supplementary information
|
|
- Muriel Powers
- 5 years ago
- Views:
Transcription
1 DOI: 1.138/nc8 Top-GFP!-ctenin GFP Intensity Nucler Bet-Ctenin c MUC FABP KRT LGR5 ASCL AXIN Figure S1 TOP-GFP expression nd reltion with nucler β-ctenin, wnt trgets nd differentition mrkers. () Co-immunostining of TOP-GFP spheroid culture with GFP nd β-ctenin ntiody demonstrtes cler correltion etween TOP-GFP levels nd nucler locliztion of β-ctenin (scle r, 5µm), quntifiction shown in (). (c) Microrry nlysis of specific gene-set in high, intermedite nd low TOP-GFP cell 15 5 frctions indictes grdul increse in differentition mrker expression nd decrese in Wnt trget gene expression from to popultions (Ech ox plot represents miniml of two dt points from seprte single-cell cloned TOP-GFP CSC cultures). Genes were picked sed on significnt differences oserved in Fig 1d Mcmilln Pulishers Limited. All rights reserved.
2 18 6 TOP-GFP Low 1 in every Apo.1.A Apo.1.B Apo.1.C Top-GFP ki67 * * Figure S Limiting dilution on vrious clones, Ki-67 stining. () Limiting dilution ssy nd clonogenic potentil of 3 independent lines derived from the sme ptient s Apo.1 (Apo.1.A, Apo.1.B nd Apo.1.C). Errors rs represent 95% CI. Representtive exmples re shown. See Methods for detils on limiting dilution ssys. () Ki-67 co-stining with GFP in TOP-GFP xenogrfts. Ki-67 positivity encompsses oth GFP positive nd negtive cells. Scle r, µm. 1 Mcmilln Pulishers Limited. All rights reserved.
3 "-SMA EGF/FGF FCS FCS + 18Co FCS + c GF FCS Muc FABP Figure S3 Myofirolsts prevent differentition of colon CSCs. () Immunohistochemistry for α-sma shows myofirolsts in the strom of primry humn colorectl mlignncies. (Scle r, 5µm) () Phse rst pictures to show morphologicl differentition of CSC. Upper left represents spheroid culture growing in medium ining EGF nd FGF, upper right is fter differentition in % FCS. Lower left is differentition with % FCS, ut plted on myofirolsts (18Co) nd lower right is differentition with FCS in the presence of. (Scle r, µm) (c) Immunofluorescence for FABP nd Muc on cytospins of spheroid cells (EGF/FGF) or cells induced to differentite with % FCS in the sence (middle) or presence of (right). (Scle r, µm) Mcmilln Pulishers Limited. All rights reserved.
4 3 Reltive spot intensity Co Co MCP-1 TIMP-1 TIMP- GRO IGFBP-1 Osteoprotegerin Eotxin IL-8 8 GRO-lph rol Angiogenin PARC IGFBP- MIP-3-lph IL-7 MCP- c-met IL-6 IL-3 c-met % of Mx 6 gpdh APC-A c CSC med rol PHA PHA 15 p-met 15 p-met 5 5 5!-ctin 5!-ctin 5 5 Figure S Myofirolsts produce nd humn colon CSCs express c-met. () A grph depicting the detected secreted fctors in (see Methods for detils). () PCR showing expression of c-met in spheroid cultured colon CSCs. Right pnel shows FACS nlysis for c-met. (red; ckground nd lue; c-met) (c) Full lot of phospho-c-met nd β-ctin of Co stimulted with 18Co conditioned medium () or CSC rol medium for the time indicted. 1 Mcmilln Pulishers Limited. All rights reserved.
5 Reltive Luciferse Intensity 6 TOP DLD1 FOP + PHA + PHA PHA Reltive Luciferse Intensity 3 1 TOP HCT116 FOP + PHA + PHA PHA Reltive Luciferse Intensity 3 1 TOP HT9 FOP + PHA + PHA PHA Reltive Luciferse Intensity 3 1 TOP LM5 FOP + PHA + Antiody Figure S5 TOP/FOP ssy on vrious lines nd with vrious conditions. Depicted re the results of TOP/FOP ssys on different humn colon cncer lines including severl estlished colorectl cncer lines (DLD1, HCT116, HT9). LM5 is liver metstsis derived primry CSC line. The stimultory effect of is dependent. Error rs represent SEM (n=3), dt from t lest replictes is shown Mcmilln Pulishers Limited. All rights reserved.
6 CRC1 CRC CRC3 CRC CRC5 CRC6 Norml DAPI "SMA "-SMA Desmin Vimentin c 18Co MF9 18Co MF-9 MF-66 H O!-ctin MF66 Figure S6 Humn colon crcinom ssocited myofirolsts express. Six different humn primry colorectl cncer specimens nd one norml humn colon specimen ws stined for oth nd α-sma. In out of 6 smples we detected in α-sma-positive cells. Scle Brs, 5µm. () Both n estlished colon myofirolst line (18Co) s well s two primry lines (MF9, MF66) isolted from colorectl cncer ptients express mrkers ssocited with myofirolsts (Scle rs, µm) nd revel production y (c) PCR Mcmilln Pulishers Limited. All rights reserved.
7 Correspond to Fig.5 h Correspond to Fig.5 i h h 8h 16h 15 5 met 15 5 p-met 15 5 p-!-ct (S55) 5 p-kt (S73) 5 kt 15 5!-ct 5 p-gsk3! (S9) 5 Gsk3! p-!-ct (T1/S5)!-ct Figure S7 Full lots. Represented re the full Western lots of Fig. 5h nd i Mcmilln Pulishers Limited. All rights reserved.
8 Tle S1 Genes showing most differentil expression etween nd cell popultions. A list of the most differentilly regulted genes in the versus frctions from two different single cell cultures is summrized in Tle S1, indicted vlues represent Log foldchnges. Tle S List of primers used in this study. Tle S1 Gene Proeset G7 A FABP1 589_s_t AKR1B1 6561_s_t MUC 673_t ST6GALNAC1 775_t GCNT3 1958_t SPINK 71_t HEPACAM 61_t GMPR 187_t CAB39L 5915_t.3 1. TSPAN5 989_t NEURL1B 5355_t TUBBB 13_x_t LGR5 1388_t SERPINI1 535_t LEF1 1558_s_t LRP 185_s_t CXCR 178_t SP5 3585_t DEFA5 9_t APCDD1 516_t 5..3 Tle S Primers Sequences Fwd Rev Lgr5 CTGCCTGCAATCTACAAGGT CCCTTGGGAATGTATGTCAGA Survivin GCCCAGTGTTTCTTCTGCTT CCGGACGAATGCTTTTTATG Axin CTCCTTATCGTGTGGGCAGT CTTCATCCTCTCGGATCTGC Muc CGAAACCACGGCCACAACGT GACCACGGCCCCGTTAAGCA Krt TGTCCTGCAAATTGATAATGCT AGACGTATTCCTCTCTCACTCTCATA Fp TGGAAGGTAGACCGGAGT AGGTCCCCCTGAGTTCAGTT c-met CTGCCTGCAATCTACAAGGT ATGGTCAGCCTTGTCCCTC Hgf CCTATTTCTCGTTGTGAAGGT TGTTTCGTTTTGGCACAAGA!-ctin ATGGAAGAAGAGATCGCCGC TCGTAGATGGGCACCGTGTG Mcmilln Pulishers Limited. All rights reserved.
3.94 ± 0.50 (95% CI) Correlative inhibition index (slope)
Supplementl Tle S. Selected rchitecturl prmeters of phy nd phyphy grown under. Vlues re mens ± SE, except for predicted primry rosette rnches where the vlues re the men with the ssocited 9% confidence
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc2975 GM13 / DNA F-ctin α shrna CLASP1 shrna shrna shrna CLASP1 shrna shrna e Tuulin CLASP1 CLASP1 shrna #32 shrna #33 #55 #58 Tuulin c Tuulin ppmlc E-Cdherin shrna CLASP1 shrna shrna f Golgi
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture11444 CMKIIN Gold prticles/ mitochondril re ( m ) 4 3 1 CMKIIN mtcmkiin mtcmkiin SERCA ATP synthse HA mitoplsts mtcmkiin CMKIIN cytosolic mtcmkiin CMKIIN 97 kdl 64 kdl 51 kdl 14 kdl 6 kdl
More informationVertical uniformity of cells and nuclei in epithelial monolayers
Supplementry informtion Verticl uniformity of cells nd nuclei in epithelil monolyers Srujn Neelm b, Peter Hyes, Qio Zhng, Richrd B. Dickinson nd Tnmy P. Lele, Figure S1. Histogrm plots compre the frequency
More informationControl NaCl ABA * * Control 4ºC 37ºC
Dul regultion of wter retention nd cell growth y stress-ssocited protein (SAP) gene in Prunus A. Lloret, A. Conejero, C. Leid, C. Petri, F. Gil-Muñoz, L. Burgos, M.L. Bdenes, nd G. Ríos.5 PpSAP Reltive
More information1,6. Tu18 1,2 0,8 0,4 0,0. Tu29. >10x down * 1,6. Tu43 1,2 0,8 0,4 0,0 8 0,0 1,6. Tu80 0,8 0,4 0,0
Reltive expression Tu14,9,6,3 2, Tu16 1,5 1,,5 Tu18,4 3 2 1 Tu19 >1x down * Reltive expression 3,2 Tu23 2,4 3 25 2 15 1 5 Tu28 >1x down * 4 Tu29 3 2 1 Tu31,9,6,3 Tu32 3,2 Tu33 Tu43 Tu57 Reltive expression
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture11813 NK cells NKp46 + RORγt - 5.4 RORγt + ILCs SSC-A FSC-H Linege 22.4 98.2 28.8 NKp46 1.2 15.4 NKp46 NKp46 + RORγt + ILCs NKp46 - RORγt + ILCs FSC-A FSC-A CD45 RORγt RORγt CCR6 + T-et
More informationSupplementary Figure 1 Supplementary Figure 2
Supplementry Figure 1 Comprtive illustrtion of the steps required to decorte n oxide support AO with ctlyst prticles M through chemicl infiltrtion or in situ redox exsolution. () chemicl infiltrtion usully
More informationSUPPLEMENTARY INFORMATION
SULEMENTARY INORMATION doi:1.138/nture1394 Trnsduced Mcrophges 293T-Nip trnsfectnts NAI2 N2 N5 5 Blot: Nip2 Blot: Nip5 N1 lg N6 5 c Blot: lg Blot: Nip6 Wild-type Legionell infection: fla Legionell infection:
More informationsupplementary information
DOI:.38/nc293 KNL-3 knl- KBP- ZWL- knl- NDC-8 KLP-9 knl- KNL-3 NDC-8 knl-3 ndc-8 KLP-9 u- klp-9 ZWL- zwl- Figure S Locliztion of kinetochore proteins nd of KLP-9 on meiosis I spindles. Immunostining of
More informationSUPPLEMENTARY INFORMATION
VOLUME: ARTICLE NUMBER: 3 In the formt provided y the uthors nd unedited. Developmentl constrints shpe the evolution of the nemtode mid-developmentl trnsition Hrel Zlts nd Iti Yni,3 Fculty of Biology,
More information( ) as a fraction. Determine location of the highest
AB Clculus Exm Review Sheet - Solutions A. Preclculus Type prolems A1 A2 A3 A4 A5 A6 A7 This is wht you think of doing Find the zeros of f ( x). Set function equl to 0. Fctor or use qudrtic eqution if
More informationa cacnb1 ts25/ts25 Supplemental Figure 1
ccn1 ts/ts α -ungrotoxin prlyzed 0.6 ΔF/F 0.0 2 ΔF/F 2 s stimulus α -ungrotoxin ccn1 ts/ts Supplementl Figure 1 CSF-cNs recorded from lrv prlyzed with α-ungrotoxin nd ccn1 mutnt lrv show no difference
More informationAB Calculus Review Sheet
AB Clculus Review Sheet Legend: A Preclculus, B Limits, C Differentil Clculus, D Applictions of Differentil Clculus, E Integrl Clculus, F Applictions of Integrl Clculus, G Prticle Motion nd Rtes This is
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture8499 doi:.38/nture8499 5 6 5 4.5 Firing rte (Hz) -67-65 -66-6 -58 V m (mv) -7-67 -68-66 -64 c Thet power (mv ) -73-69 -7-7 -7.5.8 3....9.9.4.6.6. 9 8 9 8 9 8 9 8 9 8 Supplementry Figure Firing
More information( ) where f ( x ) is a. AB Calculus Exam Review Sheet. A. Precalculus Type problems. Find the zeros of f ( x).
AB Clculus Exm Review Sheet A. Preclculus Type prolems A1 Find the zeros of f ( x). This is wht you think of doing A2 A3 Find the intersection of f ( x) nd g( x). Show tht f ( x) is even. A4 Show tht f
More informationSupplementary Figure 1
Supplementry Figure (nesthetized) (wke) Normlized mplitude.5 Pek width (ms).6.4.2 4 2 2 x 3 Wveform slope Normlized mplitude.5 Pek width (ms).6.4.2 x 3 3 2 Wveform slope c (nesthetized) d (wke) Normlized
More informationSupplementary material
10.1071/FP11237_AC CSIRO 2012 Accessory Puliction: Functionl Plnt Biology 2012, 39(5), 379 393. Supplementry mteril Tle S1. Effect of wter regime nd genotype on different growth prmeters: spike dry mtter
More informationTremor-rich shallow dyke formation followed by silent magma flow at Bárðarbunga in Iceland
In the formt provided y the uthors nd unedited. SUPPLEMENTARY INFORMATION DOI: 1.138/NGEO9 Tremor-rich shllow dyke formtion followed y silent mgm flow t Bárðrung in Icelnd 1,, 1, 3 1, 1 1, NATURE GEOSCIENCE
More information1B40 Practical Skills
B40 Prcticl Skills Comining uncertinties from severl quntities error propgtion We usully encounter situtions where the result of n experiment is given in terms of two (or more) quntities. We then need
More informationDOI:.8/nc5 Cpilities of MCAK Sidesliding, endctching on microtuules MCAKdecorted ed Functions in mitotic spindle Prometphse Slides on the microtuule surfce + Redily slides long the microtuule surfce Strongly
More informationTopics Covered AP Calculus AB
Topics Covered AP Clculus AB ) Elementry Functions ) Properties of Functions i) A function f is defined s set of ll ordered pirs (, y), such tht for ech element, there corresponds ectly one element y.
More informationSupporting Information. Cytosolic Irradiation of Femtosecond Laser Induces Mitochondria-dependent Apoptosis-like
Supporting Informtion Cytosolic Irrdition of Femtosecond Lser Induces Mitochondri-dependent Apoptosis-like Cell Deth vi Intrinsic Rective Oxygen Cscdes Jonghee Yoon 1,2, Seung-wook Ryu 1,3, Seunghee Lee
More informationp-adic Egyptian Fractions
p-adic Egyptin Frctions Contents 1 Introduction 1 2 Trditionl Egyptin Frctions nd Greedy Algorithm 2 3 Set-up 3 4 p-greedy Algorithm 5 5 p-egyptin Trditionl 10 6 Conclusion 1 Introduction An Egyptin frction
More informationSimulated climate vegetation interaction in semi-arid regions affected by plant diversity
SULMNTARY INFORMATION DOI: 0.038/NGO96 Simulted climte vegettion interction in semi-rid regions ffected y plnt diversity M. Clussen,,*, S. Bthiny, V. Brovkin nd T. Kleinen []{Mx lnck Institute for Meteorology,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.2398 Locl virtionl coherences drive the primry photochemistry of vision Philip J. M. Johnson 1, Alexei Hlpin 1, Tkefumi Morizumi 2, Vlentyn I. Prokhorenko 3, Oliver P. Ernst 2,4, & R.
More information( ) where f ( x ) is a. AB/BC Calculus Exam Review Sheet. A. Precalculus Type problems. Find the zeros of f ( x).
AB/ Clculus Exm Review Sheet A. Preclculus Type prolems A1 Find the zeros of f ( x). This is wht you think of doing A2 Find the intersection of f ( x) nd g( x). A3 Show tht f ( x) is even. A4 Show tht
More information( ) Same as above but m = f x = f x - symmetric to y-axis. find where f ( x) Relative: Find where f ( x) x a + lim exists ( lim f exists.
AP Clculus Finl Review Sheet solutions When you see the words This is wht you think of doing Find the zeros Set function =, fctor or use qudrtic eqution if qudrtic, grph to find zeros on clcultor Find
More informationThomas Whitham Sixth Form
Thoms Whithm Sith Form Pure Mthemtics Unit C Alger Trigonometry Geometry Clculus Vectors Trigonometry Compound ngle formule sin sin cos cos Pge A B sin Acos B cos Asin B A B sin Acos B cos Asin B A B cos
More informationTests for the Ratio of Two Poisson Rates
Chpter 437 Tests for the Rtio of Two Poisson Rtes Introduction The Poisson probbility lw gives the probbility distribution of the number of events occurring in specified intervl of time or spce. The Poisson
More informationTransient Stimulation of Distinct Subpopulations of Striatal Neurons Mimics Changes in the Value of Competing Actions
Supplementl mterils for: Trnsient Stimultion of Distinct Supopultions of Stritl Neurons Mimics Chnges in the Vlue of Competing Actions Lung-Ho Ti, A. Moses Lee,2, Nor Benvidez 3, Antonello Bonci 4,,6,
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures. Title of file for HTML: Peer Review File Description:
Title of file for HTML: Supplementry Informtion Description: Supplementry Figures Title of file for HTML: Peer Review File Description: WTP SST IPO PDO WTP leds IPO PDO Supplementry Figure 1 IPO (or PDO)
More informationLecture 09: Myhill-Nerode Theorem
CS 373: Theory of Computtion Mdhusudn Prthsrthy Lecture 09: Myhill-Nerode Theorem 16 Ferury 2010 In this lecture, we will see tht every lnguge hs unique miniml DFA We will see this fct from two perspectives
More informationSUPPLEMENTARY INFORMATION
doi:1.1/nture1 NF-κB/RE-GFP TNF-α pdna CA CA + DN d e NF-κB/RE-GFP GFP+DAPI NF-κB/RE-GFP GFP+DAPI NF-κB/RE-GFP GFP+DAPI V V DAPI DAPI NF-κB RE/GFP V V Mediosl hypothlmus Thlmus Cortex Suppl. Figure 1.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Synthesis of metl oxide with roomtemperture photoreversile phse trnsition Shin-ichi Ohkoshi 1 *, Yoshihide Tsunouchi, 1 Tomoyuki Mtsud, 1 Kzuhito Hshimoto, 2 Asuk Nmi, 1 Fumiyoshi
More informationScientific notation is a way of expressing really big numbers or really small numbers.
Scientific Nottion (Stndrd form) Scientific nottion is wy of expressing relly big numbers or relly smll numbers. It is most often used in scientific clcultions where the nlysis must be very precise. Scientific
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture896 c Resting stte Resting stte Resting stte Supplementry Figure Illustrtion of pttern clssifiction nd its effects on neuronl representtions. Dynmic ctivity ptterns evoked y different stimuli
More informationHaplotype Frequencies and Linkage Disequilibrium. Biostatistics 666
Hlotye Frequencies nd Linkge isequilirium iosttistics 666 Lst Lecture Genotye Frequencies llele Frequencies Phenotyes nd Penetrnces Hrdy-Weinerg Equilirium Simle demonstrtion Exercise: NO2 nd owel isese
More informationStat3 controls lysosomal-mediated cell death in vivo
L E T T E R S Stt3 controls lysosoml-medited cell deth in vivo Peter A. Kreuzler 1, Ann D. Stniszewsk 1, Wenjing Li 1, Nder Omidvr 2, Blndine Kedjour 1, Jmes Turkson 3, Vleri Poli 4, Richrd A. Flvell 5,
More informationApplication Chebyshev Polynomials for Determining the Eigenvalues of Sturm-Liouville Problem
Applied nd Computtionl Mthemtics 5; 4(5): 369-373 Pulished online Septemer, 5 (http://www.sciencepulishinggroup.com//cm) doi:.648/.cm.545.6 ISSN: 38-565 (Print); ISSN: 38-563 (Online) Appliction Cheyshev
More information4.1 One-to-One Functions; Inverse Functions. EX) Find the inverse of the following functions. State if the inverse also forms a function or not.
4.1 One-to-One Functions; Inverse Functions Finding Inverses of Functions To find the inverse of function simply switch nd y vlues. Input becomes Output nd Output becomes Input. EX) Find the inverse of
More informationlim f(x) does not exist, such that reducing a common factor between p(x) and q(x) results in the agreeable function k(x), then
AP Clculus AB/BC Formul nd Concept Chet Sheet Limit of Continuous Function If f(x) is continuous function for ll rel numers, then lim f(x) = f(c) Limits of Rtionl Functions A. If f(x) is rtionl function
More informationDesigning Information Devices and Systems I Fall 2016 Babak Ayazifar, Vladimir Stojanovic Homework 6. This homework is due October 11, 2016, at Noon.
EECS 16A Designing Informtion Devices nd Systems I Fll 2016 Bk Ayzifr, Vldimir Stojnovic Homework 6 This homework is due Octoer 11, 2016, t Noon. 1. Homework process nd study group Who else did you work
More informationFarey Fractions. Rickard Fernström. U.U.D.M. Project Report 2017:24. Department of Mathematics Uppsala University
U.U.D.M. Project Report 07:4 Frey Frctions Rickrd Fernström Exmensrete i mtemtik, 5 hp Hledre: Andres Strömergsson Exmintor: Jörgen Östensson Juni 07 Deprtment of Mthemtics Uppsl University Frey Frctions
More informationList all of the possible rational roots of each equation. Then find all solutions (both real and imaginary) of the equation. 1.
Mth Anlysis CP WS 4.X- Section 4.-4.4 Review Complete ech question without the use of grphing clcultor.. Compre the mening of the words: roots, zeros nd fctors.. Determine whether - is root of 0. Show
More informationSupplementary Figures
Electronic Supplementry Mteril (ESI) for Integrtie Biology. This journl is The Royl Society of Chemistry 214 Supplementry Figures CWound Are µm2 A EGTA Low Clcium 8 1 min. fter wounding Wound + 1 min.
More informationcritical number where f '(x) = 0 or f '(x) is undef (where denom. of f '(x) = 0)
Decoding AB Clculus Voculry solute mx/min x f(x) (sometimes do sign digrm line lso) Edpts C.N. ccelertion rte of chnge in velocity or x''(t) = v'(t) = (t) AROC Slope of secnt line, f () f () verge vlue
More informationMATH 144: Business Calculus Final Review
MATH 144: Business Clculus Finl Review 1 Skills 1. Clculte severl limits. 2. Find verticl nd horizontl symptotes for given rtionl function. 3. Clculte derivtive by definition. 4. Clculte severl derivtives
More informationWe partition C into n small arcs by forming a partition of [a, b] by picking s i as follows: a = s 0 < s 1 < < s n = b.
Mth 255 - Vector lculus II Notes 4.2 Pth nd Line Integrls We begin with discussion of pth integrls (the book clls them sclr line integrls). We will do this for function of two vribles, but these ides cn
More informationThe graphs of Rational Functions
Lecture 4 5A: The its of Rtionl Functions s x nd s x + The grphs of Rtionl Functions The grphs of rtionl functions hve severl differences compred to power functions. One of the differences is the behvior
More informationLecture INF4350 October 12008
Biosttistics ti ti Lecture INF4350 October 12008 Anj Bråthen Kristoffersen Biomedicl Reserch Group Deprtment of informtics, UiO Gol Presenttion of dt descriptive tbles nd grphs Sensitivity, specificity,
More informationUNIT 5 QUADRATIC FUNCTIONS Lesson 3: Creating Quadratic Equations in Two or More Variables Instruction
Lesson 3: Creting Qudrtic Equtions in Two or More Vriles Prerequisite Skills This lesson requires the use of the following skill: solving equtions with degree of Introduction 1 The formul for finding the
More informationStudent Activity 3: Single Factor ANOVA
MATH 40 Student Activity 3: Single Fctor ANOVA Some Bsic Concepts In designed experiment, two or more tretments, or combintions of tretments, is pplied to experimentl units The number of tretments, whether
More informationLAMEPS Limited area ensemble forecasting in Norway, using targeted EPS
Limited re ensemle forecsting in Norwy, using trgeted Mrit H. Jensen, Inger-Lise Frogner* nd Ole Vignes, Norwegin Meteorologicl Institute, (*held the presenttion) At the Norwegin Meteorologicl Institute
More informationCHEMICAL KINETICS
CHEMICAL KINETICS Long Answer Questions: 1. Explin the following terms with suitble exmples ) Averge rte of Rection b) Slow nd Fst Rections c) Order of Rection d) Moleculrity of Rection e) Activtion Energy
More informationMath 31S. Rumbos Fall Solutions to Assignment #16
Mth 31S. Rumbos Fll 2016 1 Solutions to Assignment #16 1. Logistic Growth 1. Suppose tht the growth of certin niml popultion is governed by the differentil eqution 1000 dn N dt = 100 N, (1) where N(t)
More information38 Riemann sums and existence of the definite integral.
38 Riemnn sums nd existence of the definite integrl. In the clcultion of the re of the region X bounded by the grph of g(x) = x 2, the x-xis nd 0 x b, two sums ppered: ( n (k 1) 2) b 3 n 3 re(x) ( n These
More informationMultiplying integers EXERCISE 2B INDIVIDUAL PATHWAYS. -6 ì 4 = -6 ì 0 = 4 ì 0 = -6 ì 3 = -5 ì -3 = 4 ì 3 = 4 ì 2 = 4 ì 1 = -5 ì -2 = -6 ì 2 = -6 ì 1 =
EXERCISE B INDIVIDUAL PATHWAYS Activity -B- Integer multipliction doc-69 Activity -B- More integer multipliction doc-698 Activity -B- Advnced integer multipliction doc-699 Multiplying integers FLUENCY
More informationTHE EFFECT OF GRADED DIETARY LEVELS OF VITAMIN A, GIVEN TO EARLY SEA BREAM (Sparus aurata) LARVAE ON SKELETAL DEFORMITIES AND GENOMIC EXPRESSION
THE EFFECT OF GRADED DIETARY LEVELS OF VITAMIN A, GIVEN TO EARLY SEA BREAM (Sprus urt) LARVAE ON SKELETAL DEFORMITIES AND GENOMIC EXPRESSION B. Ginzourg, W.M. Koven, S. Fontgne, A. Sgi, D. M. Power nd
More informationState space systems analysis (continued) Stability. A. Definitions A system is said to be Asymptotically Stable (AS) when it satisfies
Stte spce systems nlysis (continued) Stbility A. Definitions A system is sid to be Asymptoticlly Stble (AS) when it stisfies ut () = 0, t > 0 lim xt () 0. t A system is AS if nd only if the impulse response
More informationBlack oils Correlations Comparative Study
Reservoir Technologies Blck oils Correltions Comprtive Study Dr. Muhmmd Al-Mrhoun, Mnging Director Sturdy, 26 April, 2014 Copyright 2008, NExT, All rights reserved Blck oils Correltions Introduction to
More informationSection 4: Integration ECO4112F 2011
Reding: Ching Chpter Section : Integrtion ECOF Note: These notes do not fully cover the mteril in Ching, ut re ment to supplement your reding in Ching. Thus fr the optimistion you hve covered hs een sttic
More informationMath 42 Chapter 7 Practice Problems Set B
Mth 42 Chpter 7 Prctice Problems Set B 1. Which of the following functions is solution of the differentil eqution dy dx = 4xy? () y = e 4x (c) y = e 2x2 (e) y = e 2x (g) y = 4e2x2 (b) y = 4x (d) y = 4x
More informationI1 = I2 I1 = I2 + I3 I1 + I2 = I3 + I4 I 3
2 The Prllel Circuit Electric Circuits: Figure 2- elow show ttery nd multiple resistors rrnged in prllel. Ech resistor receives portion of the current from the ttery sed on its resistnce. The split is
More informationFundamental Theorem of Calculus
Fundmentl Theorem of Clculus Recll tht if f is nonnegtive nd continuous on [, ], then the re under its grph etween nd is the definite integrl A= f() d Now, for in the intervl [, ], let A() e the re under
More informationSupplementary figure 1
Supplementry figure 1 Igf 1 mrna 5 15 1 5 Arg1 mrna 16 1 8 Col11 mrna 5 3 1 Mmp 13 mrna 15 1 5 Tslp mrna 3 1 Il5 mrna 3 1-1 Il33 mrna 6 Figure 1s. Kinetis of woun heling ftors n erly Th-type response ytokines
More informationCalculus AB. For a function f(x), the derivative would be f '(
lculus AB Derivtive Formuls Derivtive Nottion: For function f(), the derivtive would e f '( ) Leiniz's Nottion: For the derivtive of y in terms of, we write d For the second derivtive using Leiniz's Nottion:
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.29.451 Aove-ndgp voltges from ferroelectric photovoltic devices S. Y. Yng, 1 J. Seidel 2,3, S. J. Byrnes, 2,3 P. Shfer, 1 C.-H. Yng, 3 M. D. Rossell, 4 P. Yu,
More informationarxiv:hep-ex/ v1 12 Sep 1998
Evidence of the φ ηπ γ decy rxiv:hep-ex/9891v1 12 Sep 1998 Astrct M.N.Achsov, V.M.Aulchenko, S.E.Bru, A.V.Berdyugin, A.V.Bozhenok, A.D.Bukin, D.A.Bukin, S.V.Burdin, T.V.Dimov, S.I.Dolinski, V.P.Druzhinin,
More informationMath 520 Final Exam Topic Outline Sections 1 3 (Xiao/Dumas/Liaw) Spring 2008
Mth 520 Finl Exm Topic Outline Sections 1 3 (Xio/Dums/Liw) Spring 2008 The finl exm will be held on Tuesdy, My 13, 2-5pm in 117 McMilln Wht will be covered The finl exm will cover the mteril from ll of
More informationletter Telomere dysfunction and evolution of intestinal carcinoma in mice and humans
Telomere dysfunction nd evolution of intestinl crcinom in mice nd humns Krl Lenhrd Rudolph 1,4, Meliss Millrd 1, Mrcus W. Bosenerg 1,2 & Ronld A. DePinho 1,3 Telomerse ctivtion is common feture of dvnced
More informationThermal Stability of Ti-C-Ni-Cr and Ti-C-Ni-Cr-Al-Si Nanocomposite Coatings
Journl of Physics: Conference Series PAPER OPEN ACCESS Therml Stility of Ti-C-Ni-Cr nd Ti-C-Ni-Cr-Al-Si Nnocomposite Cotings To cite this rticle: A V Andreev et l 2015 J. Phys.: Conf. Ser. 652 012057 View
More informationSupplementary Information
Supplementry Informtion Coopertion of locl motions in the Hsp90 moleculr chperone ATPse mechnism Andre Schulze 1, Gerti Beliu 1, Dominic A. Helmerich 1, Jonthn Schubert 1, Lurence H. Perl 2, Chrisostomos
More informationMuscle and serum acylcarnitine profiles in dairy cows during the periparturient period
Muscle nd serum cylcrnitine profiles in diry cows during the periprturient period Y. Yng, 1 C. Prehn, 2 J. Admski, 2 J. Rehge, 3 S. Dänicke, 4 H. Suerwein, 1 H. Sdri 1 1 Institute of Animl Science, Physiology
More informationGenetic Programming. Outline. Evolutionary Strategies. Evolutionary strategies Genetic programming Summary
Outline Genetic Progrmming Evolutionry strtegies Genetic progrmming Summry Bsed on the mteril provided y Professor Michel Negnevitsky Evolutionry Strtegies An pproch simulting nturl evolution ws proposed
More informationEvaluating Definite Integrals. There are a few properties that you should remember in order to assist you in evaluating definite integrals.
Evluting Definite Integrls There re few properties tht you should rememer in order to ssist you in evluting definite integrls. f x dx= ; where k is ny rel constnt k f x dx= k f x dx ± = ± f x g x dx f
More informationPrecalculus Spring 2017
Preclculus Spring 2017 Exm 3 Summry (Section 4.1 through 5.2, nd 9.4) Section P.5 Find domins of lgebric expressions Simplify rtionl expressions Add, subtrct, multiply, & divide rtionl expressions Simplify
More informationLinear Inequalities. Work Sheet 1
Work Sheet 1 Liner Inequlities Rent--Hep, cr rentl compny,chrges $ 15 per week plus $ 0.0 per mile to rent one of their crs. Suppose you re limited y how much money you cn spend for the week : You cn spend
More information2015 SRJC H2 Mathematics Prelim Paper 2
05 SRJC H Mthemtics Prelim Pper Section A: Pure Mthemtics [40 mrks] Functions f nd g re defined s elow. f :, g : ln( ), (i) Sketch the grph of g() nd stte its ect rnge. [] (ii) Determine whether the composite
More informationUncertainty propagation with AGS
Uncertinty propgtion with A J. Heyse, C. Prdel, P. chilleeeckx EC JRC IRMM tndrds for Nucler fety, ecurity nd fegurds (N3 H.I. Kim Koren Atomic Energy Reserch Institute Nucler t Center Contents Uncertinty
More information0.1 THE REAL NUMBER LINE AND ORDER
6000_000.qd //0 :6 AM Pge 0-0- CHAPTER 0 A Preclculus Review 0. THE REAL NUMBER LINE AND ORDER Represent, clssify, nd order rel numers. Use inequlities to represent sets of rel numers. Solve inequlities.
More informationBridging the gap: GCSE AS Level
Bridging the gp: GCSE AS Level CONTENTS Chpter Removing rckets pge Chpter Liner equtions Chpter Simultneous equtions 8 Chpter Fctors 0 Chpter Chnge the suject of the formul Chpter 6 Solving qudrtic equtions
More informationSurface Integrals of Vector Fields
Mth 32B iscussion ession Week 7 Notes Februry 21 nd 23, 2017 In lst week s notes we introduced surfce integrls, integrting sclr-vlued functions over prmetrized surfces. As with our previous integrls, we
More informationLinear Systems with Constant Coefficients
Liner Systems with Constnt Coefficients 4-3-05 Here is system of n differentil equtions in n unknowns: x x + + n x n, x x + + n x n, x n n x + + nn x n This is constnt coefficient liner homogeneous system
More informationANALYSIS OF FAST REACTORS SYSTEMS
ANALYSIS OF FAST REACTORS SYSTEMS M. Rghe 4/7/006 INTRODUCTION Fst rectors differ from therml rectors in severl spects nd require specil tretment. The prsitic cpture cross sections in the fuel, coolnt
More informationQuantum Nonlocality Pt. 2: No-Signaling and Local Hidden Variables May 1, / 16
Quntum Nonloclity Pt. 2: No-Signling nd Locl Hidden Vriles My 1, 2018 Quntum Nonloclity Pt. 2: No-Signling nd Locl Hidden Vriles My 1, 2018 1 / 16 Non-Signling Boxes The primry lesson from lst lecture
More informationpolyimide Spray-coated ZrP/epoxy film Spray-coated ZrP/epoxy film glass
c d e polyimide Spry-coted ZrP/epoxy film glss Spry-coted ZrP/epoxy film f g Supplementry Figure 1. Opticl microscopy of smectic ( = 0.044) α-zrp/epoxy films., Trnsmission opticl microscopy (TOM) of smectic
More informationChapter 3. Vector Spaces
3.4 Liner Trnsformtions 1 Chpter 3. Vector Spces 3.4 Liner Trnsformtions Note. We hve lredy studied liner trnsformtions from R n into R m. Now we look t liner trnsformtions from one generl vector spce
More informationProperties of Integrals, Indefinite Integrals. Goals: Definition of the Definite Integral Integral Calculations using Antiderivatives
Block #6: Properties of Integrls, Indefinite Integrls Gols: Definition of the Definite Integrl Integrl Clcultions using Antiderivtives Properties of Integrls The Indefinite Integrl 1 Riemnn Sums - 1 Riemnn
More informationDA 3: The Mean Value Theorem
Differentition pplictions 3: The Men Vlue Theorem 169 D 3: The Men Vlue Theorem Model 1: Pennslvni Turnpike You re trveling est on the Pennslvni Turnpike You note the time s ou pss the Lenon/Lncster Eit
More informationRugby High School Physical Science I Can & Evidence Statements
Rugy High School Physicl Science I Cn & Evidence Sttements RHS-PS1-1 Students who demonstrte understnding cn: RHS-PS1-1. Use the periodic tle s model to predict the reltive properties of elements sed on
More informationarxiv: v1 [physics.soc-ph] 25 Mar 2008
Pulic trnsport networks: empiricl nlysis nd modeling rxiv:0803.3514v1 [physics.soc-ph] 25 Mr 2008 C. von Ferer, 1, 2, T. Holovtch, 3, 1, Yu. Holovtch, 4, 5, nd V. Plchykov 4, 1 Applied Mthemtics Reserch
More informationES.182A Topic 32 Notes Jeremy Orloff
ES.8A Topic 3 Notes Jerem Orloff 3 Polr coordintes nd double integrls 3. Polr Coordintes (, ) = (r cos(θ), r sin(θ)) r θ Stndrd,, r, θ tringle Polr coordintes re just stndrd trigonometric reltions. In
More informationsupplementary information
DOI: 1.138/n2131 Protein levels (% of ) e Full-length protein remining (%) 1 5 1 5 1 1 5 5 Hs7 Syt1 Syt2 β-atin CSP +tsyn Hs7 Syt1 Syt2 P4 rin.1.1.1 1 [Trypsin] (g/l) f +tsyn SNARE-omplexes remining (%)
More informationA negative answer to a question of Wilke on varieties of!-languages
A negtive nswer to question of Wilke on vrieties of!-lnguges Jen-Eric Pin () Astrct. In recent pper, Wilke sked whether the oolen comintions of!-lnguges of the form! L, for L in given +-vriety of lnguges,
More informationThe Trapezoidal Rule
_.qd // : PM Pge 9 SECTION. Numericl Integrtion 9 f Section. The re of the region cn e pproimted using four trpezoids. Figure. = f( ) f( ) n The re of the first trpezoid is f f n. Figure. = Numericl Integrtion
More informationAn Overview of Integration
An Overview of Integrtion S. F. Ellermeyer July 26, 2 The Definite Integrl of Function f Over n Intervl, Suppose tht f is continuous function defined on n intervl,. The definite integrl of f from to is
More information3.1 Exponential Functions and Their Graphs
. Eponentil Functions nd Their Grphs Sllbus Objective: 9. The student will sketch the grph of eponentil, logistic, or logrithmic function. 9. The student will evlute eponentil or logrithmic epressions.
More informationSection 6.1 INTRO to LAPLACE TRANSFORMS
Section 6. INTRO to LAPLACE TRANSFORMS Key terms: Improper Integrl; diverge, converge A A f(t)dt lim f(t)dt Piecewise Continuous Function; jump discontinuity Function of Exponentil Order Lplce Trnsform
More informationb a wt ccd8 dad2 Secondary branches 15 e cd normal low b 2
A 3 1 Shoot mss (g) B Root mss (g) C 8 Primry rnhes D 8 Seonry rnhes 1 e E 8 Shoot mss/rnhes norml low 1 F 8 8 Shoot mss/root mss 8 8 Supplementl Figure 1 Aitionl phenotypi t reore from the plnts esrie
More information