Conservation Genetics. Outline
|
|
- Ann Franklin
- 5 years ago
- Views:
Transcription
1 Conservation Genetics The basis for an evolutionary conservation Outline Introduction to conservation genetics Genetic diversity and measurement Genetic consequences of small population size and extinction. Defining conservation and management units based on population genetics. 1
2 Biodiversity IUCN (Int. Union for Conservation of Nature) 3 fundamental levels: Ecosystem Species Genetic Genes Population genetics: Why bother? Key contribution: focus on evolutionary potential of populations and species Conservation Genetics (Frankham et al. 2002) Conservation genetics is the application of genetics to preserve species as dynamic entities capable of coping with environmental change. Conservation genetics has been driven by what many consider to be a global environmental crisis: the sixth extinction Very young science: First journal in 2000 First textbook in
3 Practices in Conservation genetics Genetic management of small populations. Identifying and defining units of conservation within and between species. Use of genetic information for wildlife forensics. Evolutionary genetics Taxonomic uncertainties Understanding species biology Forensics Conservation Genetics Small populations Introgression Population structure & fragmentation Outbreeding Inbreeding Loss of genetic diversity Mutational accumulation Reproductive fitness Genetic management Identify mgmt units Wild Captive Extinction Adaptation to captivity Reintroduction 3
4 Evolutionary Change Genetic drift Mutation Most mutations are recessive. Here the mutation is dominant Migration/gene flow Natural selection Genetic Diversity Required for populations to adapt to environmental change (long term). Assessed using molecular or quantitative methods. Large, outbreeding populations generally have a lot of diversity Small populations risk losing diversity 4
5 10/14/09 Why is genetic variation important? variation global warming survival EXTINCTION!! no variation NJ tree for COI DNA barcodes of the six species of Perichares reared in the conservation area of Guanacaste, Costa Rica. Burns J M et al. PNAS 2008;105:
6 Many different markers: mtdna sequences *** chloroplast DNA sequences * nuclear DNA sequences * Microsatellites *** Minisatellites * AFLP (amplified fragment length polymorphisms) * RAPD (random amplified polymorphic DNA) * Marker chosen depends on the question to be answered. Measures of Genetic Diversity Terms Locus = portion of DNA (plural = loci) Allele = form that a locus can take Subjective depending on resolution of measurement Nucleotide state difference (sequencing) AGGCGTTCGCTTATGATAA AGGCGTACGCTTATGATAA Length difference (microsatellite) AGGCGTTCACACACACACGCTTATGATAA AGGCGTTCACACACACACACGCTTATGATAA 6
7 DNA sequences Co-dominant Ultimate level of resolution Neutral or functional variation Population-level to deep phylogeny Origins of sequence data Nuclear DNA (nucdna) Chromosomes Diploid Sex chromosomes Haploid genomes Mitochondrial DNA (mtdna) Animals (relatively fast mutation rates) Plants (relatively slow mutation rates) Chloroplast DNA Maternally inherited in angiosperms Paternally inherited in most gymnosperms 7
8 Nature of mutation 4 nucleotides A & G = purines [R] T & C = pyrimidines [Y] In dsdna, R always bonds with Y A bonds with T, G bonds with C in double-stranded DNA R for R or Y for Y = transition [ts] R for Y or Y for R = transversion [tv] Ts much more common than tv R A G Y T C 5 ATGCATGC 3 3 TACGTACG 5 8
9 Measures of diversity Number of segregating sites (S) Total number of sites that are polymorphic Nucleotide diversity (π) Mean number of nucleotide differences per site between 2 sequences DNA Sequence Evolution AAGATTT AAGACTT AGGACTT -3O,OOO yrs -20,000 yrs AAGGTTT AAGATTC AGGACTC -10,000 yrs AAAGTTT GAGATTC AGGATTC AGGATTC AGGGCTC today 9
10 Microsatellites Highly repetitive DNA One repeat unit (2-4 nucleotides) repeated multiple times within a sequence Alleles defined by length differences Synonyms: Short tandem repeats (STRs) Simple sequence repeats (SSRs) Mechanisms of mutation (slipped-strand mispairing) Step 1 ca ca ca ca gt gt gt gt gt gt gt Step 2 Step 3 ca ca ca ca gt gt gt gt gt gt gt Step 4 ca ca ca ca ca ca gt gt gt gt gt gt gt 10
11 Allelic Variation at a Microsatellite Locus GCCATGACACACACAGTAACGT Allele A Allele B GCCATGACACACACACACACACACAGTAACGT S Direction of travel M F 11
12 10/14/09 Dispersal / structure Parentage / mating systems Source of invasions / colonisation routes Level of diversity Hybridisation / introgression Impact of habitat change 12
13 Measures of diversity using microsat s Diploid genomes Allelic diversity (A) Mean number of alleles per locus Heterozygosity (H) Sum of proportions of heterozygotes at all loci divided by number of loci ( ) / 5 = 0.14 Percent loci polymorphic (P) Percent of loci with >1 allele Ahonen et al Molecular Ecology, (999) Nuclear and mitochondrial DNA reveals isolation of imperilled grey nurse shark populations (Carcharias taurus) Fig. 1 (a) The geographic distribution of the grey nurse shark is shown, pie charts are distribution and frequencies of mtdna haplotypes. (b) Haplotype network for mtdna control region. 13
14 Fig. 3 A maximum parsimony tree constructed using sequence data from the mitochondrial control region. Fig. 2 Stronger differentiation between regions in the northern and southern hemisphere is illustrated with this UPMGA tree generated with Nei's D A genetic distance measure and 5000 bootstraps across six microsatellite loci. 14
15 10/14/09 Conservation implications for grey nurse sharks Populations are genetically discrete entities in different parts of the world. Exchange among populations is low and genetic divergence high. Each population should be regarded as evolutionary significant units (Waples 1991). In contrast to pelagic species, grey nurse shark needs to be managed regionally. Outline Introduction to conservation genetics Genetic diversity and measurement NEXT THURSDAY: Genetic consequences of small population size and extinction. Defining conservation and management units based on population genetics. 15
Applications of Genetics to Conservation Biology
Applications of Genetics to Conservation Biology Molecular Taxonomy Populations, Gene Flow, Phylogeography Relatedness - Kinship, Paternity, Individual ID Conservation Biology Population biology Physiology
More informationMajor questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
More informationMolecular Markers, Natural History, and Evolution
Molecular Markers, Natural History, and Evolution Second Edition JOHN C. AVISE University of Georgia Sinauer Associates, Inc. Publishers Sunderland, Massachusetts Contents PART I Background CHAPTER 1:
More informationCONSERVATION AND THE GENETICS OF POPULATIONS
CONSERVATION AND THE GENETICS OF POPULATIONS FredW.Allendorf University of Montana and Victoria University of Wellington and Gordon Luikart Universite Joseph Fourier, CNRS and University of Montana With
More informationLecture 14 Chapter 11 Biology 5865 Conservation Biology. Problems of Small Populations Population Viability Analysis
Lecture 14 Chapter 11 Biology 5865 Conservation Biology Problems of Small Populations Population Viability Analysis Minimum Viable Population (MVP) Schaffer (1981) MVP- A minimum viable population for
More informationWhat is conservation genetics? Conservation Genetics. Are genetics important in conservation? Inbreeding and loss of genetic diversity
What is conservation genetics? B242 Evolutionary Genetics Conservation Genetics Kanchon Dasmahapatra Conservation genetics is the application of genetics to preserve species as dynamic entities capable
More informationMicrosatellite data analysis. Tomáš Fér & Filip Kolář
Microsatellite data analysis Tomáš Fér & Filip Kolář Multilocus data dominant heterozygotes and homozygotes cannot be distinguished binary biallelic data (fragments) presence (dominant allele/heterozygote)
More informationLevels of genetic variation for a single gene, multiple genes or an entire genome
From previous lectures: binomial and multinomial probabilities Hardy-Weinberg equilibrium and testing HW proportions (statistical tests) estimation of genotype & allele frequencies within population maximum
More informationLife Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationUNIT 8 BIOLOGY: Meiosis and Heredity Page 148
UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 CP: CHAPTER 6, Sections 1-6; CHAPTER 7, Sections 1-4; HN: CHAPTER 11, Section 1-5 Standard B-4: The student will demonstrate an understanding of the molecular
More informationModule Contact: Dr Doug Yu, BIO Copyright of the University of East Anglia Version 1
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-2015 EVOLUTIONARY BIOLOGY & CONSERVATION GENETICS BIO-3C24 Time allowed: 3 hours Answer ALL questions in Section
More informationWHAT IS BIOLOGICAL DIVERSITY?
WHAT IS BIOLOGICAL DIVERSITY? Biological diversity or biodiversity is the variety of life - the wealth of life forms found on earth. 9 WHAT IS BIOLOGICAL DIVERSITY? Wilcox s (1984) definition: Biological
More informationEffective population size and patterns of molecular evolution and variation
FunDamental concepts in genetics Effective population size and patterns of molecular evolution and variation Brian Charlesworth Abstract The effective size of a population,, determines the rate of change
More informationQ Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2.
NCEA Level 2 Biology (91157) 2018 page 1 of 6 Assessment Schedule 2018 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Q Expected Coverage Achievement Merit Excellence
More informationAnswers to Problems. Amino acids met lys pro stop (note that the code is read from mrna)
Answers to Problems Chapter 1 1.1 ¼ A 1 A 1 : ½ A 1 A 2 : ¼ A 2 A 2. 1.2 1/16 A 1 A 1 B 1 B 1: 1/8 A 1 A 1 B 1 B 2 : 1/16 A 1 A 1 B 2 B 2 : 1/8 A 1 A 2 B 1 B 1 : ¼ A 1 A 2 B 1 B 2 : 1/8 A 1 A 2 B 2 B 2
More informationPhylogeography and genetic differentiation between Loxigilla noctis and L. barbadensis in the Lesser Antilles
Phylogeography and genetic differentiation between Loxigilla noctis and L. barbadensis in the Lesser Antilles Sophie Arnaud-Haond 1, Carla Daniel 2, Sébastien Motreuil 3, Julia Horrocks 2 & Frank Cézilly
More informationChapter 5 Evolution of Biodiversity. Sunday, October 1, 17
Chapter 5 Evolution of Biodiversity CHAPTER INTRO: The Dung of the Devil Read and Answer Questions Provided Module 14 The Biodiversity of Earth After reading this module you should be able to understand
More informationAEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity,
AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, Today: Review Probability in Populatin Genetics Review basic statistics Population Definition
More informationBig Idea #1: The process of evolution drives the diversity and unity of life
BIG IDEA! Big Idea #1: The process of evolution drives the diversity and unity of life Key Terms for this section: emigration phenotype adaptation evolution phylogenetic tree adaptive radiation fertility
More informationName Period. 3. How many rounds of DNA replication and cell division occur during meiosis?
Name Period GENERAL BIOLOGY Second Semester Study Guide Chapters 3, 4, 5, 6, 11, 14, 16, 17, 18 and 19. SEXUAL REPRODUCTION AND MEIOSIS 1. What is the purpose of meiosis? 2. Distinguish between diploid
More informationChapter 5 Evolution of Biodiversity
Chapter 5 Evolution of Biodiversity Earth is home to a tremendous diversity of species diversity- the variety of ecosystems within a given region. diversity- the variety of species in a given ecosystem.
More informationOCR (A) Biology A-level
OCR (A) Biology A-level Topic 4.2: Biodiversity Notes Biodiversity is the variety of living organisms, over time the variety of life on Earth has become more extensive but now it is being threatened by
More informationEVOLUTION ALGEBRA Hartl-Clark and Ayala-Kiger
EVOLUTION ALGEBRA Hartl-Clark and Ayala-Kiger Freshman Seminar University of California, Irvine Bernard Russo University of California, Irvine Winter 2015 Bernard Russo (UCI) EVOLUTION ALGEBRA 1 / 10 Hartl
More informationPLANT VARIATION AND EVOLUTION
PLANT VARIATION AND EVOLUTION D. BRIGGS Department of Plant Sciences, University of Cambridge S. M. WALTERS Former Director of the University Botanic Garden, Cambridge 3rd EDITION CAMBRIDGE UNIVERSITY
More informationGENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF EVOLUTION Evolution is a process through which variation in individuals makes it more likely for them to survive and reproduce There are principles to the theory
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationSpecies Identification and Barcoding. Brendan Reid Wildlife Conservation Genetics February 9th, 2010
Species Identification and Barcoding Brendan Reid Wildlife Conservation Genetics February 9th, 2010 Why do we need a genetic method of species identification? Black-knobbed Map Turtle (Graptemys nigrinoda)
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationModule Contact: Dr Doug Yu, BIO Copyright of the University of East Anglia Version 1
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 EVOLUTIONARY BIOLOGY AND CONSERVATION GENETICS BIO-3C24 Time allowed: 3 hours Answer ALL questions in Section
More informationPopulation Structure
Ch 4: Population Subdivision Population Structure v most natural populations exist across a landscape (or seascape) that is more or less divided into areas of suitable habitat v to the extent that populations
More informationoverproduction variation adaptation Natural Selection speciation adaptation Natural Selection speciation
Evolution Evolution Chapters 22-25 Changes in populations, species, or groups of species. Variances of the frequency of heritable traits that appear from one generation to the next. 2 Areas of Evolutionary
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationEvolutionary Significant Units (ESUs) & Management Units (MUs)
Evolutionary Significant Units (ESUs) & Management Units (MUs) Diversity is Diverse and Complex Defining Management Units Within Species Genetic Distinctiveness & ESU s definition Measuring & Managing
More informationName Period. 2. Name the 3 parts of interphase AND briefly explain what happens in each:
Name Period GENERAL BIOLOGY Second Semester Study Guide Chapters 3, 4, 5, 6, 11, 10, 13, 14, 15, 16, and 17. SEXUAL REPRODUCTION AND MEIOSIS 1. The cell cycle consists of a growth stage and a division
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationFor a species to survive, it must REPRODUCE! Ch 13 NOTES Meiosis. Genetics Terminology: Homologous chromosomes
For a species to survive, it must REPRODUCE! Ch 13 NOTES Meiosis Genetics Terminology: Autosomes Somatic cell Gamete Karyotype Homologous chromosomes Meiosis Sex chromosomes Diploid Haploid Zygote Synapsis
More informationSTABILIZING SELECTION ON HUMAN BIRTH WEIGHT
STABILIZING SELECTION ON HUMAN BIRTH WEIGHT See Box 8.2 Mapping the Fitness Landscape in Z&E FROM: Cavalli-Sforza & Bodmer 1971 STABILIZING SELECTION ON THE GALL FLY, Eurosta solidaginis GALL DIAMETER
More informationGenetic Variation in Finite Populations
Genetic Variation in Finite Populations The amount of genetic variation found in a population is influenced by two opposing forces: mutation and genetic drift. 1 Mutation tends to increase variation. 2
More informationQuiz Section 4 Molecular analysis of inheritance: An amphibian puzzle
Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will
More informationSexual Reproduction and Genetics
Sexual Reproduction and Genetics Mitosis is a form of asexual reproduction This means that it only requires 1 organism (ex. Skin cells dividing) For growth and repair in somatic (body) cells! Results
More informationLecture Notes: BIOL2007 Molecular Evolution
Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits
More informationBIODIVERSITY: STRUCTURE AND FUNCTION Vol. I - Evolutionary and Genetic Aspects of Biodiversity - J.A.C. Uy, G. Theißen
EVOLUTIONARY AND GENETIC ASPECTS OF BIODIVERSITY J.A.C. Uy Department of Biology, Syracuse University, USA G. Department of Genetics, Friedrich Schiller University of Jena, Germany Keywords: adaptation,
More informationHow robust are the predictions of the W-F Model?
How robust are the predictions of the W-F Model? As simplistic as the Wright-Fisher model may be, it accurately describes the behavior of many other models incorporating additional complexity. Many population
More informationReproduction and Evolution Practice Exam
Reproduction and Evolution Practice Exam Topics: Genetic concepts from the lecture notes including; o Mitosis and Meiosis, Homologous Chromosomes, Haploid vs Diploid cells Reproductive Strategies Heaviest
More informationProblems for 3505 (2011)
Problems for 505 (2011) 1. In the simplex of genotype distributions x + y + z = 1, for two alleles, the Hardy- Weinberg distributions x = p 2, y = 2pq, z = q 2 (p + q = 1) are characterized by y 2 = 4xz.
More informationHomework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:
Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships
More informationGenetic adaptation to captivity in species conservation programs
Genetic adaptation to captivity in species conservation programs R. Frankham Macquarie University & Australian Museum, Sydney, Australia Why captive breed? 4-6K species of terrestrial vertebrates cannot
More informationGenetic diversity of beech in Greece
Genetic diversity of beech in Greece A.C. Papageorgiou (1), I. Tsiripidis (2), S. Hatziskakis (1) Democritus University of Thrace Forest Genetics Laboratory Orestiada, Greece (2) Aristotle University of
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationWest Windsor-Plainsboro Regional School District AP Biology Grades 11-12
West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels
More informationGenetic Structure and Diversity of the Medano- Zapata Bison Herd using Microsatellite Data
University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Fall 2018 Genetic Structure and Diversity of the Medano- Zapata Bison Herd using Microsatellite Data Torrey E. Davis
More informationThe Mechanisms of Evolution
The Mechanisms of Evolution Figure.1 Darwin and the Voyage of the Beagle (Part 1) 2/8/2006 Dr. Michod Intro Biology 182 (PP 3) 4 The Mechanisms of Evolution Charles Darwin s Theory of Evolution Genetic
More informationLecture 13: Variation Among Populations and Gene Flow. Oct 2, 2006
Lecture 13: Variation Among Populations and Gene Flow Oct 2, 2006 Questions about exam? Last Time Variation within populations: genetic identity and spatial autocorrelation Today Variation among populations:
More informationName: Period: EOC Review Part F Outline
Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences
More informationD. Incorrect! That is what a phylogenetic tree intends to depict.
Genetics - Problem Drill 24: Evolutionary Genetics No. 1 of 10 1. A phylogenetic tree gives all of the following information except for. (A) DNA sequence homology among species. (B) Protein sequence similarity
More informationIUCN Red List Process. Cormack Gates Keith Aune
IUCN Red List Process Cormack Gates Keith Aune The IUCN Red List Categories and Criteria have several specific aims to provide a system that can be applied consistently by different people; to improve
More informationLinking levels of selection with genetic modifiers
Linking levels of selection with genetic modifiers Sally Otto Department of Zoology & Biodiversity Research Centre University of British Columbia @sarperotto @sse_evolution @sse.evolution Sally Otto Department
More informationMeiosis and Mendel. Chapter 6
Meiosis and Mendel Chapter 6 6.1 CHROMOSOMES AND MEIOSIS Key Concept Gametes have half the number of chromosomes that body cells have. Body Cells vs. Gametes You have body cells and gametes body cells
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More information- mutations can occur at different levels from single nucleotide positions in DNA to entire genomes.
February 8, 2005 Bio 107/207 Winter 2005 Lecture 11 Mutation and transposable elements - the term mutation has an interesting history. - as far back as the 17th century, it was used to describe any drastic
More information1. The diagram below shows two processes (A and B) involved in sexual reproduction in plants and animals.
1. The diagram below shows two processes (A and B) involved in sexual reproduction in plants and animals. Which statement best explains how these processes often produce offspring that have traits not
More informationFormative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)
Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific
More informationQ1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate.
OEB 242 Exam Practice Problems Answer Key Q1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate. First, recall
More informationPatterns of inheritance
Patterns of inheritance Learning goals By the end of this material you would have learnt about: How traits and characteristics are passed on from one generation to another The different patterns of inheritance
More informationMutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution
Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.
More informationNatural Selection results in increase in one (or more) genotypes relative to other genotypes.
Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Fitness - The fitness of a genotype is the average per capita lifetime contribution of individuals of that
More informationPlant variation and evolution
Plant variation and evolution D. BRIGGS S.M. WALTERS SECOND EDITION UNIVERSITATS- BIBLIOTHEK The right of the University of Cambridge all manner of books was granted by Henry VIII in 1534. The University
More information2. Next, try to describe the cell cycle as follows: interphase, prophase, metaphase, anaphase, telophase, cytokinesis
1. First, tell me something exciting you did over spring break! 2. Next, try to describe the cell cycle as follows: interphase, prophase, metaphase, anaphase, telophase, cytokinesis *Reminder*-Thursday
More informationMechanisms of Evolution. Adaptations. Old Ideas about Evolution. Behavioral. Structural. Biochemical. Physiological
Mechanisms of Evolution Honors Biology 2012 1 Adaptations Behavioral Structural Biochemical Physiological 2 Old Ideas about Evolution Aristotle (viewed species perfect and unchanging) Lamarck suggested
More informationSAMPLE COURSE OUTLINE BIOLOGY GENERAL YEAR 12
SAMPLE COURSE OUTLINE BIOLOGY GENERAL YEAR 12 Copyright School Curriculum and Standards Authority, 2015 This document apart from any third party copyright material contained in it may be freely copied,
More informationLecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based
More information- point mutations in most non-coding DNA sites likely are likely neutral in their phenotypic effects.
January 29 th, 2010 Bioe 109 Winter 2010 Lecture 10 Microevolution 3 - random genetic drift - one of the most important shifts in evolutionary thinking over the past 30 years has been an appreciation of
More informationThe theory of evolution continues to be refined as scientists learn new information.
Section 3: The theory of evolution continues to be refined as scientists learn new information. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the conditions of the
More informationwww.lessonplansinc.com Topic: Dinosaur Evolution Project Summary: Students pretend to evolve two dinosaurs using genetics and watch how the dinosaurs adapt to an environmental change. This is a very comprehensive
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More information8.8 Growth factors signal the cell cycle control system
The Cellular Basis of Reproduction and Inheritance : part II PowerPoint Lectures for Campbell Biology: Concepts & Connections, Seventh Edition Reece, Taylor, Simon, and Dickey Biology 1408 Dr. Chris Doumen
More informationPopulation Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More informationContents PART 1. 1 Speciation, Adaptive Radiation, and Evolution 3. 2 Daphne Finches: A Question of Size Heritable Variation 41
Contents List of Illustrations List of Tables List of Boxes Preface xvii xxiii xxv xxvii PART 1 ear ly problems, ea r ly solutions 1 1 Speciation, Adaptive Radiation, and Evolution 3 Introduction 3 Adaptive
More informationHeredity Variation Genetics Meiosis
Genetics Warm Up Exercise: -Using your previous knowledge of genetics, determine what maternal genotype would most likely yield offspring with such characteristics. -Use the genotype that you came up with
More informationChapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species.
AP Biology Chapter Packet 7- Evolution Name Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species. 2. Define the following terms: a. Natural
More informationBIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
More informationThere are 3 parts to this exam. Take your time and be sure to put your name on the top of each page.
EVOLUTIONARY BIOLOGY BIOS 30305 EXAM #2 FALL 2011 There are 3 parts to this exam. Take your time and be sure to put your name on the top of each page. Part I. True (T) or False (F) (2 points each). 1)
More information1 Errors in mitosis and meiosis can result in chromosomal abnormalities.
Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal
More informationMeiosis and Sexual Life Cycles
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 13 Meiosis and Sexual Life Cycles
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 009 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationChapter 5. Evolution of Biodiversity
Chapter 5. Evolution of Biodiversity I. Earth s tremendous diversity A. life comes in many forms B. Recall 1. we can think of biodiversity in three ways a) genetic diversity b) species diversity c) ecosystem
More informationCh. 13 Meiosis & Sexual Life Cycles
Introduction Ch. 13 Meiosis & Sexual Life Cycles 2004-05 Living organisms are distinguished by their ability to reproduce their own kind. -Offspring resemble their parents more than they do less closely
More informationBIOL 502 Population Genetics Spring 2017
BIOL 502 Population Genetics Spring 2017 Lecture 1 Genomic Variation Arun Sethuraman California State University San Marcos Table of contents 1. What is Population Genetics? 2. Vocabulary Recap 3. Relevance
More informationCELL BIOLOGY - CLUTCH CH MEIOSIS AND SEXUAL REPRODUCTION.
!! www.clutchprep.com CONCEPT: BASICS OF MEIOTIC GENETICS Sexual reproduction involves mixing DNA from individuals to produce genetically distinct offspring Beneficial because it allows for genetic diversity
More informationLIFE SCIENCES GRADE 12 SESSION 20 ( LEARNER NOTES)
TOPIC: CONSOLIDATION EXAMINATION PAPER 1 Learner Note: Please stick to the time limits. Read the questions carefully and underline the operative words. Make sure that you understand what is being asked.
More informationA. Correct! Genetically a female is XX, and has 22 pairs of autosomes.
MCAT Biology - Problem Drill 08: Meiosis and Genetic Variability Question No. 1 of 10 1. A human female has pairs of autosomes and her sex chromosomes are. Question #01 (A) 22, XX. (B) 23, X. (C) 23, XX.
More informationMolecular markers in plant systematics and population biology
Molecular markers in plant systematics and population biology 2. Overview of applications and questions Tomáš Fér tomas.fer@natur.cuni.cz Molecular markers overview 1. proteins isozymes 2. DNA markers
More informationBIO Lab 5: Paired Chromosomes
Paired Chromosomes Of clean animals and of animals that are not clean.two and two, male and female, went into the ark with Noah as God had commanded Noah. Genesis 7:8-9 Introduction A chromosome is a DNA
More informationWhy the Indian subcontinent holds the key to global tiger recovery
Why the Indian subcontinent holds the key to global tiger recovery QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Samrat Mondol K. Ullas Karanth Uma Ramakrishnan NCBS-TIFR
More informationExam 1 PBG430/
1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.
More informationPlant Genetic Resources: Effective Utilization
Plant Genetic Resources: Effective Utilization AU: Please check if the affiliation has been identified correctly. Hikmet Budak Faculty of Engineering and Natural Science, Biological Science and Bioengineering
More informationHow Molecules Evolve. Advantages of Molecular Data for Tree Building. Advantages of Molecular Data for Tree Building
How Molecules Evolve Guest Lecture: Principles and Methods of Systematic Biology 11 November 2013 Chris Simon Approaching phylogenetics from the point of view of the data Understanding how sequences evolve
More informationQuantitative Trait Variation
Quantitative Trait Variation 1 Variation in phenotype In addition to understanding genetic variation within at-risk systems, phenotype variation is also important. reproductive fitness traits related to
More information