phaseoleae Phaseolus vulgaris G19906 Guatemala W CIAT 10 Phaseoleae Phaseolus vulgaris G19907 Guatemala W CIAT 11 Phaseoleae Phaseolus vulgaris G19909 Guatemala W CIAT 12 Phaseoleae Phaseolus vulgaris G23429 Mexico W CIAT 13 Phaseoleae Phaseolus vulgaris G23582 Equador (anc) W CIAT 14 Phaseoleae Phaseolus vulgaris G21245 Perú (anc) W CIAT 15 Phaseoleae Phaseolus vulgaris G23585 Perú (anc) W CIAT 16 Phaseoleae Phaseolus vulgaris PI Brazil (A) D USDA 17 Phaseoleae Phaseolus vulgaris PI Chile (A) D USDA 18 Phaseoleae Phaseolus vulgaris PI Chile (A) D USDA 19 Phaseoleae Phaseolus vulgaris PI Perú (A) D USDA 20 Phaseoleae Phaseolus vulgaris PI Perú (A) D USDA 21 Phaseoleae Phaseolus vulgaris PI Mexico (M) D USDA 22 Phaseoleae Phaseolus vulgaris PI Honduras (M) D USDA 23 Phaseoleae Phaseolus vulgaris PI Mexico (M) D USDA 24 Phaseoleae Phaseolus vulgaris PI Mexico (M) D USDA 25 Phaseoleae Phaseolus vulgaris PI Mexico (M) D USDA 26 Phaseoleae Phaseolus coccineus PI Mexico W USDA 27 Phaseoleae Phaseolus coccineus PI Mexico W USDA 28 Phaseoleae Phaseolus coccineus PI Mexico W USDA 29 Phaseoleae Phaseolus coccineus PI Mexico W USDA 30 Phaseoleae Phaseolus coccineus PI Mexico W USDA 31 Phaseoleae Phaseolus coccineus CX03 Mexico W UNIVPM 32 Phaseoleae Phaseolus coccineus PI Mexico W USDA 33 Phaseoleae Phaseolus coccineus CF19 Mexico W UNIVPM 34 Phaseoleae Phaseolus coccineus PI Honduras D USDA 35 Phaseoleae Phaseolus coccineus PI Mexico D USDA 36 Phaseoleae Phaseolus coccineus PI Mexico D USDA 37 Phaseoleae Phaseolus coccineus PI Mexico D USDA 38 Phaseoleae Phaseolus coccineus PI Mexico D USDA 39 Phaseoleae Phaseolus coccineus PI Mexico D USDA 40 Phaseoleae Phaseolus coccineus PI Mexico D USDA 41 Phaseoleae Phaseolus coccineus PI Mexico D USDA 42 Phaseoleae Phaseolus coccineus PI Mexico D USDA 43 Phaseoleae Phaseolus coccineus PI Mexico D USDA 44 Phaseoleae Phaseolus coccineus PI Mexico D USDA 45 Phaseoleae Phaseolus acutifolius PI El Salvador D USDA 46 Phaseoleae Phaseolus acutifolius PI Mexico D USDA 47 Phaseoleae Phaseolus dumosus PI Costa Rica D USDA 48 Phaseoleae Phaseolus dumosus PI Guatemala D USDA 600 Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands

4 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Table 1. Continued. code tribe species accession country (GP) form donor 49 Phaseoleae Phaseolus dumosus PI Guatemala D USDA 50 Phaseoleae Phaseolus dumosus PI Mexico D USDA 51 Phaseoleae Phaseolus lunatus PI Argentina D USDA 52 Phaseoleae Phaseolus lunatus W Argentina D USDA 53 Phaseoleae Phaseolus lunatus PI Costa Rica D USDA 54 Phaseoleae Phaseolus lunatus PI Costa Rica D USDA 55 Phaseoleae Phaseolus lunatus PI Guatemala D USDA 56 Phaseoleae Phaseolus lunatus PI Mexico D USDA 57 Phaseoleae Phaseolus lunatus PI Mexico D USDA 58 Phaseoleae Phaseolus lunatus PI Mexico D USDA 59 Phaseoleae Phaseolus lunatus PI Mexico D USDA CIAT, Centro Internacional de Agricultura Tropical; USDA, United States Department of Agriculture; UNIVPM, Università Politecnica delle Marche. Table 2. The 39 primer pairs for cpssrs screened in this study, including locus name, reference and PCR conditions. locus name reference PCR conditions ccmp1, ccmp8, ccmp9, ccssr3, ccssr5, ccssr10, SOYCP, RD19, gmcp1, gmcp3 ccmp2, ccmp4, ccmp5, ccmp6, ccmp7, ccmp10, ccssr2, ccssr4, ccssr6, ccssr7, ccssr8, ccssr9, ccssr12, ccssr14, ccssr15, ccssr16, ccssr17, ccssr18, ccssr19, ccssr20, ccssr21, ccssr22, gmcp2, gmcp4 Weising & Gardner (1999), Chung & Staub (2003), Xu et al. (2002) Weising & Gardner (1999), Chung & Staub (2003), Xu et al. (2002) ccmp3 Weising & Gardner (1999) 2 ccssr11 Chung & Staub (2003) 3 cp1 a In this work 4 cp2 b, cp3 c In this work 5 PCR conditions: 1: 5 min at 94 C; 35 cycles of 1 min at 94 C, 1 min at 50 C, 1 min at 72 C; 35 min at 72 C, 4 C. Ramping: 75%; 2: 5 min at 94 C; 20 cycles of 1 min at 94 C, 1 min at 45 C, 1 min at 72 C; 35 min at 72 C, 4 C. Touch down C with )1 C two cycles. Ramping: 75%; 3: 5 min at 94 C; 35 cycles of 1 min at 94 C, 1 min at 43 C, 1 min at 72 C; 35 min at 72 C, 4 C. Touch down C 1 C two cycles. Ramping: 75%; 4: 5 min at 94 C; 30 cycles of 30 s at 94 C, 30 s at 50 C, 30 s at 72 C; 35 min at 72 C, 4 C ; 5: 5 min at 94 C; 30 cycles of 30 s at 94 C, 30 s at 48 C, 30 s at 72 C; 35 min at 72 C, 4 C. a Primer pair sequences: Forward: CAAAATCAAAAGAGCGATTAGG; Reverse: GTCAAACCCATGAACGGACT. b Primer-pair sequences: Forward: TCTGTTTTGACCATATCGCACT; Reverse: GTCCATAAATAGATTCCCGAAAAA. c Primer-pair sequences: Forward: TCGGTGTAAATTGATAAAACGAAA; Reverse: TGCCTAGCAAAAGACTCTAAGAAAG. n.a.: primer pairs that give no or multiple amplification products. n.a. 1 used to study the genetic diversity in the domesticated common bean from central Italy (Sicard et al. 2005). Twenty were universal primer pairs designed by Chung & Staub (2003) (Table 2) that were tested on Pisum sativum and Phaseolus vulgaris. Three primer pairs published by these last authors were not used here because they did not amplify in Leguminosae species, as indicated in Chung & Staub (2003). Eight primer pairs were designed to detect the same microsatellite loci previously detected by the eight primer pairs of Weising & Gardner (1999) (Table 2), but with recognition of different annealing sites. We also included six primer pairs of Xu et al. (2002) that were specifically developed for analyses in soybean (Table 2). We redesigned a primer pair (that we named cp1) for a locus (Table 2) because, in our hands, those already available (ccmp1, Weising & Gardner 1999; ccssr1, Chung & Staub 2003) did not provide an intelligible PCR product in the set of Leguminosae analysed. Thus, sequences of P. vulgaris (accession number DQ450863), P. coccineus (accession number DQ445966) and N. tabacum (accession number Z00044) were obtained from the GenBank database ( and aligned using the ClustalW ver 1.74 program (Thompson et al. 1994). The original microsatellite (T) 10 was then detected and the new primer pair designed (Primer 3 v.0.4.0, on the flanking regions (positions of annealing 5 fi3 : ). Two primerpairs (cp2 and cp3) targeting two new loci were also developed. The P. vulgaris and P. coccineus sequences listed above were downloaded and aligned. For each locus, we identified a microsatellite and we designed a pair of primers flanking the microsatellite on the basis of the conserved regions between the two species (Table 2). Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands 601

5 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Analysis of chloroplast sequences from GenBank To determine whether the cpssr length variations seen were due to SSR variations or to other insertion deletion events within the region between the annealing sites, all of the cpssr loci were highlighted in the plastomes where they were first identified (N. tabacum for Weising & Gardner 1999; Chung & Staub 2003; G. max for Xu et al. 2002; P. vulgaris for the primer pairs designed in the present study). Each putative amplification product was blasted against the complete chloroplast genomes of Lotus japonicus (accession number: AP002983) (Kato et al. 2000), Medicago truncatula (AC093544), G. max (DQ317523) (Saski et al. 2005) and P. vulgaris (DQ886273) (Guo et al. 2007). DNA sequences were aligned using the ClustalW ver 1.74 program (Thompson et al. 1994). Weising & Gardner (1999) defined a microsatellite as a repeat of n 10, while Chung & Staub (2003) defined it as a repeat of n 7. To look for microsatellites within putative amplicons, we used both classifications. Insertion or deletion events (indels) were also identified. When available, we compared the observed electrophoretic data with the expected molecular weights based on the alignments. Finally, we detected the number of microsatellites present in the whole chloroplast sequence of P. vulgaris (Guo et al. 2007) using the Sputnik software (Abajian 1994; We then calculated the fraction of cpssrs included in the loci analysed. Data analysis For each locus, gene diversity (H) was calculated as for a haploid organism: H ¼ n n 1 1 Xk p 2 i i¼1 where p i is the frequency of the ith alleles and summation extends over n alleles (Nei 1978). This allowed for direct comparisons with the results of other studies (e.g. Bryan et al. 1999; Ishii & McCouch 2000; Ishii et al. 2001; Xu et al. 2002; Chung et al. 2003). Gene diversity (H) was estimated only considering one accession per genus, the whole sample, the entire Phaseolus genus sample, and within P. vulgaris and P. coccineus samples, separately. Principal component analysis (PCA; based on Euclidean distances and on the covariance matrix) was performed using the JMP ver. 7 software (SAS Institute Inc. 2007) to study and display the relationships among all of the genera and species analysed in this study. The analysis of the distribution of genetic differentiation among groups (Andean, Mesoamerican, wild and domesticated) within species (P. vulgaris and P. coccineus) was carried out using the amova option of the Arlequin v3.01 software package (Excoffier et al. 2005). The divergence! among populations was estimated as F ST and R ST, (corresponding to the infinite allele and the step-wise mutation models). The significance of the estimates was obtained through permutation tests, using 1000 permutations. Linkage disequilibrium (LD) values among cpssr loci (Hale et al. 2004; Wills & Burke 2006) were estimated in the overall sample, in the Phaseolus genus, in the P. vulgaris and P. coccineus pools, and within P. vulgaris and P. coccineus separately (excluding repeated multilocus genotypes). As a measure of multilocus LD, we calculated the statistic r d using MultiLocus ver. 1.2 software ( ac.uk/evolve/software/multilocus/). This statistic is similar to the index of multilocus association (I A ) (Brown et al. 1980), even if its expectation is largely independent of the number of polymorphic loci (Burt et al. 1999), allowing comparisons among different samples. The significance of r d was tested by shuffling alleles across individuals. RESULTS Amplification and diversity of cpssrs in legume species Of the 39 cpssr primer pairs tested across the eight genera of Papilionoideae, seven primer pairs (18%) (ccmp8, ccmp9, ccssr3, ccssr5, ccssr10, gmcp1, gmcp3) gave no amplification products, one (ccmp1) did not give a clear banding pattern (fancy bands), and two (5%) (SOYCP, RD19) gave multiple bands. Therefore, these 10 primer pairs were not considered in the subsequent analyses. Overall, 29 (74%) of the primer pairs produced a single and clear amplification product in all of the eight genera: two (5%; ccmp10 and ccssr6) of these were monomorphic, and 27 (69%) polymorphic (Supplementary Table S1) in Leguminosae. Considering a sample made up of only one accession per genus, the most polymorphic cpssr was ccssr4, which discriminated between all of the accessions (eight alleles detected and gene diversity H = 1.00), and the least polymorphic were ccssr14 and cp3, both of which detected only two alleles with H = The average number of alleles per locus was 5.41 ± 1.72, and the average H was 0.83 ± 0.20 (Table 3). Considering the whole sample of 66 accessions (Table 3), the most polymorphic primer remained ccssr4 as the number of alleles, but not as the gene diversity (ccssr 20; H = 0.92), and the least polymorphic was ccssr14 (two alleles detected and H = 0.24). In the same sample, we compared the number of alleles (n) and the gene diversity (H) between intergenic and intronic regions. We did not see any significant differences between these regions (n = 8.41, H = in intergenic, and n = 7.70 in H = 0.61, intronic; t test: P > 0.05). Analysis of the sequences from GenBank The alignments between putative amplicons of N. tabacum, M. truncatula, G. max, L. japonicus and P. vulgaris were obtained. They suggested that polymorphisms of the locus arise not only from differences in the number of 602 Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands

6 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Table 3. Diversity statistics for each locus analysed. all genera whole sample Phaseolus genus Phaseolus vulgaris Phaseolus coccineus locus sample size n a H sample size n a H sample size n a H sample size n a H sample size n a H ccmp ccmp ccmp ccmp ccmp ccmp ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr ccssr gmcp gmcp cp cp cp Mean ±1.72 ±0.20 ±3.62 ±0.25 ±3.26 ±0.34 ±1.81 ±0.34 ±1.5 ±0.30 The average number of alleles and the average H were obtained considering the 27 loci that are polymorphic in the whole sample. n a, number of alleles. H, genetic diversity on the whole sample, on the Phaseolus genus and on the Phaseolus vulgaris and Phaseolus coccineus samples. repeats of the microsatellite motif, but also (often) due to other insertion deletion events (indels). For example, Fig. 1 shows the alignment obtained for ccmp2 of Weising & Gardner (1999) corresponding to ccssr2 of Chung & Staub (2003). In addition to the originally targeted cpssr locus motif, other SSR sequences were also present (n 7: four in L. japonicus, three in M. trucatula, one in G. max and P. vulgaris). Moreover, such extra microsatellites are more often shared among closely related species (e.g. between P. vulgaris and G. max, instead of between P. vulgaris and N. tabacum). In some cases, microsatellites can be part of the annealing site of the primer, such as that in L. japonicus. The results for all of the loci are given in Table 4. Compared to N. tabacum, the highest number of conserved cpssrs is seen in M. truncatula (13 with n 7, and five with n 10), followed by P. vulgaris (13 with n 7, and four with n 10), L. japonicus (13 with n 7, and three with n 10) and G. max (12 with n 7, and three with n 10). In 22 (n 7) and ten (n 10) cases, the SSR motif was conserved in the legumes analysed. In five (n 7) and one cases (n 10), the cpssr motif was conserved in at least one legume species; in seven (n 7) and three cases (n 10) in at least two legume species; in eight (n 7) and in five cases (n 10) it was conserved among at least three species. Finally, the original microsatellite was once conserved across all of the species analysed. Moreover, occurrence of extra microsatellites was not rare (Table 5), as this was observed for all of the legume species considered: M. truncatula, G. max, L. japonicus and P. vulgaris. In 10 cases (ccmp5, ccmp6, ccmp10, ccssr8, ccssr14, ccssr15, ccssr17, ccssr21, ccssr22, gmcp2), no microsatellites (both original or extra ) were detected in the sequences between the primer pairs in P. vulgaris (Table 5). We detected the number of cpssrs in the plastome of P. vulgaris. We identified 10,133 cpssrs with n 3, and in particular, 419 sequences with n 7 and 58 with n 10 (with a maximum of 16 repeats). Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands 603

7 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Fig. 1. Alignment of the chloroplast sequences of Nicotiana tabacum and of four Leguminosae species. In bold, primer pairs (ccssr2) designed by Chung & Staub (2003); underlined, primer pairs (ccmp2) designed by Weising & Gardner (1999). Dark grey, original target based on N. tabacum sequence and the corresponding homologue region in the other legumes; light grey, other microsatellites (n 7) present within the putative amplification products. In P. vulgaris, the 19 loci targeted by the primer pair used in this study contained 31 (n 7) and five (n 10) microsatellites (Table 5). Therefore, the analysis of these loci summarises the variation of 7.16% (n 7) and 8.62% (n 10) of the cpssr loci of P. vulgaris. Moreover, these loci were well distributed across the plastome of P. vulgaris (data not shown). Supplementary Table S2 shows the genomic positions of the cpssr loci in N. tabacum and in the four legumes analysed, and their expected and the observed sizes. The length of the amplification fragments seen for M. truncatula, G. max and P. vulgaris were highly correlated with their expected sizes (R 2 = 0.985, P < ; R 2 = 0.953, P < ; and R 2 = 0.998, P < , respectively). Amplification and diversity of cpssrs in Phaseolus Eighteen of the primer pairs investigated were polymorphic within at least one species of the Phaseolus genus (ccmp2, ccmp3, ccmp4, ccssr2, ccssr4, ccssr7, ccssr8, ccssr9, ccssr11, ccssr12, ccssr15, ccssr16, ccssr18, ccssr19, ccssr20, cp1, cp2, cp3). Seventeen loci were polymorphic in P. vulgaris or P. coccineus. Among these, 16 were polymorphic in P. vulgaris and 16 in P. coccineus. No diagnostic markers were seen between these two species. When all five species of Phaseolus were considered, seven diagnostic markers were identified: three (ccmp2, ccssr2 and ccssr8) that separated P. acutifolius from the other species; one (ccmp4) that separated P. dumosus from the other species, and three (ccssr8, ccssr4 and cp3) that separated P. lunatus from the other species (Supplementary Table S1). The six primer pairs designed by Xu et al. (2002) were not useful for our sample: four of them gave no amplification products and two (gmcp2 and gmcp4) are monomorphic in the Phaseolus genus. The two new primer pairs (cp2, cp3) are both polymorphic within the Phaseolus genus. Within the Phaseolus genus, the most polymor- 604 Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands

8 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Table 4. Microsatellite motifs in N. tabacum and their conservation in the other legumes analyzed. Primer pairs Repeats in Nicotiana tabacum Medicago truncatula Identity % Glycine max Identity % Phaseolus vulgaris Identity % Lotus japonicus Identity % n. of n 7 n. of n 10 cp1* 60 (T) 8 80 (T) 10 (T) ccmp2 (A) 11 (A) (A) 9 82 (A) ccmp3 (T) 11 (T) (T) ccmp4 (T) 13 (T) (T) 8 92 (T) ccmp5 (C) 7 (T) 10 ; (T) 10 ;(A) (T) 10 ;(A) (T) 5 C(A) 11 ccmp6 (T) 5 C(T) 17 (T) (T) ccmp7 (A) (A) ccmp10 (T) (T) ccssr2 (A) 11 (A) (A) 9 82 (A) ccssr4 (T) ccssr6 (T) 8 (T) (T) (T) ccssr7 (T) 11 (T) ccssr8 (T) 5 C(T) 17 (T) (T) ccssr9 (A) 13 (A) (A) 7 77 (A) ccssr11 (T) 6 C(T) 14 (T) 9 43 (T) 9 81 (T) 7 71 (T) ccssr12 (A) ccssr14 (T) (T) ccssr15 (T) ccssr16 (T) 7 C(T) 2 60 (T) 7 70 (T) 7 70 (T) ccssr17 (A) ccssr18 (A) (A) (A) ccssr19 (T) ccssr20 (A) 8 (A) 7 75 (A) 7 75 (A) (A) ccssr21 (T) ccssr22 (T) gmcp2 50 (A) gmcp4 (A) (A) (A) cp2* 87 (T) 7 87 (T) cp3* 50 (A) 7 75 (A) n n *primer pairs designed in Phaseolus vulgaris; primer pairs designed in Glycine max. - = not detected. The identity for the microsatellites not detected was obtained according to the Blast alignment. phic locus was ccssr20, with 12 alleles detected and H = 0.90, and the least polymorphic was ccmp4, with two alleles and H = The average number of alleles was 4.18 ± 3.26 and the average H was 0.42 ± 0.34 (Table 3). Within P. vulgaris, the most polymorphic primer pair was ccssr11, which detected eight alleles with H = The least polymorphic loci were ccmp3, ccssr12, ccssr19 and cp3, with two alleles detected and gene diversity of 0.52, 0.54, 0.43 and 0.08, respectively. The average number of alleles was 2.70 ± 1.81 and the average H was 0.31 ± 0.34 (Table 3). Within P. coccineus, the most polymorphic loci were ccssr11 and ccssr20, with six alleles each and H = 0.85 and H = 0.81, respectively, while those with the lowest polymorphism levels were ccssr8, ccssr16, ccssr19 and cp2, with two alleles each and H = 0.48, H = 0.52, H = 0.11 and H = 0.11, respectively. The average number of alleles was 2.37 ± 1.50 and the average H was 0.30 ± 0.30 (Table 3). Within the Phaseolus genus, by combining the variants for 18 cpssr loci, we obtained 56 haplotypes from 59 individuals. We saw one haplotype repeated four times only in P. coccineus (data not shown). We calculated the [(haplotype individual) marker] ratio to be able to compare the power of our set of markers with respect to previous studies that have used the same kinds of markers. In our sample, this ratio was Relationships among the legume taxa analysed Relationships among the eight legume species were investigated by principal component analysis (PCA) using all of the 27 cpssr polymorphic markers, and considering one accession per species. In Fig. 2 (plot A), Phaseolus is closer to Vigna and Glycine, while it is quite divergent Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands 605

9 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa primer pair Medicago truncatula Glycine max Lotus japonicus Phaseolus vulgaris Table 5. Other microsatellites (n 7) within each putative amplicon that are different from the original target in Nicotiana tabacum. cp1 (A) 10 no (A) 8 (T) 7 ;(T) 8 ccmp2 (T) 7 ;(A) 8 ;(A) 10 (A) 9 (T) 9 ;(A) 9 ; (T) 7 ;(A) 7 ;(A) 8 ;(A) 10 (A) 7 ;(A) 9 ccmp3 no (T) 7 (T) 7 (A) 8 ;(T) 9 ccmp4 no no no (T) 7 ccmp5 no no no no ccmp6 no (A) 7 ;(T) 8 ;(T) 7 no no ccmp7 (A) 10 (A) 12 (A) 7 ;(G) 10 (T) 8 ccmp10 no no no no ccssr2 (T) 7 ;(A) 8 ;(A) 10 (A) 9 (T) 9 ;(A) 9 ;(T) 7 ;(A) 7 ;(A) 8 (A) 7 ;(A) 9 ccssr4 no (T) 18 ;(T) 7 (T) 8 (T) 7 ccssr6 (T) 8 (T) 8 (T) 8 (T) 8 ;(T) 10 ccssr7 no (A) 10 (A) 10 (T) 8 ;(A) 8 ccssr8 no (A) 7 ;(T) 8 ;(T) 7 no no ccssr9 (T) 10 ;(T) 7 no (T) 9 (T) 8 ;(T) 9 ;(A) 8 ccssr11 no no (A) 8 (A) 12 ;(T) 7 ccssr12 no (A) 7 ;(T) 7 (T) 9 (T) 9 ;(C) 9 ccssr14 no no no no ccssr15 no (T) 7 no no ccssr16 no (T) 7 no (T) 7 ;(G) 10 ccssr17 no no (T) 10 no ccssr18 no no no (A) 15 ccssr19 no no no (T) 9 ccssr20 (A) 8 ;(T) 7 (A) 7 (T) 9 (A) 13 ;(A) 8 ccssr21 no no (A) 10 no ccssr22 no no no no gmcp2 no (A) 7 (A) 7 no gmcp4 (A) 9 (A) 7 no (T) 8 cp2 no no no (T) 8 cp3 no (A) 7 ; (T) 7 (T) 7 (A) 8 ;(A) 7 In bold: microsatellites shared between P. vulgaris and N. tabacum. from both Lupinus and Pisum. PCA was also performed within the Phaseolus genus using all of the 18 cpssr polymorphic markers. The first principal component (PC1) explains 44.06% of the total molecular variance, the second (PC2), 24.79% (Fig. 2, plot B). In Fig. 2 (plot B), the five species belonging to the Phaseolus genus are well separated from each other, and the four individuals of P. dumosus appeared to be closer to P. vulgaris than to any of the other species. PC1 mainly separated P. coccineus from the rest, and PC2 separated P. lunatus from all of the other individuals (Fig. 2, plot B). PC3 (which accounts for 8.83% of the total molecular variance) mainly identified variations within species: one pattern is the subdivision between the wild and domesticated forms within P. coccineus, and the second is between two groups of P. lunatus (not shown). When we focus on P. vulgaris accessions, PC1 (43.95%) splits the individuals into two clusters: one includes all of the Mesoamerican accessions, together with the three ancestral accessions, while the second cluster includes all of the Andean accessions (Fig. 2, plot C). Finally, PCA showed the main separation on the first PCA (which explained about 51% of the total molecular variance) between two clusters (see Fig. 2, plot D): Cluster A and Cluster B. Both clusters were formed by wild and domesticated genotypes, but while Cluster A did not show any subsequent internal structure, Cluster B showed a clear distinction on the second PCA (which explained about 32% of the total molecular variance) between domesticated (Cluster B1) and wild (Cluster B2) genotypes. With consideration of two (A and B) or three (A, B1 and B2) groups, no differences were seen for geographic origin or seed morphology, even when wild and domesticated accessions were considered separately (data not shown). Differentiation between P. vulgaris and P. coccineus was always strong and highly significant (Table 6). Within the P. vulgaris pair-wise population comparisons, the highest differentiation value is between the Andean wild and Mesoamerican domesticated individuals for F ST, and between the Andean and Mesoamerican domesticated individuals for R ST (both significant) (Table 6). The lowest differentiation estimates (often not significant) were seen in comparisons between forms within each gene pool. The levels of linkage disequilibrium among the microsatellite loci were always highly significant in the overall 606 Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands

10 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa A B C D Fig. 2. Principal component analysis (PCA) of (A) Leguminosae species; (B) Phaseolus species; (C) P. vulgaris accessions; and (D) P. coccineus accessions. In plot B, P. vulgaris domesticated ( ), ancestral ( ) and wild ( ) accessions are indicated. P. lunatus ( ); P. acutifolius ( ); P. dumosus ( ). In plot C, P. vulgaris Mesoamerican (light colour), Andean (dark colour), wild (circles), domesticated (squares) and ancestral (triangles) accessions are indicated. In plots B and D, P. coccineus domesticated ( ) and wild ( ) accessions are indicated. See Table 1 for corresponding accession codes names. samples (r d = 0.23, P < 0.001), in the Phaseolus genus (r d = 0.08, P < 0.001), in the P. vulgaris and P. coccineus pool (r d = 0.09, P < 0.001), and within P. vulgaris (r d = 0.05, P < 0.001) and P. coccineus (r d = 0.19, P < 0.001) separately. DISCUSSION In the present study, we have shown that among the 39 cpssr primer pairs investigated, 27 can detect variations in the lengths of the sequences within the Leguminosae (Papilionoideae subfamily). This rate of success is similar to that obtained by Bryan et al. (1999) in the Solanaceae family, where there were 26 polymorphic loci out of 36 primer pairs examined, and to that of Wills et al. (2005) in Compositae (30 polymorphic loci out of 36 primer pairs tested). Eighteen primer pairs were polymorphic within the Phaseolus genus and 16 can detect polymorphisms in P. vulgaris and P. coccineus. Levels of polymorphism Overall, our results are in agreement with those of other studies. Within the five species of the Phaseolus genus we Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands 607

11 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa Table 6. Genetic differentiation (F ST and R ST ) in Phaseolus vulgaris (Pv) and Phaseolus coccineus (Pc). F ST \R ST PvAW PvMW PvAD PvMD PcW PcD PvAW 0.52** ) ** 0.87*** 0.86*** PvMW 0.28** 0.53** *** 0.82*** PvAD * 0.60** 0.89*** 0.87*** PvMD 0.32* 0.26** 0.25* 0.86*** 0.86*** PcW 0.54*** 0.44*** 0.51*** 0.50*** 0.17* PcD 0.42*** 0.38*** 0.39*** 0.35*** 0.16* A, Andean; M, Mesoamerican; W, wild; D, domesticated. Below and above the diagonal, values in the distance matrices represent F ST and R ST, respectively. Ancestral individuals were excluded from the analyses because only three individuals were available. Significance values were obtained by 10,000 permutations. ***P 0.001; **P 0.01, *P found average n a = 5.8 and H = 0.60 per locus (when only polymorphic markers were considered), and n a = 4.2 and H = 0.42 when all of the markers were considered. This is higher than the values that were seen in a large set of Solanaceae species (Bryan et al. 1999) and in a set of Oryza spp. (Ishii & McCouch 2000), and is similar to the values obtained in an array of domesticated and wild Triticum and Aegilops species (Ishii et al. 2001), and in the Solanum brevicaule complex (Sukhotu et al. 2006). Moreover, these levels are lower than those seen in soybean, for the number of alleles rather than for gene diversity (Xu et al. 2002). It has been suggested that variations in the lengths of introns can affect splicing activity, and therefore, would tend to be suppressed in the chloroplast genome (Ishii & McCouch 2000). However, we did not see any significant genetic diversity (H and n) between intergenic regions and intronic regions. This is also consistent with the data calculated in the present study using the data reported in Table 2 of Bryan et al. (1999) for the Solanum genus. The [(haplotype individual) marker] ratio obtained in the present study (0.053) is lower than that obtained in Oryza (0.122; Provan et al. 1997), but higher than that reported in Solanum spp. (0.038; Bryan et al. 1999), Helianthus annuus (0.035; Wills & Burke 2006), Glycine (0.035; Xu et al. 2002), and Triticum and Aegilops (0.026; Ishii et al. 2001). Studies of cpssrs have often revealed higher levels of diversity than for chloroplast RFLPs (Abe et al. 1999; Provan et al. 2001; Xu et al. 2002; Sukhotu et al. 2006). Recently, this technique has also been used to analyse the chloroplast molecular diversity in P. vulgaris in Mesoamerican and Andean wild and domesticated genotypes (Chacón et al. 2005, 2007). Among 322 accessions of domesticated landraces, weedy and wild beans, Chacón et al. (2005) found only 14 chloroplast haplotypes through investigation of 10 non-coding chloroplast regions that were digested with several restriction enzymes. In contrast, we saw that all the 53 P. vulgaris individuals could be discriminated using 16 cpssrs. Moreover, our survey of cpssr frequencies in the chloroplast of P. vulgaris has revealed that the primer pairs used can identify regions containing 8.62% of the total plastidial microsatellite (n 10) and the cpssrs used in the present study are well distributed across the bean plastome. This indicates that our set of cpssrs could well represent the microsatellite diversity of the P. vulgaris genome. Origin of the polymorphism Our sequence analysis has revealed that most of the cpssr motifs that have been previously identified in the tobacco chloroplast genome are not conserved in the corresponding regions of four legumes species (G. max, M. truncatula, L. japonicus and P. vulgaris), for which the chloroplast genomes have been completely sequenced (Kato et al. 2000; Saski et al. 2005; Guo et al. 2007). This is mainly due to base substitutions within a microsatellite, resulting in interrupted microsatellites or in the loss of the microsatellites. This suggests that the polymorphisms identified in the pool of 66 accessions cannot be directly related to the expansion contraction of the previously considered tobacco SSR motif. This parallels the data of Weising & Gardner (1999). Differences are also present between the four legume species. However, in relation to the sequence alignments, we observed several indels in the microsatellite flanking sequences that might determine large differences in allele sizes unrelated to the repeat numbers. We found that more than one microsatellite could often be present within an amplicon. Backward and forward mutations of multiple microsatellites will cause homoplasy. Similar observations have also been discussed for other systems in other studies (Bryan et al. 1999; Weising & Gardner 1999; Ishii & McCouch 2000; Chung et al. 2003; Hale et al. 2004; Nanni et al. 2004). Linkage disequilibrium To investigate whether homoplasy is likely to be relevant for cpssrs in Phaseolus, we examined the linkage disequilibrium (LD) among the microsatellite loci, as proposed by Hale et al. (2004). The multilocus LD was estimated in the overall sample, in the Phaseolus genus, in the P. vulgaris and P. coccineus pools, and within P. vulgaris and P. coccineus separately. In all of these samples, the multilocus LD was significant. This is what we would expect if the loci are on a non-recombining genome and if alleles of the same size tend to be identical by descent. Our results are similar to those of Wills & Burke (2006) for wild and domesticated Helianthus annuus, but they are different from those of Hale et al. (2004) on the Clusia genus, where the level of homoplasy was considered too high (low LD) to allow reliable phylogenetic studies. A greater number of loci that span different regions of the genome (as in the case of the loci analysed in the present study) would give a higher possibility of distinguishing haplotypes with homoplastic alleles at a given cpssr 608 Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands

12 Angioi, Desiderio, Rau, Bitocchi, Attene & Papa locus through the polymorphism of linked loci (Bryan et al. 1999; Navascuès & Emerson 2005). Potential use of cpssrs to study genetic diversity in Phaseolus spp. Overall, we have seen that our set of molecular markers can discriminate among the genera analysed, and among and within the species of the Phaseolus genus. Moreover, our data are, in general, in agreement with previously published studies. For instance, the close relationship between P. dumosus and P. vulgaris is in agreement with the hypothesis that P. dumosus originated from a cross that involved P. vulgaris as the maternal parent, with successive backcrosses from P. coccineus as the paternal donor (Schmit et al. 1993; Llaca et al. 1994). This suggestion was developed from the observation that, at the molecular level, P. dumosus is closer to P. coccineus by nuclear DNA comparison (Piñero & Eguiarte 1988; Delgado-Salinas et al. 1999) but more similar to P. vulgaris by chloroplast DNA comparison (Llaca et al. 1994). Within Phaseolus vulgaris, the cpssrs identified the occurrence of two major gene pools This result was previously described using morphological traits (Evans 1976) and biochemical markers (Gepts & Bliss 1986), and were confirmed later with various molecular approaches. As has been previously established, this indicates the occurrence of at least two independent domestication events, one in Mesoamerica and a second in the Andes (see Papa et al. 2006; Acosta-Gallegos et al for a review). Finally, within Phaseolus coccineus we observed the occurrence of two different wild genetic groups, suggesting the presence of two wild P. coccineus subspecies. The separation seen in the wild paralleled the differentiation between two groups of domesticated accessions, suggesting the occurrence of multiple domestication of P. coccineus in Mesoamerica. However, while for the first genetic group (Cluster A), wild and domesticated accessions were indistinct for cpssrs, a clear separation was seen for the second genetic group (Cluster B). Nevertheless, a much wider sampling is needed to validate our observations that are based on a very small sample of genotypes, and to obtain a better representation of the population structure of P. coccineus in its area of distribution. CONCLUSIONS The molecular markers identified in the present study can discriminate between the five domesticated species belonging to the Phaseolus complex, between the wild and domesticated forms of P. coccineus, and also between the two domesticated gene pools of P. vulgaris. Thus, while a certain degree of homoplasy is probably present in our dataset, our results suggest that the highly informative chloroplast primer pairs we have used (that were already available in the literature or that we developed de novo) are a valuable tool to depict the relationships between maternal lineages within the Phaseolus complex and in P. vulgaris and P. coccineus. They should also be useful, for the identification of interspecific and intraspecific hybridisation events, for the study of the domestication of P. vulgaris in America and its expansion into Europe, and for the better classification and management of the Phaseolus genetic resources. Finally, our data suggest the occurrence of different subspecies and of multiple domestication events in P. coccineus. SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Table S1. Size (bp) of the amplification products for each of the 27 suitable primer pairs and for each taxon considered. Table S2. Primer pair positions and expected and observed sizes of amplicons in N. tabacum and in the other four legumes analysed. The ranges and most frequent alleles in P. vulgaris (in parentheses) are also shown. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article. ACKNOWLEDGEMENTS This study was supported by the Italian Government (MIUR), grant no. # , Project PRIN 2005 and constituted part of the PhD theses of SA Angioi and F Desiderio. We thank S Camiolo for support in the data analysis. REFERENCES Abajian C. (1994) Available from pages/sputnik.jsp Abe J., Hasegawa A., Fukushi H., Mikami T., Ohara M., Shimamoto Y. (1999) Introgression between wild and cultivated soybeans of Japan revealed by RFLP analysis for chloroplast DNAs. Economic Botany, 53, Acosta-Gallegos J.A., Kelly J.D., Gepts P. (2007) Prebreeding in common bean and use of genetic diversity from wild germplasm. Crop Science, 47(S3), S44 S59. Arroyo-García R., Lefort F., de Andrés M.T., Ibáñez J., Borrego J., Jouve N., Cabello F., Martínez-Zapater J.M. (2002) Chloroplast microsatellite polymorphisms in Vitis species. Genome, 45, Arroyo-García R., Ruiz-García L., Bolling L., Ocete R., López M.A., Arnold C., Ergul A., Söylemezoolu G., Uzun H.I., Cabello F., Ibáñez J., Aradhya M.K., Atanassov A., Atanassov I., Balint S., Cenis J.L., Costantini L., Gorislavets S., Grando M.S., Klein B.Y., McGovern P.E., Merdinoglu D., Pejic I., Pelsy F., Primirikos N., Rissovannaya V., Roubelakis-Angelakis K.A., Snoussi H., Sotiri P., Tamhankar S., This P., Plant Biology 11 (2009) ª 2008 German Botanical Society and The Royal Botanical Society of the Netherlands 609