letter Telomere dysfunction and evolution of intestinal carcinoma in mice and humans

Transcription

1 Telomere dysfunction nd evolution of intestinl crcinom in mice nd humns Krl Lenhrd Rudolph 1,4, Meliss Millrd 1, Mrcus W. Bosenerg 1,2 & Ronld A. DePinho 1,3 Telomerse ctivtion is common feture of dvnced humn cncers 1 nd fcilittes the mlignnt trnsformtion of cultured humn cells 2 nd in mice 3,4. These experimentl oservtions re in ccord with the presence of roust telomerse ctivity in more dvnced stges of humn colorectl crcinogenesis 5 7. However, the occurrence of colon crcinoms in telomerse RNA (Terc)-null, p53-mutnt mice 8 hs reveled complex interctions etween telomere dynmics, checkpoint responses nd crcinogenesis9. We therefore sought to determine whether telomere dysfunction exerts differentil effects on cncer initition versus progression of mouse nd humn intestinl neoplsi. In successive genertions of Apc Min Terc / mice 10,11, progressive telomere dysfunction led to n increse in initited lesions (microscopic denoms), yet significnt decline in the multiplicity nd size of mcroscopic denoms. Tht telomere dysfunction lso contriutes to humn colorectl crcinogenesis is supported y the ppernce of nphse ridges ( correlte of telomere dysfunction) t the denomerly crcinom trnsition, trnsition recognized for mrked chromosoml instility Together, these dt re consistent with model in which telomere dysfunction promotes the chromosoml instility tht drives erly crcinogenesis, while telomerse ctivtion restores genomic stility to level permissive for tumor progression. We propose tht erly nd trnsient telomere dysfunction is mjor mechnism underlying chromosoml instility of humn cncer. Epithelil cncers occur infrequently in lortory mice, nd when they do occur they rrely exhiit the errnt cytogenetic profiles typicl of humn crcinoms, such s severe neuploidy nd complex nonreciprocl trnsloctions 8,16. The long telomeres nd somtic expression of telomerse in mice would seem to contriute to these species differences s evidenced y the emergence of epithelil cncers with chromosoml instility in telomerse-deficient, p53-mutnt mice with short dysfunctionl telomeres 8. To delinete the complex role of telomere dysfunction in the initition nd progression of intestinl crcinom, we monitored the impct of incresing levels of telomere dysfunction on the rte, growth nd clinicl ehvior of gstrointestinl neoplsis in Apc Min mice. In this model, loss of the wildtype Apc llele cuses multiple intestinl neoplsi (Min) in 100% of Apc Min mice nd deth t 4 6 months 10,11. The quntittive nture of the denom phenotype llows us to exmine tumor initition s well s progression from micro- to mcrodenom. To void strin-specific modifiction of the Apc Min phenotype 17,18, we ckcrossed the Terc / llele to C57BL/6 (B6) mice (N7) nd then mted the mice with congenic B6 Apc Min mice. B6 mice possess shorter telomere lengths (on verge) thn the mixed genetic strins studied previously 19 22, which produces n onset of chromosoml instility in the second genertion (G2) Terc / mice nd mrked increse in chromosoml errtions in G3 nd G4 mice. Although survivl curves of Terc +/+ Apc Min nd G1 Terc / Apc Min mice re superimposle, we oserved decrese in survivl in G2 nd G3 Terc / Apc Min mice, wheres G4 Terc / Apc Min mice show mrked increse in survivl (Fig. 1). These complex survivl trends indicte tht the level of telomere dysfunction my differentilly influence the emergence nd the susequent growth of denoms. To ssess more directly telomere-relted effects on initition versus progression of Apc Min neoplsis, we quntitted microdenoms nd mcrodenoms in whole-mount intestinl preprtions derived from the vrious Terc / genertions (Fig. 2). The rnge nd verge numer of microdenoms re similr in Terc +/+ nd G1 Terc / Apc Min mice, compred with significnt increse in microdenom formtion in G3 nd G4 mterc / Apc Min smples (Fig. 2). In contrst to the microdenom trend, mcrodenom formtion peks modestly in G2 Terc / Apc Min mice ut declines in G3 nd significntly in G4 Terc / Apc Min mice (Fig. 2). One G3 nd five of six G4 Terc / Apc Min mice showed ner-complete suppression of mcrodenom formtion nd mrkedly impired denom growth (Figs. 2, 3). Mcrodenom urden correltes inversely with survivl trends cross the Apc Min Terc / genertions (Fig. 1). Finlly, the rtio of micro- to mcrodenom formtion in these Fig. 1 Telomere shortening hs contrsting effects on the survivl of Apc Min mice. We exmined survivl of the B6 Apc Min in Terc +/+ nd Terc +/ mice (dequte telomere function, positive telomerse ctivity), G1 Terc / mice (dequte telomere function, no telomerse ctivity), G2 Terc / mice (moderte telomere dysfunction, no telomerse ctivity) nd G3 G4 Terc / mice (severe telomere dysfunction, no telomerse). Survivl in Terc +/+ ws no different thn survivl in G1 Terc / mice. A significnt decrese in survivl ws noted in midgenertion (G3 nd G2 Terc / ) mice. In contrst, we oserved significnt increse in the lifespn in lte-genertion (G4) Terc / mice. Note tht 7 months fter irth none of the G4 Terc / mice hd died nd tht nimls were scrificed t tht time to nlyze the tumor urden. 1 Deprtment of Adult Oncology, Dn-Frer Cncer Institute, Boston, Msschusetts 02115, USA. 2 Deprtment of Pthology, Brighm nd Women s Hospitl, Boston, Msschusetts 02115, USA. 3 Deprtments of Medicine nd Genetics, Hrvrd Medicl School, Boston, Msschusetts 02115, USA. 4 Deprtment of Gstroenterology nd Heptology, Medicl School Hnnover, Hnnover 30623, Germny. Correspondence should e ddressed to R.A.D. (e-mil: ron_depinho@dfci.hrvrd.edu). nture genetics volume 28 june

2 Fig. 2 Contrsting effects of telomere shortening on tumor formtion in ApcMin mice. We determined the numer of micro- nd mcrodenoms in Terc+/+ nd G1 G4 Terc / mice crrying the ApcMin muttion. The ge of the mice rnged from 3.5 to 5 months t the time of the nlyses; only G4 mice were chrcterized t 7 months of ge due to the incresed lifespn., Wheres the numer of microdenoms ws no different in G1 Terc / thn in Terc+/+ mice, we oserved twofold increse in the numer of microdenoms in G2 G4 Terc / mice. Photomicrogrphs show representtive exmples of the morphologicl (wholemount, top) nd histologicl (ottom) ppernce of cystic crypts (left) nd microdenoms (right)., A significnt increse in the numer of mcrodenoms is present only in G2 Terc / mice compred with mterc+/+ mice. In contrst, the numer of mcrodenoms decreses in G3 Terc / mice nd is mrkedly suppressed in G4 Terc / mice. In generl, the numer of mcrodenoms correltes inversely to ApcMin survivl trends (Fig. 1). Photomicrogrphs on the right show representtive exmples of the ppernce of mcrodenoms in the terminl ileum of the different genertions indicted (mgnifiction, 7.5). Checkpoint responses tht re dependent on p53 underlie the dverse cellulr consequences of telomere dysfunction29,30. To determine whether such mechnisms contriute to impired progression of lte genertion Terc / ApcMin denoms, we determined p53 sttus nd expression s well s intrtumorl rtes of poptosis nd cell prolifertion in denom smples from the different cohorts. All mcrodenoms nd mtched norml mucosl iopsies tested y PCR-sed ssy retined oth copies of the Trp53 llele (Fig. 4). In ddition, we detected overexpression of p53 y immunofluorescence in G3 Terc / denoms, which is more pronounced in G4 Terc / denoms (Fig. 4c). Correspondingly, we detected incresed poptosis nd decresed prolifertion in G3 nd G4 Terc / denoms, with ner complete suppression of prolifertion in G4 Terc / denoms (Fig. 4d,e). Thus, the sis for impired progression in G3 nd G4 Terc / denoms is proly due to checkpoint responses ctivted in the setting of nphse ridge rekge nd intct DNA-dmge responses nd my e compounded y the rmpnt genomic instility induced y dvnced telomere dysfunction3,4,8,29. Do these findings in the mouse provide frmework for understnding telomere-dependent mechnisms in humn crcinom development? If telomeres were to modulte the mlignnt different genertions further sustntites the dverse effect of telomere dysfunction on intestinl tumor progression (Fig. 3). Thus, ApcMin denom growth nd progression re suppressed significntly in lte Terc / genertions, despite n incresed incidence of initited neoplstic lesions. In the evlution of the moleculr events modulting the ApcMin phenotype, polymerse chin rection (PCR)-sed llelotyping of G2 G4 Terc / ApcMin denoms shows wildtype Apc llele loss in 90% of microdenoms (n=10), 100% of mcrodenoms (n=21) nd none of the non-tumor-ering intestinl mucosl iopsies from lte-genertion Terc / ApcMin mice (n=6) (dt not shown). The min mechnism of Apc loss in ApcMin mice involves loss of the entire chromosome 18 crrying the wildtype Apc llele followed y dupliction of the remining chromosome crrying the mutnt llele23. Mitotic recomintion is second possile mechnism nd hs een identified s cuse of Apc loss in Bloom-deficient ApcMin mice24. It is resonle to ssume tht chromosoml loss is enhnced in the setting of telomere dysfunction through the formtion of dicentric chromosomes nd their high rte of loss3,8. In line with this hypothesis, the very low nphse ridge index25 28 (ABI) of Terc+/+ nd G1 Terc / ApcMin denoms contrsted shrply with higher thn norml ABI in the denoms of lter Terc / genertions (Fig. 4). Fig. 3 Telomere shortening inhiits progression of intestinl neoplsi. The size of mcrodenoms nd the rtio of micro- to mcrodenoms were determined in Terc+/+ nd G1 G4 Terc / mice crrying the ApcMin muttion., We first oserved significnt decrese in the size of mcrodenoms in G2 Terc / mice compred with Terc+/+ mice. G4 Terc / mice show further decrese in mcrodenom size. Right, representtive exmples of the histologicl ppernce of the mcrodenom size difference in G1 nd G3 Terc / mice (mgnifiction for oth smples, 100)., Rtio of micro- to mcrodenoms determined in individul Terc+/+ nd G1 G4 Terc / mice. 156 nture genetics volume 28 june 2001

3 process in humns, one would nticipte their gretest impct to e t the point of mximl ttrition just efore, or t the time of, telomerse ctivtion. In this regrd, it is notle tht chromosoml instility (of the type ssocited with, ut not specific for, telomere dysfunction) increses mrkedly t the trnsition from lte denomtous polyps to crcinoms. Moreover, p53 function, potent rrier for spiring cncer cells with telomere dysfunction, is often lost in these emerging crcinoms16. Lstly, telomerse is rectivted lte in the evolution of colorectl crcinom, pttern tht correltes well with telomere ttrition. The confluence of these events in humns nd in the mouse dt presented here nd reported previously8,22,29 leds us to propose tht telomere dysfunction is key mechnism driving chromosoml instility t the enign-to-mlignnt trnsition in humn colorectl crcinogenesis, therey enling premlignnt cells to rech criticl cncer threshold9. If this process is opertive, then hllmrk of telomere dysfunction, nphse ridge formtion, should e evident s denomtous lesions ssume high-grde dysplstic fetures. To test this hypothesis, we determined the ABI for spordic humn colorectl tumor smples representing different stges of tumor progression: denom, denom with high-grde dysplsi, denocrcinom rising in n denomtous polyp (crcinom-in situ), primry denocrcinom, nd metstsis (Fig. 5). The ABI is very low in erly denoms ut increses shrply nture genetics volume 28 june 2001 in foci of high-grde dysplsi nd CIS (Fig. 5). We oserved further, ut not significnt, increse in deeply invsive primry denocrcinom, wheres metstsis show significnt reduction in the ABI compred with primry denocrcinom. Together, the presence of short telomeres in colorectl crcinom5,31, the ctivtion of telomerse t the crcinom stge5 7, the shrp increse of nphse ridges t the denom crcinom trnsition nd the decrese of nphse ridges in metstsis imply tht telomere dynmics contriute to the known genomic nd phenotypic chrcteristics of humn colorectl crcinom progression. Given the prominent role of chromosoml instility in humn colorectl cncer initition nd the strong selection of telomerse-expressing cells lter during cncer progression, the telomerse-deficient ApcMin mouse provides system in which to model this criticl stge in the life history of colorectl cncer cell. Methods Terc ApcMin mouse. We ckcrossed Terc+/ mice of mixed genetic ckground21 to C57BL6J mice for seven genertions efore we performed crosses to C57BL6J ApcMin mice. Intercrosses of Terc+/ ApcMin mice ccording to previously pulished mting schemes19 results in successive genertions of Terc / ApcMin mice (Terc+/+ nd G1 G4 mterc / ). Segregtion studies revel similr trnsmission for the mutnt ApcMin llele in ll Terc genertions (39% in Terc+/+ nd G1 Terc /, 41% in G2 nd G3 Terc / nd 38% in G4 Terc / ). c d Fig. 4 Degree of telomere dysfunction ffects denom progression., We determined the ABI in the mcrodenoms of Terc+/+ nd G1 G4 Terc / mice y clculting the rtio of nphse ridges to norml ppering nphses. A significnt increse in nphse ridges ppers first in G2 Terc / mice nd further significnt increse is evident in G4 Terc / mice. Right, exmple of two nphse ridges (rrows) nd two norml ppering nphses (mgnifiction, 1,000; r, 30 µm).,c, Retention nd overexpression of p53 in mcrodenoms of Terc / ApcMin mice. Trp53 gene dosge ws quntified y rel-time PCR with Moleculr Becons ssy (). The stndrd curve ws clculted on mixtures of DNA derived from the intestines of Trp53 / nd Trp53+/+ mice with the rtios indicted. No significnt decrese in signl intensity is detected in 23 mcrodenoms investigted from Terc+/+ nd G1 G4 Terc / ApcMin mice. Immunofluorescence of p53 revels overexpression of p53 in denoms rising in G3 nd G4 Terc / mice (c). Histogrm represents quntifiction of p53-positive nuclei per high-power field (mgnifiction, 400). Right, representtive immunofluorescent stins from Terc+/+ nd G3 G4 Terc / denoms (mgnifiction, 400; r, 50 µm). d, We oserved n incresed numer of poptotic cells in the mcrodenoms of G3 Terc / mice tht is more pronounced in G4 Terc / mice. Quntifiction of TUNEL-positive cells per low-power field (mgnifiction, 100 (left rs)) nd of pyknotic nuclei per high-power field (mgnifiction, 400 (right rs)). Representtive photogrphs of TUNEL ssys re shown on the left, demonstrting n increse in poptotic cells (rrows) in mcrodenoms of G3 nd G4 Terc / mice (mgnifiction, 100; r, 150 µm); representtive photogrphs of section stined with hemtoxylin nd eosin re shown on the right, demonstrting n increse in pyknotic nuclei (rrows) in mcrodenoms of G3 nd G4 Terc / mice (mgnifiction, 200; r, 50 µm). e, PCNA immunofluorescence demonstrtes n initil decrese in proliferting cells in the denoms of G3 Terc / mice nd shrp decrese in prolifertion in the denoms of G4 Terc / mice. Quntifiction of PCNA-positive nuclei per low-power field (mgnifiction, 100) is shown. Photogrphs show representtive exmples of the genertions depicted (mgnifiction, 200; r, 100 µm). e 157

4 Fig. 5 Telomere dysfunction peks t the denom-crcinom trnsition in humn colorectl crcinogenesis., We determined the rte of nphse ridge formtion t different stges of humn colorectl crcinogenesis: denom (AD; 26 cses), high-grde dysplsi (HD) nd denocrcinom present in denomtous polyps (CIS; 24 cses), invsive denocrcinom (CA; 33 cses) nd metstsis (MET; 29 cses). Rtio of nphse ridges to totl numer of nphses is shown. Photogrphs show representtive exmples of nphse ridges in crcinom specimen () nd norml nphse in n denom (c) (mgnifiction, 600; r, 50 µm; inset mgnifiction, 1,000; r, 15 µm). Survivl curves. We monitored the helth sttus of the different cohorts of Terc Apc Min mice (16 Terc +/+, 19 G1, 14 G2, 14 G3 nd 6 G4 mterc / mice) during weekly inspections of the mouse colony. We used the survivl dt of mice tht were scrificed ecuse of severely impired helth sttus nd of mice tht died etween oservtion rounds to clculte survivl curves for the different cohorts. Whole-mount stining/nlysis of micro- nd mcrodenoms. The complete smll nd lrge intestine of the mice ws resected en lock, opened longitudinlly nd pinned luminl side up on Styrofom. We counted mcrodenoms (1 5 mm dimeter) efore the whole-mount stining. Whole-mount stining ws performed fter overnight fixtion in 3% formlin in phosphteuffered sline (PBS) t 4 ºC. After rinse in fresh PBS, the intestines were stined for 3 5 min in 0.2% methylene lue in PBS. After two wshes in PBS, the intestines were kept in PBS for n dditionl min with shking. We quntified the microdenom counts (<1 mm) on the entire smll intestine with Leic dissecting microscope (mgnifiction, 7 40). We dissected single microdenoms with 26-guge syringe for DNA extrction. Adenom size in individul mice (n=6 for ech cohort) ws determined with dissection microscope (mgnifiction, 15) nd n opticl micrometer. For ech mouse, we determined the size of 3 15 denoms locted in the lst 5 cm of the terminl ileum nd clculted men vlues. Histology nd immunohistochemistry. We used longitudinl cross sections (5 µm thick) through intestinl rolls spnning the entire smll intestine for histologicl nd immunohistochemicl nlyses. We used sections stined with hemtoxylin nd eosin to compre histologicl morphology nd to quntify nphse ridges nd pyknotic nuclei. Unstined sections were stined for poptotic cells with the fluorescent cell deth detection kit (Roche). A 1:200 dilution of the p53-a-1 ntiody (Oncogene) ws used for immunofluorescence of p53 nd 1:200 dilution of the PCNA-A-1 ntiody (Oncogene) ws used to detect proliferting cell nucler ntigen (PCNA). Stined sections were dehydrted nd mounted. Apc nlysis. A PCR-sed nlysis for deletion of the wildtype Apc llele ws performed s descried previously 23. We used two PCR primers to mplify the Apc locus spnning the Apc Min point muttion t nucleotide 2549 (forwrd, 5 TCTCGTTCTGAGAAAGACAGAAGCT 3 ; reverse, 5 TGATACT TCTTCTTCCAAAGCTTTGGCTAT 3 ). Both primers contined HindIII restriction sides. An dditionl HindIII restriction site ws present only in the wildtype Apc PCR product nd missing in the PCR product of the Apc Min llele. The PCR products were digested with HindIII nd seprted in 10% denturing polycrylmide gel. DNA products were visulized y stining with ethidium romide. The wildtype Apc llele ws 123 se pirs (p), nd the Apc Min llele ws 155 p. We quntified the stining intensity for oth products on duplictes for ech smple nd used only smples with reproducile results (within 10% devition) for nlysis of the Apc sttus. p53 Quntittive (Q)-PCR mplifiction. Genomic DNA ws isolted with Qigen Dnesy kit (Qigen; Vlenci) nd quntified y rel-time PCR using Moleculr Becons ssy. PCR mplifictions were performed in replictes of 8 in 25 µl rection mixtures, ech contining 50 ng of genomic DNA, 1 Sentinel Q-PCR core regent (Strtgene) in 4 mm MgCl 2 with ech primer t 300 nm nd the corresponding fluorescent-leled proe t 400 nm. Primer nd proe sequences re ville upon request. Amplifictions were done on the ABI Prism 7700 (PE Biosystems) under the following conditions: 95 C for 3 min, 40 cycles of 95 C for 15 s, 60 C for 30 s. We determined the reltive quntities of p53 y normlizing the p53 gene mplifiction product to tht of the single-copy gene ApoB nd clirting the results to DNA smple known to contin single copy of p53. Humn smples. All cses of humn colorectl denoms (n=26), HD nd denocrcinom rising in denomtous polyps (n=24), invsive denocrcinoms (n=33) nd metstsis (n=29) were retrieved from the rchives of the Deprtment of Pthology, Brighm nd Women s Hospitl nd the Medicl School Hnnover (Germny). We reviewed the dignoses nd determined the ABI for ech morphologiclly distinct tumor stge present. The ABI ws determined y dividing the numer of nuclei with nphse ridges y the totl numer of nphse nuclei. Two investigtors independently scored minimum of 10 nphses per smple. Anphse ridging ws defined s nphses in which greter thn two-thirds of the distnce etween the seprting nphse poles ws spnned y the ridging chromosome to void counting lgging chromosomes. Acknowledgments We thnk D. Cstrillon nd S. Chng for helpful dvice regrding the pthologicl nd histologicl clssifiction of intestinl neoplsi; L. Chin, S. Weiler nd R. Greenerg for criticl review of the mnuscript; nd P. Flemming nd M. Mnns for ccess to the histology rchives of the Medicl School Hnnover. K.L.R. ws supported y Deutsche Forschungsgemeinschft grnt Ru 745/1-1, M.W.B. is supported y Howrd Hughes Medicl Institute Physicin Postdoctorl fellowship nd the work ws supported y Ntionl Institutes of Helth grnts to R.A.D., who is n Americn Cncer Society Reserch Professor nd Kirsch Foundtion Scholr. Received 17 April; ccepted 27 April Kim, N.W. et l. Specific ssocition of humn telomerse ctivity with immortl cells nd cncer. Science 266, (1994). 2. Hhn, W.C. et l. Cretion of humn tumour cells with defined genetic elements. Nture 400, (1999). 3. Greenerg, R.A. et l. Short dysfunctionl telomeres impir tumorigenesis in the INK4(delt2/3) cncer-prone mouse. Cell 97, (1999). 4. Gonzlez-Surez, E., Smper, E., Flores, J.M. & Blsco, M.A. Telomerse-deficient mice with short telomeres re resistnt to skin tumorigenesis. Nture Genet. 26, (2000). 5. Engelhrdt, M., Drullinsky, P., Guillem, J. & Moore, MA. Telomerse nd telomere length in the development nd progression of premlignnt lesions to colorectl cncer. Clin. Cncer Res. 3, (1997). 6. Tng, R., Cheng, A.J., Wng, J.Y. & Wng, T.C. Close correltion etween telomerse expression nd denomtous polyp progression in multistep colorectl crcinogenesis. Cncer Res. 58, (1998). 7. Chdeneu, C., Hy, K., Hirte, H.W., Gllinger, S. & Bcchetti, S. Telomerse ctivity ssocited with cquisition of mlignncy in humn colorectl cncer. 158 nture genetics volume 28 june 2001

5 Cncer Res. 55, (1995). 8. Artndi, S. et l. Telomere dysfunction promotes non-reciprocl trnsloctions nd epithelil cncers in mice. Nture 406, (2000). 9. Hnhn, D. Benefits of d telomeres. Nture 406, (2000). 10. Moser, A.R., Pitot, H.C. & Dove, W.F. A dominnt muttion tht predisposes to multiple intestinl neoplsi in the mouse. Science 247, (1990). 11. Su, L.K. et l. Multiple intestinl neoplsi cused y muttion in the murine homolog of the APC gene. Science 256, (1992). 12. Young, J. et l. Genomic instility occurs in colorectl crcinoms ut not in denoms. Hum. Mutt. 2, (1993). 13. Okmoto, M. et l. Loss of constitutionl heterozygosity in colon crcinom from ptients with fmilil polyposis coli. Nture 331, (1988). 14. Ried, T. et l. Comprtive genomic hyridiztion revels specific pttern of chromosoml gins nd losses during the genesis of colorectl tumors. Genes Chromosom. Cncer 15, (1996). 15. Meijer, G.A. et l. Progression from colorectl denom to crcinom is ssocited with non-rndom chromosoml gins s detected y comprtive genomic hyridistion. J. Clin. Pthol. 51, (1998). 16. Lenguer, C., Kinzler, K.W. & Vogelstein, B. Genetic instilities in humn cncers. Nture 396, (1998). 17. Dietrich, W.F. et l. Genetic identifiction of Mom-1, mjor modifier locus ffecting Min-induced intestinl neoplsi in the mouse. Cell 75, (1993). 18. Hlerg, R.B. et l. Tumorigenesis in the multiple intestinl neoplsi mouse: redundncy of negtive regultors nd specificity of modifiers. Proc. Ntl. Acd. Sci. USA 97, (2000). 19. Blsco, M.A. et l. Telomere shortening nd tumor formtion y mouse cells lcking telomerse RNA. Cell 91, (1997). 20. Herrer, E. et l. Disese sttes ssocited with telomerse deficiency pper erlier in mice with short telomeres. EMBO J. 18, (1999). 21. Lee, H.W. et l. Essentil role of mouse telomerse in highly prolifertive orgns. Nture 392, (1998). 22. Rudolph, K.L. et l. Longevity, stress response, nd cncer in ging telomersedeficient mice. Cell 96, (1999). 23. Luongo, C. & Dove, W.F. Somtic genetic events linked to the Apc locus in intestinl denoms of the Min mouse. Genes Chromosom. Cncer 17, (1996). 24. Luo, G. et l. Cncer predisposition cused y elevted mitotic recomintion in loom mice. Nture Genet. 26, (2000). 25. McClintock, B. The stility of roken ends of chromosomes in Ze mys. Genetics 26, (1941). 26. vn Steensel, B., Smogorzewsk, A. & de Lnge, T. TRF2 protects humn telomeres from end-to-end fusions. Cell 92, (1998). 27. Kirk, K.E., Hrmon, B.P., Reichrdt, I.K., Sedt, J.W. & Blckurn, E.H. Block in nphse chromosome seprtion cused y telomerse templte muttion. Science 275, (1997). 28. Rudolph, K.L., Chng, S., Millrd, M., Schreier-Agus, N. & DePinho, R.A. Inhiition of experimentl liver cirrhosis in mice y telomerse gene delivery. Science 287, (2000). 29. Chin, L. et l. p53 deficiency rescues the dverse effects of telomere loss nd coopertes with telomere dysfunction to ccelerte crcinogenesis. Cell 97, (1999). 30. Krlseder, J., Broccoli, D., Di, Y., Hrdy, S. & de Lnge, T. p53- nd ATMdependent poptosis induced y telomeres lcking TRF2. Science 283, (1999). 31. Hstie, N.D. et l. Telomere reduction in humn colorectl crcinom nd with geing. Nture 346, (1990). nture genetics volume 28 june