BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, maximizing access to critical research.
|
|
- Delphia Gaines
- 6 years ago
- Views:
Transcription
1 The Complete Mitochondrial Genome of the Near-Threatened Swallowtail, Agehana maraho (Lepidoptera: Papilionidae): Evaluating Sequence Variability and Suitable Markers for Conservation Genetic Studies Author(s): Li-Wei Wu, David C. Lees, Shen-Horn Yen, Chih-Chien Lu, and Yu-Feng Hsu Source: Entomological News, 121(3): Published By: The American Entomological Society DOI: URL: BioOne ( is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne s Terms of Use, available at Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit requests publishers, should academic be directed institutions, to research the individual libraries, and publisher research funders as copyright in the common holder. goal of maximizing access to critical research.
2 Volume 121, Number 3, May and June THE COMPLETE MITOCHONDRIAL GENOME OF THE NEAR-THREATENED SWALLOWTAIL, AGEHANA MARAHO (LEPIDOPTERA: PAPILIONIDAE): EVALUATING SEQUENCE VARIABILITY AND SUITABLE MARKERS FOR CONSERVATION GENETIC STUDIES 1 Li-Wei Wu, 2 David C. Lees, 3,4 Shen-Horn Yen, 5 Chih-Chien Lu, 2 and Yu-Feng Hsu 2 ABSTRACT: Agehana maraho (Shiraki and Sonan, 1934) is a near-threatened swallowtail butterfly endemic to Taiwan. As a first step in evaluating the most variable molecular markers for further population genetic and conservation studies of this and other insects, the entire mitochondrial genome (mitogenome) was sequenced (16,094bp). The most distinctive structure of the Agehana mitogenome is the control region (CR; 1,270bp). This is the longest CR found so far in any lepidopteran, and it also represents the first known case of two units of macro repeats within a tandem region. In a comparison with another 12 lepidopteran mitogenomes, the genes atp8, atp6, and nad6 were found to be more variable than cox1, suggesting an undue focus on cox1 (COI) in identification and phylogeographic studies. A combination of these first three genes plus the CR, comprising micro as well as macro repeats, may thus provide more suitable markers for conservation genetic studies, not only of this near-threatened species, but also of many other insects. KEYWORDS: control region, macro repeat, barcoding, Papilio, COI The endemic swallowtail butterfly, Agehana maraho (Shiraki and Sonan, 1934), is a conspicuous but rare species in Taiwan (Shirôzu, 1960; Igarashi, 1979; d Abrera, 1982). This species possesses a unique broad lobe-like tail in the hindwing that is penetrated by both the M3 and CuA1 veins. Agehana maraho and its sister species A. elwesi are often placed within Papilio sensu lato (e. g. Munroe, 1961; Hancock, 1983), but in a separate genus by others (e. g. Shirôzu, 1960; Igarashi, 1984; Lu et al., 2009). We retain these two species for now in the genus Agehana, because the most recent comprehensive phylogenetic study on Papilio sensu lato (Zakharov et al., 2004) does not include members of Agehana. Agehana maraho is a species of conservation concern, not only as a result of illegal collecting (Cheng et al., 1996; Yen and Yang, 2001) but also because of its specialized dependence on its larval hostplant, Sassafras randaiense (Hayata) Rehder (Lauraceae), which is also a rare Taiwanese endem- 1 Received on June 13, Accepted on July 28, Department of Life Science, National Taiwan Normal University, No.88, Tingzhou Rd., Sec. 4, Taipei 116, Taipei, Taiwan, ROC. s: (L-WW) chiladessp@gmail.com; (C-CL) euthaliasp@ yahoo.com.tw; (Y-FH) t43018@ntnu.edu.tw (corresponding author) 3 Department of Entomology, Natural History Museum, London, SW7 5BD, UK. dclees@ gmail.com 4 Centre de recherche d Orléans, INRA, UR 633 Zoologie Forestière, F Orléans, France. 5 Department of Biological Sciences, National Sun Yat-Sen University, Kaohsiung, Taiwan, ROC. shenhornyen@hotmail.com Mailed on September 28, 2011
3 268 ENTOMOLOGICAL NEWS ic (Hsu, 2006; Nie et al., 2007). Therefore, this butterfly has been assessed as near threatened (LR/nt) by IUCN (IUCN, 2009). Chou (1999) even proposed that both species of Agehana should be protected. Some work has been carried out on the behavior and ecological requirements of Agehana maraho (Igarashi and Fukuda, 1997; Tseng, 2000; Wang et al., 2007; Wang, 2008) but a suitable genetic marker for population genetic evaluation has been lacking, although limited variation was found in the cox1 gene in a comparison of A. maraho and A. elwesi (Lu et al., 2009). There is now an urgent need to re-evaluate the conservation status of A. maraho and obtain useful data for conservation planning. Mitochondrial sequences are widely used genetic markers in many fields of biological study. The mitochondrial genome (mitogenome) has a circular structure about kb long, including 22 transfer RNA (trna) genes, two ribosomal RNA (rrna) genes, 13 protein coding genes (PCGs), and a non-coding region (Wolstenholme, 1992; Boore, 1999). Although the mitochondrion has vital functions in energy supply, its mutation rate is ten times higher than functional nuclear genes (Brown et al., 1979). Consequently, the high mutation signatures remaining in the nucleotides have provided useful information for diverse applications, such as population genetics, species determination, phylogenetics, and phylogeography (Avise, 2000; Caterino et al., 2000; Avise, 2004; Hebert et al., 2004). However, mitogenome sequencing has been uneven, and the results have not yet been sufficiently assessed in insects in terms of the utility of different markers for purposes of conservation genetics, phylogeography and identification (including barcoding). In terms of described species, Lepidoptera is the second largest insect order globally (Grimaldi and Engel, 2005). Yet, of 116 insect mitogenomes sequenced (Genbank, accessed March 2009), there are only ten completed and two near-completed products for Lepidoptera (thus representing only 11% of investigated insect mitogenomes), with none for papilionid butterflies, a cosmopolitan family of focal interest for molecular studies and conservation evaluation (e.g. Zakharov et al., 2004). It appears, in general, that so far there has been relatively little sampling for exploring the evolution of the lepidopteran mitogenome, including the history of rearrangements and the comparative variability of close relatives. However, the utility of the work that has been undertaken has been well demonstrated, as the few lepidopteran mitogenomes published have been used for studying mitogenomic structure (Kim et al., 2006; Salvato et al., 2008), comparison of related species (Yukuhiro et al., 2002; Coates et al., 2005), higher level phylogeny (Lee et al., 2006; Hong et al., 2008), and gene variability (Cameron and Whiting, 2008). In this study, we sequenced the entire mitogenome of Agehana maraho, for two purposes. The first was to determine whether the Agehana mitogenome is structurally similar to other lepidopteran species. The second purpose was to discover variable regions for future conservation studies of Agehana populations. However, our results may have wider implications for the conservation and identification of many insect species.
4 Volume 121, Number 3, May and June METHODS Sample collection and DNA preparation A single male of Agehana maraho was collected from Taoyuan, Taiwan, under a collecting permit issued by local conservation authorities. Genomic DNA was obtained from thorax muscle using the Purgene DNA Isolation kit (Gentra Systems, Minnesota, USA), following the extraction protocol of the manufacturer. The extracted DNA was then resuspended in 100µL ddh 2 0. PCR and Sequencing The entire Agehana mitogenome was amplified in several overlapping fragments. We first amplified the genes cox1, cox2, cob, nad1 and nad5 using primers published in previous studies (Aubert et al., 1999; Caterino and Sperling, 1999; Yagi et al., 1999; Simmons and Weller, 2001). Internal primers were subsequently designed for amplifying internal fragments among those genes (Primer sequences used for PCR amplification are summarized in Table 1). PCR products were amplified using Amersham Taq (Amersham Biosciences, Buckinghamshire, UK) and each PCR reaction mixture was performed in 25µL with 80µM dntp, 1.2 mm MgCl 2, 0.2 µm primers (both direction), 1X Taq buffer, 1U Taq, and 1µL of the template DNA. Finally dh 2 O was added to make up to 25µL. The following PCR conditions were adopted: 4 min at 94ºC, followed by 35 cycles of 30s at 94ºC, 30s at 50-62ºC, and min at 72ºC. The final elongation step was continued for 7 min at 72ºC, and stopped at 4ºC. If the above conditions did not succeed in amplifying the target fragment, we amplified the fragments using a touchdown reaction: 4 min at 94ºC, followed by 10 cycles of 30s at 94ºC, 30s at 65ºC decreasing 0.5ºC degree each cycle, 1-2 min at 72ºC, followed by 35 cycles of 30s at 94ºC, 30s at 50ºC, and min at 72ºC. The final elongation step was continued for 7 min at 72ºC, and stopped at 4ºC. All PCR reactions were successfully amplified except the control region (CR), which failed to amplify in all the above PCR conditions. Nevertheless, the A+T rich region was successfully amplified by the long PCR method, conducted with TaKaRa LA Taq (Takara Bio Inc., Shiga, Japan). The long PCR condition followed the manufacturer s protocol, except for the temperatures of annealing and elongation, which were set to 60ºC at the relevant steps. Several primer pairs were tested and specific regions successfully amplified (listed in Table 1). PCR reactions were checked using 1% agarose gels. If there was only a single band on the gel, PCR products were processed and sequenced using a 96 well Gel/PCR Clean Up kit (Geneaid, Taipei, Taiwan) on an ABI3730 DNA Analyzer (Applied Biosystems, Taipei, Taiwan). Analyses Sequences obtained were visually checked and assembled manually using Sequencher 4.7 (GeneCode, Boston, USA). Determination of gene locations, such as protein coding genes and ribosomal RNA genes, was made by comparison with the mitogenome of Bombyx mori (Yukuhiro et al., 2002) and Drosophila
5 270 ENTOMOLOGICAL NEWS yakuba (Clary and Wolstenholme, 1985). The trna genes were identified through use of the trnascan-se Search Server v1.21 (Lowe and Eddy, 1997). The trnas not found by trnascan-se were identified through comparison with published lepidopteran mitogenomes. Moreover, sequence statistics such as nucleotide variation, composition, and codon usage were calculated using Dnasp 4.5 (Rozas et al., 2003) and Mega 4.1 (Kumar et al., 2004). Finally, the Agehana mitogenome sequence was submitted to GenBank under the Accession number FJ RESULTS AND DISCUSSION Genetic information The entire mitochondrial sequence of Agehana maraho is 16,094 bp long, the longest mitogenome found so far in Lepidoptera. The second longest is that of the bombycid silkmoth, Bombyx mandarina, at 15,928bp (Yukuhiro et al., 2002). Likewise, with 1270 bp, the CR of Agehana maraho is the longest of any lepidopteran ever reported, the second longest being that of the geometrid moth, Epirrita autumnata, at 1075bp (Snäll et al., 2002). By contrast, most of the CR lengths are ~350bp in other butterflies (Taylor et al., 1993; Vila and Björklund, 2004), albeit some longer CR were found in a satyrine, Arethusana arethusa ( bp, listed in Vila and Björklund, 2004) and two papilionids, Papilio pilumnus (~830bp) and P. garamus (~740bp) (both listed in Sperling, 1991). The Agehana mitogenome contains 37 genes, encoding 13 PCGs, two rrnas and 22 trnas, one for each amino acid, and two for leucine and serine (Figure 1, Table 2). The order and orientation of the genes are the same as in Drosophila yakuba, exhibiting the ancestral form for all hexapods and crustaceans (Crease, 1999). The only exception is the arrangement of the trnas between the CR and nad2 gene. The arrangement in Lepidoptera (CR-M-I-Q-nad2) is a derived one (the ground plan being CR-I-Q-M-nad2: Taylor et al., 1993). The most distinctive part of the Agehana mitogenome is found in the CR. This region is not only the longest reported to date for Lepidoptera but also furnishes the first record of macro repeats for Lepidoptera. While macro repeats are commonly found in the mitogenomes of Orthoptera, Diptera, and Coleoptera, they have never until now been found in Lepidoptera (Zhang and Hewitt, 1997; Cameron and Whiting, 2008). The nucleotide A+T compositional bias of the Agehana mitogenome is 80.5%, which fits within the published lepidopteran range of 77.8% (Ochrogaster lunifer, Noctuidae) to 82.7% (Coreana raphaelis, Lycaenidae). The minor strand (79.4%) had a slightly higher A+T proportion than the major strand (77.5%). The highest A+T composition occurred in the CR (94.9%) rather than in the trnas (80.8%), rrnas (84.4%), or PCGs (78.2%) (Table 3). This high A+T content in the CR is frequent in insect mitogenomes (Kim et al., 2005). Non-coding regions The CR, also called the A-T rich region, is located between rrns and trna- Met (labeled M in Figure 1) in all Lepidoptera so far sequenced, including with-
6 Volume 121, Number 3, May and June Figure 1. Mitochondrial genome structure of Agehana maraho. Standard abbreviations for the 22 trnas are used. in the mitogenome of A. maraho (Figure 1). However, due to the fourfold macro repeats in the middle of Agehana CR, the CR becomes the longest among all investigated lepidopterans. The length of this macro repeat is 252bp, comprising two units: unit 1 is 87 bp, composed entirely of A+T, and unit 2 is 165 bp, with 92.7% A+T. No variation was found between copies and no similar sequence was found through blasting those two units in NCBI. Moreover, the order of the macro repeat was unique because of an extra unit 1 copy found in the macro repeat chain, representing five instances of unit 1 and four instances of unit 2, arranged in tandem (Figure 2). The size of macro repeats in other insects ranges from 155bp to 2kb, and repeat numbers range from two to seven fold (Zhang and Hewitt, 1997). Moreover, there were also some micro repeats found in the CR of A. maraho (Figure 2). The (TA) 8 repeat was found in the unit 2, and also the 12 poly-t found in unit 1. The poly-t region (complementary to poly-a) is considered to flag O N (the origin of minority), which is one of the duplicated start regions of the mitochondrion located upstream of rrns (Saito et al., 2005). The start region of O N is conserved among Lepidoptera, including A. maraho (such as the region ATAGA in Figure 3). While the lepidopteran O J (the origin of majority) region was not determined, the first 50bp region near to trna-ile also shows little conservation. In the sequencing work, determining the full length of
7 272 ENTOMOLOGICAL NEWS Table 1. Primers used in this study. Positions are based upon the mitogenomic sequence of Agehana maraho. Posi- Posiition Name Sequence (5' to 3') tion Name Sequence (5' to 3') 10 tm-r10 GTATGAACCCAAAAGCTTAATTT 7927 N5-F7927 GAATTAAAAGAAATAATCTCCC 32 tm-r32 GGGATTTCCTTTATATTTGGGGTATG 8188 N4-R8188 TTATACAGGAACATCTCGTGA 75 ti-r75 AGAATAGTCCTTTAATCAGGCAC 8205 N4-F8205 TATTCACGAGATGTTCCTGTA 175 tq-r175 TATTTTAGTGTAGGGGCACCG 8511 N4-R8511 TCATGGTTTATGTTCTTCTGGT 588 N2-F588 GCWCCWTTTCATTTTTGATTTCC 8787 N4-R8787 CTGGTTCTATGATTTTAGCAGGT 598 N2-598 CAATTAAATCAAGATAAACCTTCA 9038 N4-F9038 TAATAAATAWAYACCAGCTTG 769 N2-R769 CTTAAATTATTAATAGAAGAAAATGCT 9044 N4-R9044 TGGGTGAGGGTATCAACCTGAGC 1000 N2-F1000 TTTAGGTGGATTACCWCCATTT 9062 N4-F9062 TTGMAWWCGYTCYGGTTGATAACCTCA 1108 N2-R1108 CGAAGAATAGATAATTCGGATG 9090 N4-R9090 TTTATTTTTGAGGGGAGATTA 1162 C1-R1162 a GGTACTAATCAGTTTCCAAATCCTCC 9271 N4-R9271 GGGTGCGATTTAGTTTCATACGG 1435 ty-f1435 a TACAATTTATCGCCTAAACTTCAGCC 9293 N4-F9293 CCGTATGAAACTAAATCGCACCC 1834 C1-F1834 ACAGTTTACCCCCCACTTTC 9459 N4L-R9459 GGGAATGATTATTTTCAGAGATTTAG 2050 C1-F2050 CTCTACCAGTATTAGCTGGAGC 9484 N4L-F9484 CTAAATCTCTGAAAATAATCATTCCC 2113 C1-F2113 TTTTGATCCTGCAGGAGGAGG N6-F10062 ATTTTTAGGAGGATTATTAGT 2119 C1-F2119 CTGCTGGAGGAGGCGATCC N6-R10076 TTCATTTGAAGCTACTCTTGAAAC 2160 C1-R2160 a CCCGGTAAAATTAAAATATAAACTTC Cb-F10451 CAACCCCTACGGAAAATCCACCC 2599 C1-F2599 TCTATAGGAGCTGTATTCGC Cb-R10486 ATATTAGAGGGGGTTGGTAG 2603 C1-F2603 TCTATRGGAGCYGTATTTGCTATT Cb-F10841 a TATGTACTACCATGAGGACAAATATC 2611 C1-F2611 GCAGTATTTGCTATTTTTGGAGG Cb-R10952 AATGAAATGAGTAGAATCGAG 2745 C1-R2745 a TGGATAATCAGAATATCGTCGAGG Cb-R11078 AGTGAAAAATGGGTGGAATGGAA 3014 tl-f3014 ATATGTAATGGATTTAAACCCC Cb-F11234 TTACYCCTATTCATATTCAACC 3100 C2-F3100 a AGAGCCTCTCCTTTAATAGAACA Cb-R11275 ATTACACCTCCTAATTTATTAGGAAT 3238 C2-R3238 GAGATAGCTGGTAAAATAGTTC Cb-R11432 CAACAGGACAGGCTCCAGCTCATG 3271 C2-R3271 CGTAATGAAGGTAAGGCAA Cb-F11455 GAGCTGGAGCCTGTCCTGTTG 3351 C2-R3351 a TCATAACTTCAATATCATTG ts-f11591 CTTGTAAAAGCATTTGTCTTG 3413 A6-F3413 CCTTATATTTTTACAAGAACTAG N1-F11987 a ATCAAAAGGAGCTCGATTAGTTTC 3649 C2-F3649 ACAATGCTCAGAAATTTGTGGAGC N1-R12186 TTGCTGGTTGGTCTTCAAATTCT 3731 tk-r3731 a GAGACCATTACTTGCTTTCAGTCATCT N1-F12207 AGAATTTGAAGACCAACCAGCAA 4414 A6-R4414 GAATTAGGGGTGTTCCTTGAGG N1-R12320 CTCCTGTTGTGAGACTTGTAG 5095 C3-F5095 ATTTAATCCTTTACAAATTCCCT rl-f12777 a CCGGTTTGAGCTCAGATCA 5298 C3-R5298 TTCCATGAAATCCTGTTGCTATG rl-r12841 GTTTGCGACCTCGATGTTGGA 5693 N3-F5693 CCCCCTTTGAATGTGGTTTTGACCCC rl-f13186 ATCCAATCTTTCATACAAGCCTCC 5874 N3-R5874 TATATTTTGATTTCATTCATG rl-r13292 a CGCCTGTTTATCAAAAACAT 6064 tn-f6064 AATTGAAACCAAAATAGAGGT rs-r14059 AAAGTAGAGGTACTGGAAAGTG 6266 tf-f6266 AAATAATCTCCGTAATAGCTTC rs-r14125 ATGAAAGCGACGGGCAATATG 6456 N5-F6456 a TAACCTCTATATATYTCTCTT rs-f14419 CCTCTAAATGAACTAAAATACCGCC 6467 N5-F6467 TAACTCTCTTCATCCCATATC rs-f14419 CTAAATAAACTAAAATACCGCC 6514 N5-R6514 TGCCTAATCTTTCTACTTATAGGTT rs-f14499 AATAATAGAGTATCTAATTCT 6768 N5-R6768 CGAAGATTATTTGATATTAAAGAGA rs-r14632 GTGCCAGCAGTTGCGGTTATAC 6919 N5-R6919 AGAGATGGTAAGTATAAGAGA rs-f14653 GTATAACCGCAACTGCTGGCAC 7170 N5-F7170 AAAAAGCTAAATCCGAAAACCCT rs-f14657 AACCGCAACTGCTGGCACAAAA 7268 N5-F7268 ATAATTTGCAGACACTCCCGCCAT rs-f14788 AAAATTTACATGTAAAACAAA 7372 N5-R7372 TGCGTTAGTTCATTCTTCTAC rs-f14812 AAATTAAACTTTATAAATCAT 7381 N5-R7381 a CCTGTTTCTGCTTTAGTTCA AT-R15990 GATAAAGATTTCTTTTTATTT 7393 N5-F7393 GTAGAAGAATGAACTAACGCAG AT-R16003 CAATAATAAAAAAGATAAAGA 7697 N5-F7697 ACCAATCCTAACCCATCTCAACC a Primers used are listed in the papers of Aubert et al., 1999; Caterino and Sperling, 1999; Yagi et al., 1999; Simmons and Weller, 2001
8 Volume 121, Number 3, May and June Figure 2. Control region of Agehana maraho. The PCR product was amplified by using primer pairs of rs-f14657 and tm-r32. Poly-T and TA repeat were showed in Region 1 and Unit 2, respectively. Figure 3. Conserved region of the control region among 11 investigated lepidopteran mitogenomes the Agehana CR was difficult because the repeat region is over 1,000bp. Finally, we used the primers tm-r32 and rs-r14125 to amplify and count the repeat number to confirm the full length. Besides the CR (spacer 14), 13 non-coding regions were found in the Agehana mitogenome (Table 2): spacer 1 between trna-gln and nad2 (47bp); spacer 2 between trna-cys and trna-tyr (4bp); spacer 3 between trna-tyr and cox1 (2bp); spacer 4 between atp6 and cox3 (3bp); spacer 5 between cox3 and trna- Gly (2bp); spacer 6 between nad3 and trna-ala (2bp); spacer 7 between trna- Ser (AGN) and trna-glu (1bp); spacer 8 between nad5 and trna-his (15bp); spacer 9 between nad4l and trna-thr (2bp); spacer 10 trna-pro and nad6 (2bp); spacer 11 between nad6 and cob (14bp); spacer 12 between trna-
9 274 ENTOMOLOGICAL NEWS Table 2. The organization of Agehana mitogenome. * denotes incomplete stop codon. Start/Stop Gene Direction Length Position codons Notes trna Met (M) F trna Ile (I) F nt overlap at 3' trna Gln R nt overlap at 3' Spacer nad2 F ATT/TAA 2nt overlap at 3' trna Trp F nt overlap at 5' and 7nt overlap at 3' trna Cys R bp overlap at 3' Spacer trna Tyr R Spacer 3 F cox1 F CGA/T* trna Leu(UUR) F cox2 F ATG/T* trna Lys F nt overlap at 3' trna Asp F nt overlap at 5' atp8 F ATT/TAA 7nt overlap at 3' atp6 F ATG/TAA 7nt overlap at 5' Spacer cox3 F ATG/TAA Spacer trna Gly F nad3 F ATA/TAA Spacer trna Ala F nt overlap at 3' trna Arg F nt overlap at 5' and 1nt overlap at 3' trna Asn F nt overlap at 5' trna Ser(AGN) F Spacer trna Glu F nt overlap at 3' trna Phe R nt overlap at 5' nad5 R ATT/TA* Spacer trna His R nad4 R ATG/T* 1nt overlap at 3' nad4l R ATG/TAA 1nt overlap at 5' Spacer trna Thr F trna Pro R Spacer nad6 F ATC/TAA Spacer Cob F ATG/TAA 2nt overlap at 3' trna Ser(UCN) F nt overlap at 5' Spacer nad1 R ATG/TAG Spacer trna Leu(CUN) R rrnl R trna Val R rrns R Spacer
10 Volume 121, Number 3, May and June Ser (UCN) and nad1 (16bp); spacer 13 between nad1 and trna-leu (CUN) (1bp). In common with other lepidopteran mitogenomes, spacer 1 is a feature of over 45bp, but this spacer is absent in other insects. Spacers ( 2-6, 8-10, and 13) have also been found in most Lepidoptera mitogenomes and show some length variation from 0 to 23bp but less variation occurs between related species (e.g. in Bombyx and Ostrinia). Microsatellite-like regions were not found in 13 non-coding regions of the Agehana mitogenome, but were found in the Bombyx and Manduca mitogenomes in the regions of spacers 6 and 11, and the regions between trna-ala and trna-arg (Bombyx), between trna-his and nad4 (Bombyx), and between nad4 and nad4l (Manduca sexta). Spacer 12 is also a common feature among the 13 investigated lepidopteran species. The domain CTAAAAA- TA has been detected in several other insects (Cameron and Whiting, 2008). PCGs Conventional start codons could be assigned to 8 of Met and 4 of Ile (Table 2) in the Agehana mitogenome. However, the start codon of the cox1 gene is still unclear in several arthropod species (Wolstenholme, 1992). Based on comparisons with Bombyx mitogenomes, the Agehana open reading frame (ORF) starts at a CGA (Arginine) codon, and the codon before this triplet is a TAA stop codon. In Drosophila species, the first tetraplet of cox1 ATAA was proposed as the first codon (Clary and Wolstenholme, 1985). Currently, most lepidopteran mitogenomes, including Agehana maraho, are also proposed to have the tetraplet ATAA as the initiating codon of the cox1 gene (Clary and Wolstenholme, 1983; Kim et al., 2006), but by contrast in the mitogenome of Saturnia (Rinaca) boisduvalii, TTG has been proposed as the start codon (Hong et al., 2008; as Caligula boisduvalii). Conventional stop codons (TAA or TAG) could be assigned to most of the putative protein sequences of Agehana maraho. Only cox1, cox2, and nad4 genes were terminated with a single T residue, which implies that a complete termination signal is produced after polyadenylation of the transcript (Oyala et al., 1981). trnas and rrnas There were 22 trnas found: 21 trnas, as determined by trnascanse 1.21 (Lowe and Eddy, 1997), with trna-ser (AGN) being found through comparison with the mitogenome of Bombyx mori (mainly) and other Lepidoptera. All the trnas except for the trna-ser (AGN) have the clover-leaf structure. The trna- Ser (AGN) lacks the DHC arm found in many metazoan species (Wolstenholme, 1992). In 13 previously investigated lepidopteran mitogenomes, one extra trna was found only in Coreana raphaelis, whose extra copy of trna-ser (AGN) is placed between original trna-ser (AGN) and trna- Glu (Kim et al., 2006). In 13 mitogenomes, less variation was found in the trna structure of the acceptor stem and the anticodon arm, than in regions of the DHC arm, TψC arm, and variable loop. These differences may be related to their functional constraints.
11 276 ENTOMOLOGICAL NEWS Table 3. Nucleotide compositional bias by regions. Length %T %C %A %G %AT All sites (J strand) Protein coding First codon Second codon Third codon atp atp cob cox cox cox nad nad nad nad nad4l nad nad Ribosonal RNAs rrnl rrns trna Noncoding region Control Region Table 4. Genetic variation among 13 investigated lepidopteran mitogenomes. V: number of variable sites (%); I: number of informative sites (%) Aligned Lepidoptera Bombycoidea a Papilionoidea b Gene length V I V I V atp (45.9%) 235(34.70%) 184(27.10%) 112(16.50%) 182(26.80%) atp (42.0%) 55(31.60%) 70(40.20%) 35(20.10%) 54(31.00%) Cob (44.0%) 361(30.90%) 324(27.80%) 140(12.00%) 320(27.40%) cox (37.4%) 398(25.90%) 343(22.30%) 159(10.30%) 315(20.50%) cox (37.0%) 160(23.50%) 145(21.30%) 63(9.20%) 133(19.50%) cox (47.9%) 260(32.80%) 238(30.10%) 115(14.50%) 240(30.30%) nad (46.5%) 305(32.20%) 250(26.40%) 124(13.10%) 292(30.80%) nad (51.2%) 375(36.50%) 304(29.60%) 151(14.70%) 296(28.80%) nad (51.4%) 125(35.30%) 98(27.70%) 51(14.40%) 125(35.30%) nad (47.0%) 470(33.20%) 403(28.50%) 157(11.10%) 398(28.10%) nad4l (46.3%) 90(30.60%) 72(24.50%) 33(11.20%) 85(28.90%) nad (45.1%) 529(29.80%) 458(25.80%) 228(12.80%) 465(26.20%) nad (59.7%) 246(44.10%) 206(36.90%) 102(18.30%) 219(39.20%) rrnl (33.2%) 348(22.80%) 338(22.20%) 175(11.50%) 294(19.30%) rrns (15.3%) 79(9.40%) 137(16.30%) 71(8.40%) 177(21.00%) a Bombyx mori, B. mandarina, Antheraea pernyi, Manduca sexta, Saturnia boisduvalii b Pieris melete, Corena raphaelis, Agehana maraho
12 Volume 121, Number 3, May and June The genes rrnl (1523bp) and rrns (842bp) of Agehana maraho are located between trna-leu (CUN) and trna-val, and between trna-val and the CR, respectively. In 13 investigated lepidopteran mitogenomes, most variable regions were found in loop rather then stem regions. Even a microsatellite-like structure has been found in the mitogenome of Manduca sexta (Cameron and Whiting, 2008). Sequence and length variation Mitochondrial sequences are one of the most widely used markers for fast species identification (Avise et al., 1987; Hebert et al., 2004) and are also used for determining species relationships (Caterino et al., 2000). The regions of partial cox1 (Hebert et al., 2003) and the CR (Vila and Björklund, 2004; Roux-Morabito et al., 2008) are often preferred for analyzing the relationships of closely related species. Variation in other parts of the mitogenome is often arbitrarily ignored for such purposes. This is quite different from the situation in plants, where for the purposes of establishing suitable regions for barcoding and as a result of low variation in cox1, more comprehensive analyses of variation in plastid and other genomes were carried out (e.g. Fazekas et al., 2008). The first comprehensive search for regions more variable than the 5' cox1 barcode region that is usually used in Lepidoptera involved the comparison of eight lepidopteran mitogenomes (Cameron and Whiting, 2008). This study concluded that, for studies at lower taxonomic levels, the regions from atp8 to nad3 and cob to nad6 have far more variable sites than the workhorse region of cox1 to cox2. Similar results were obtained in our analysis, in which the number of mitogenomes compared was increased to 13 (Table 4). Although not regions formally proposed as barcoding markers in animals, these two studies agree that the genes atp8, atp6, and nad6 are strong alternatives to cox1 for identifying closely related species. In particular, they have a higher proportion of informative sites per variable site (>73%) than either the entire cox1 gene (69%) or just the 5' barcode region (68.5%, 161 informative sites in 235 variable sites of 660bp) (Table 4). The length variation in the CR has also led to its consideration as a useful genetic marker for studies of population genetics or to explore the relationships of closely related species (Schultheis et al., 2002; Vila and Björklund, 2004), and micro repeats are found to be more variable than sequence mutations (Zhang and Hewitt, 1997). The CR of Agehana maraho exhibits patterns of both macro and micro repeats and further analysis of this variation among populations may provide a useful tool in the conservation genetics of this near-threatened butterfly. ACKNOWLEDGMENTS This study was supported by the Council of Agriculture (Taiwan) grants 91AS FC-R1, 92AS FC-R1, 93AS FB-e2, and 94AS FB-e1. One of the authors (DCL) was supported by a STUDIUM fellowship.
13 278 ENTOMOLOGICAL NEWS LITERATURE CITED Aubert, J., L. Legal, H. Descimon, and F. Michel Molecular phylogeny of swallowtail butterflies of the tribe Papilionini (Papilionidae, Lepidoptera). Molecular Phylogenetics and Evolution 12: doi: /mpev Avise, J. C Phylogeography: The history and formation of species. Harvard University Press. Cambridge, MA. 477 pp. Avise, J. C Molecular markers, natural history, and evolution (2nd ed). Sinauer Associates. Sunderland, MA. 684 pp. Avise, J. C., J. Arnold, R. M. Ball, E. Bermingham, T. Lamb, J. E. Neigel, C. A. Reeb, and N. C. Saunders Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology, Evolution, and Systematics 18: doi: /annurev.es Boore, J. L Animal mitochondrial genomes. Nucleic Acids Research 27: Brown, W., M. Geogre Jr., and A. C. Wilson Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences 76: Cameron, S. L. and M. F. Whiting The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 408: doi: /j.gene Caterino, M. S., S. Cho, and F. A. H. Sperling The current state of insect molecular systematics: A thriving Tower of Babel. Annual Review of Entomology 45:1-54. doi: / annurev.ento Caterino, M. S. and F. A. H. Sperling Papilio phylogeny based on mitochondrial cytochrome oxidase I and II genes. Molecular Phylogenetics and Evolution 11: doi: /mpev Cheng, H. C., C. T. Yao, H. C. Lin, T. W. Li, L. H. Lin, C. F. Lu, Y. L. Yang, and C. Y. Lai A Guide to Endangered Wild Animals. Taiwan Endemic Species Research Center. Chichi. 319 pp. (in Chinese) Chou, I A Colored Guide to Chinese Butterflies (Revised Edition), Vol. 1. Henan Scientific and Technological Publishing House. Zhenzhou. 408 pp. (in Chinese) Clary, D. O. and D. R. Wolstenholme Genes for cytochrome c oxidase subunit I, URF2, and three trnas in Drosophila mitochondrial DNA. Nucleic Acids Research 11: Clary, D. O. and D. R. Wolstenholme The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. Journal of Molecular Evolution 22: Coates, B. S., D. V. Sumerford, R. L. Hellmich, and L. C. Lewis Partial mitochondrial genome sequences of Ostrinia nubilalis and Ostrinia furnicalis. International Journal of Biological Sciences 1: Crease, T. J The complete sequence of the mitochondrial genome of Daphnia pulex (Cladocera: Crustacea). Gene 233: doi: /s (99) D Abrera, B Butterflies of the Oriental Region, Part I. Hill House Publishers. London. 244 pp. Fazekas, A. J., K. S. Burgess, P. R. Kesanakurti, S. W. Graham, S. G. Newmaster, B. C. Husband, D. M. Percy, M. Hajibabaei, and S. C. H. Barrett Multiple multilocus DNA barcodes form the plastid genome discriminate plant species equally well. PLoS ONE 3:e2802. doi: /journal.pone Grimaldi, D. and M. S. Engel Evolution of the insects. Cambridge University Press. Cambridge. 755 pp. Hancock, D. L Classification of the Papilionidae (Lepidoptera): A phylogenetic approach. Smithersia 2:1-48.
14 Volume 121, Number 3, May and June Hebert, P. D. N., E. H. Penton, J. M. Burns, D. H. Janzen, and W. Hallwachs Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences 101: doi: / pnas Hebert, P. D. N., S. Ratnasingham, and J. R. dewaard Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B: Biological Sciences 270: doi: /rsbl Hong, M. Y., E. M. Lee, Y. H. Jo, H. C. Park, S. R. Kim, J. S. Hwang, B. R. Jin, P. D. Kang, K. G. Kim, Y. S. Han, and I. Kim Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects. Gene 413: doi: /j.gene Hsu, Y. F Butterflies of Taiwan, Vol. 3. Phoenix Park. Luku. 404 pp. (in Chinese) Igarashi, S Papilionidae and Their Early Stages. Kodansha. Tokyo. 218 pp. (in Japanese) Igarashi, S The classification of the Papilionidae mainly based on the morphology of their immature stage. Tyô To Ga 34: (in Japanese) Igarashi, S. and H. Fukuda The life histories of Asian butterflies, Vol. I. Tokai University Press. Tokyo. 549 pp. UCN IUCN Red List of threatened Species. Version Available from iucnredlist.org Accessed 21 June Kim, I., S. Y. Cha, M. H. Yoon, J. S. Hwang, S. M. Lee, H. D. Sohn, and B. R. Jin The complete nucleotide sequence and gene organization of the mitochondrial genome of the oriental mole cricket, Gryllotalpa orientalis (Orthoptera: Gryllotalpidae). Gene 353: doi: /j.gene Kim, I., E. M. Lee, K. Y. Seol, E. Y. Yun, Y. B. Lee, J. S. Hwang, and B. R. Jin The mitochondrial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae). Insect Molecular Biology 15: doi: /j x. Kumar, S., K. Tamura, and M. Nei MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5: doi: /bib/ Lee, E. S., K. S. Shin, M. S. Kim, H. Park, S. Cho, and C. B. Kim The mitochondrial genome of the smaller tea tortrix Adoxophyes honmai (Lepidoptera: Tortricidae). Gene 373:52-7. doi: /j.gene Lowe, T. M. and S. R. Eddy trnascan-se: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: Lu, C.C., L. W. Wu, G. F. Jiang, H. L. Deng, L. H. Wang, P. S. Yang, and Y. F. Hsu Systematic status of Agehana elwesi f. cavaleriei based on morphological and molecular evidence. Zoological Studies 48: Munroe, E The classification of the Papilionidae (Lepidoptera). Canadian Entomologist Supplement 17:1-51. Nie, Z. L., J. Wen, and H. Sun Phylogeny and biogeography of Sassafras (Lauraceae) disjunct between eastern Asia and eastern North America. Plant Systematics and Evolution 267: doi: /s Oyala, D., J. Montoya, and G. Attardi trna punctuation model of RNA processing in human mitochondria. Nature 290: doi: /290470a0. Roux-Morabito, G., N. E. Gillette, A. Roques, L. Dormont, J. Stein, and F. A. H. Sperling Systematics of the Dioryctria abietella species group (Lepidoptera: Pyralidae) based on mitochondrial DNA. Annals of Entomological Society of America 101: doi: / (2008)101. Rozas, J., J. C. Sanchez-DelBarrio, X. Messeguer, and R. Rozas DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: doi: / bioinformatics/btg359.
15 280 ENTOMOLOGICAL NEWS Saito, S., K. Tamura, and T. Aotsuka Replication origin of mitochondrial DNA in insects. Genetics 171: doi: /genetics Salvato, P., M. Simonato, A. Battisti, and E. Negrisolo The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Genomics 9:331. doi: / Schultheis, A.S., L. A. Weigt, and A. C. Hendricks Arrangement and structural conservation of the mitochondrial control region of two species of Plecoptera: utility of tandem repeat-containing regions in studies of population genetics and evolutionary history. Insect Molecular Biology 11: doi: /j x. Shirôzu, T Butterflies of Formosa in colour. Hoikusha. Osaka. 481 pp. (in Japanese) Simmons, R. B. and S. J. Weller Utility and evolution of cytochrome b in insects. Molecular Phylogenetics and Evolution 20: doi: /mpev Snäll, N., K. Huoponen, M. L. Savontaus, and K. Puohomäki Tandem repeats and length variation in the mitochondrial DNA control region of Epirrita autumnata (Lepidoptera: Geometridae). Genome 45: doi: /g Sperling, F. A. H Mitochondrial DNA phylogeny, speciation, and hostplant coevolution of Papilio butterflies. Dissertation, Cornell University. 132 pp. Tseng, C. S The systematics of Papilionini (Lepidoptera: Papilionidae). Dissertation, National Taiwan University. Taylor, M. F., S. W. McKechnie, N. Pierce, and M. Kreitman The lepidopteran mitochondrial control region: structure and evolution. Molecular Biology and Evolution 10: Vila, M. and M. Björklund The utility of the neglected mitochondrial control region for evolutionary studies in Lepidoptera (Insecta). Journal of Molecular Evolution 58: doi: /s Wang, L. H., C. C. Lu, L. W. Wu, C. R. Chen, and Y. F. Hsu New discoveries on biology of Agehana maraho in Taiwan. The Nature and Insects 42: (in Japanese) Wang, L. H Study on ecological requirements and behaviors of Agehana maraho. Dissertation, National Taiwan Normal University. 46 pp. Wolstenholme, D. R Animal mitochondrial DNA: structure and evolution. International Review of Cytology 141: Yagi, T., G. Sasaki, and H. Takebe Phylogeny of Japanese papilionid butterflies inferred from nucleotide sequences of the mitochondrial ND5 gene. Journal of Molecular Evolution 48: doi: /pl Yen, S. H. and P. S. Yang Illustrated Identification Guide to Insects Protected by the CITES and Wildlife Conservation Law of Taiwan. Agriculture Council, Executive Yuan. Taipei. 176 pp. Yukuhiro, K., H. Sezutsu, M. Itoh, K. Shimizu, and Y. Banno Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori. Molecular Biology and Evolution 19: Zakharov, E. V., M. S. Caterino, and F. A. H. Sperling Molecular phylogeny, historical biogeography, and divergence time estimates for swallowtail butterflies of the genus Papilio (Lepidoptera: Papilionidae). Systematic Biology 53: doi: / Zhang, D. X. and G. M. Hewitt Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochemical Systematics and Ecology 25: doi: /s (96)
Corresponding author: J.S. Hao / Q. Yang /
Complete mitochondrial genomes of the Bright Sunbeam Curetis bulis and the Small Copper Lycaena phlaeas (Lepidoptera: Lycaenidae) and their phylogenetic implications L.L. Zhang 1, J.S. Hao 1,2, D.Y. Huang
More informationComplete nucleotide sequence and organization of the mitogenome of endangered Eumenis autonoe (Lepidoptera: Nymphalidae)
African Journal of Biotechnology Vol. 9(5), pp. 735-754, 1 February 2010 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2010 Academic Journals Full Length Research Paper Complete
More informationTranslation. A ribosome, mrna, and trna.
Translation The basic processes of translation are conserved among prokaryotes and eukaryotes. Prokaryotic Translation A ribosome, mrna, and trna. In the initiation of translation in prokaryotes, the Shine-Dalgarno
More informationFrom Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
More informationThe complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Nymphalidae)
Mol Biol Rep (2012) 39:6529 6536 DOI 10.1007/s11033-012-1481-7 The complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Nymphalidae) Min Zhang Xinping Nie Tianwen Cao Juping Wang
More informationIntroduction to the Ribosome Overview of protein synthesis on the ribosome Prof. Anders Liljas
Introduction to the Ribosome Molecular Biophysics Lund University 1 A B C D E F G H I J Genome Protein aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa10 aa9 aa8 aa11 aa12 aa13 a a 14 How is a polypeptide synthesized? 2
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationA minimalist barcode can identify a specimen whose DNA is degraded
Molecular Ecology Notes (2006) 6, 959 964 doi: 10.1111/j.1471-8286.2006.01470.x Blackwell Publishing Ltd BARCODING A minimalist barcode can identify a specimen whose DNA is degraded MEHRDAD HAJIBABAEI,*
More informationHow Molecules Evolve. Advantages of Molecular Data for Tree Building. Advantages of Molecular Data for Tree Building
How Molecules Evolve Guest Lecture: Principles and Methods of Systematic Biology 11 November 2013 Chris Simon Approaching phylogenetics from the point of view of the data Understanding how sequences evolve
More informationAmy Driskell. Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC
DNA Barcoding Amy Driskell Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC 1 Outline 1. Barcoding in general 2. Uses & Examples 3. Barcoding Bocas
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationAdvanced Topics in RNA and DNA. DNA Microarrays Aptamers
Quiz 1 Advanced Topics in RNA and DNA DNA Microarrays Aptamers 2 Quantifying mrna levels to asses protein expression 3 The DNA Microarray Experiment 4 Application of DNA Microarrays 5 Some applications
More informationMolecular Markers, Natural History, and Evolution
Molecular Markers, Natural History, and Evolution Second Edition JOHN C. AVISE University of Georgia Sinauer Associates, Inc. Publishers Sunderland, Massachusetts Contents PART I Background CHAPTER 1:
More informationLeber s Hereditary Optic Neuropathy
Leber s Hereditary Optic Neuropathy Dear Editor: It is well known that the majority of Leber s hereditary optic neuropathy (LHON) cases was caused by 3 mtdna primary mutations (m.3460g A, m.11778g A, and
More informationLecture 15: Realities of Genome Assembly Protein Sequencing
Lecture 15: Realities of Genome Assembly Protein Sequencing Study Chapter 8.10-8.15 1 Euler s Theorems A graph is balanced if for every vertex the number of incoming edges equals to the number of outgoing
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationEnergy and Cellular Metabolism
1 Chapter 4 About This Chapter Energy and Cellular Metabolism 2 Energy in biological systems Chemical reactions Enzymes Metabolism Figure 4.1 Energy transfer in the environment Table 4.1 Properties of
More informationOrganic Chemistry Option II: Chemical Biology
Organic Chemistry Option II: Chemical Biology Recommended books: Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: stuart.conway@chem.ox.ac.uk Teaching
More informationPacking of Secondary Structures
7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary
More informationAoife McLysaght Dept. of Genetics Trinity College Dublin
Aoife McLysaght Dept. of Genetics Trinity College Dublin Evolution of genome arrangement Evolution of genome content. Evolution of genome arrangement Gene order changes Inversions, translocations Evolution
More informationProteins: Characteristics and Properties of Amino Acids
SBI4U:Biochemistry Macromolecules Eachaminoacidhasatleastoneamineandoneacidfunctionalgroupasthe nameimplies.thedifferentpropertiesresultfromvariationsinthestructuresof differentrgroups.thergroupisoftenreferredtoastheaminoacidsidechain.
More informationPhylogenetic Analysis of Reticulitermes speratus using the Mitochondrial Cytochrome C Oxidase Subunit I Gene* 1
Mokchae Konghak 38(2) : 135~139, 2010 Phylogenetic Analysis of Reticulitermes speratus using the Mitochondrial Cytochrome C Oxidase Subunit I Gene* 1 Moon Jung Cho* 2, Keum Shin* 2, Young-Kyoon Kim* 2,
More informationProperties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but not the only one!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids repeated
More informationFrom gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
More informationTypes of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.
RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic
More informationMassachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution
Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationComplete mitochondrial genome of the Amur hedgehog Erinaceus amurensis (Erinaceidae) and higher phylogeny of the family Erinaceidae
Complete mitochondrial genome of the Amur hedgehog Erinaceus amurensis (Erinaceidae) and higher phylogeny of the family Erinaceidae N.H. Kim, S.J. Lim, H.M. Chae and Y.C. Park Division of Forest Science,
More informationLesson Overview. Ribosomes and Protein Synthesis 13.2
13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationSEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA
SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationProtein structure. Protein structure. Amino acid residue. Cell communication channel. Bioinformatics Methods
Cell communication channel Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu SEQUENCE STRUCTURE DNA Sequence Protein Sequence Protein Structure Protein structure ATGAAATTTGGAAACTTCCTTCTCACTTATCAGCCACCT...
More informationThe translation machinery of the cell works with triples of types of RNA bases. Any triple of RNA bases is known as a codon. The set of codons is
Relations Supplement to Chapter 2 of Steinhart, E. (2009) More Precisely: The Math You Need to Do Philosophy. Broadview Press. Copyright (C) 2009 Eric Steinhart. Non-commercial educational use encouraged!
More informationMicrobiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationDNA Barcoding and taxonomy of Glossina
DNA Barcoding and taxonomy of Glossina Dan Masiga Molecular Biology and Biotechnology Department, icipe & Johnson Ouma Trypanosomiasis Research Centre, KARI The taxonomic problem Following ~250 years of
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationRNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
More informationThe Journal of Animal & Plant Sciences, 28(5): 2018, Page: Sadia et al., ISSN:
The Journal of Animal & Plant Sciences, 28(5): 2018, Page: 1532-1536 Sadia et al., ISSN: 1018-7081 Short Communication BIOINFORMATICS ANALYSIS OF CODON USAGE BIAS AND RNA SECONDARY STRUCTURES FOR SALT
More informationObjective: You will be able to justify the claim that organisms share many conserved core processes and features.
Objective: You will be able to justify the claim that organisms share many conserved core processes and features. Do Now: Read Enduring Understanding B Essential knowledge: Organisms share many conserved
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationMiller & Levine Biology 2014
A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationGENETICS - CLUTCH CH.11 TRANSLATION.
!! www.clutchprep.com CONCEPT: GENETIC CODE Nucleotides and amino acids are translated in a 1 to 1 method The triplet code states that three nucleotides codes for one amino acid - A codon is a term for
More informationMidterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.
Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer
More informationVideos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationUsing Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell
Using Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell Mathematics and Biochemistry University of Wisconsin - Madison 0 There Are Many Kinds Of Proteins The word protein comes
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationInvestigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
More informationViewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
More informationSpecies Identification and Barcoding. Brendan Reid Wildlife Conservation Genetics February 9th, 2010
Species Identification and Barcoding Brendan Reid Wildlife Conservation Genetics February 9th, 2010 Why do we need a genetic method of species identification? Black-knobbed Map Turtle (Graptemys nigrinoda)
More informationIntroduction to Lepidoptera
Introduction to Lepidoptera Taxonomic Workshop for Early Detection of Important Tortricidae and Other Lepidopteran Agricultural and Silvicultural Pests UMass Amherst 15-17 July 2013 Todd M. Gilligan, Ph.D.
More informationHiromi Nishida. 1. Introduction. 2. Materials and Methods
Evolutionary Biology Volume 212, Article ID 342482, 5 pages doi:1.1155/212/342482 Research Article Comparative Analyses of Base Compositions, DNA Sizes, and Dinucleotide Frequency Profiles in Archaeal
More information1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
More informationIdentification of COI partial sequences in two closely related frog species, Rana dalmatina and Rana temporaria
HERPETOLOGICA ROMANICA Vol. 4, 2010, pp.1-6 ISSN: 1842-9203 Article No. 041101 Identification of COI partial sequences in two closely related frog species, Rana dalmatina and Rana temporaria Béla MAROSI
More informationSupplementary Information. Broad Spectrum Anti-Influenza Agents by Inhibiting Self- Association of Matrix Protein 1
Supplementary Information Broad Spectrum Anti-Influenza Agents by Inhibiting Self- Association of Matrix Protein 1 Philip D. Mosier 1, Meng-Jung Chiang 2, Zhengshi Lin 2, Yamei Gao 2, Bashayer Althufairi
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationOMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More information9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationName Block Date Final Exam Study Guide
Name Block Date Final Exam Study Guide Unit 7: DNA & Protein Synthesis List the 3 building blocks of DNA (sugar, phosphate, base) Use base-pairing rules to replicate a strand of DNA (A-T, C-G). Transcribe
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationProtein Fragment Search Program ver Overview: Contents:
Protein Fragment Search Program ver 1.1.1 Developed by: BioPhysics Laboratory, Faculty of Life and Environmental Science, Shimane University 1060 Nishikawatsu-cho, Matsue-shi, Shimane, 690-8504, Japan
More informationTRANSLATION: How to make proteins?
TRANSLATION: How to make proteins? EUKARYOTIC mrna CBP80 NUCLEUS SPLICEOSOME 5 UTR INTRON 3 UTR m 7 GpppG AUG UAA 5 ss 3 ss CBP20 PABP2 AAAAAAAAAAAAA 50-200 nts CYTOPLASM eif3 EJC PABP1 5 UTR 3 UTR m 7
More informationUNIT TWELVE. a, I _,o "' I I I. I I.P. l'o. H-c-c. I ~o I ~ I / H HI oh H...- I II I II 'oh. HO\HO~ I "-oh
UNT TWELVE PROTENS : PEPTDE BONDNG AND POLYPEPTDES 12 CONCEPTS Many proteins are important in biological structure-for example, the keratin of hair, collagen of skin and leather, and fibroin of silk. Other
More informationIntroduction to Biosystematics - Zool 575
Introduction to Biosystematics Lecture 8 - Modern Taxonomy Outline - 1. Tools - digital imaging, databases 2. Dissemination - WWW 3. Tools - Molecular data, species demarcation, phylogeography 1 2 Prognosis
More information9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationChapter
Chapter 17 17.4-17.6 Molecular Components of Translation A cell interprets a genetic message and builds a polypeptide The message is a series of codons on mrna The interpreter is called transfer (trna)
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More information7.05 Spring 2004 February 27, Recitation #2
Recitation #2 Contact Information TA: Victor Sai Recitation: Friday, 3-4pm, 2-132 E-mail: sai@mit.edu ffice ours: Friday, 4-5pm, 2-132 Unit 1 Schedule Recitation/Exam Date Lectures covered Recitation #2
More informationDeciphering the Molecular Phylogenetics of Family Hyblaeidae and Inferring the Phylogeographical Relationships Using DNA Barcoding
Journal of Genetics and Molecular Biology Vol. 19, No. 3, 158-167, September 1, 2008 Deciphering the Molecular Phylogenetics of Family Hyblaeidae and Inferring the Phylogeographical Relationships Using
More informationDegeneracy. Two types of degeneracy:
Degeneracy The occurrence of more than one codon for an amino acid (AA). Most differ in only the 3 rd (3 ) base, with the 1 st and 2 nd being most important for distinguishing the AA. Two types of degeneracy:
More informationRanjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013
Hydration of protein-rna recognition sites Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India 1 st November, 2013 Central Dogma of life DNA
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationJisha Krishnan and Sebastian, IJALS, Volume (8) Issue (2) May RESEARCH ARTICLE
Analysis of evolutionary divergence of Neurothemis tullia (Odonata:Libellulidae) using cytochrome oxidase subunit I gene E.K. Jisha Krishnan and C.D. Sebastian Molecular Biology Laboratory, Department
More informationSupplemental Materials
JOURNAL OF MICROBIOLOGY & BIOLOGY EDUCATION, May 2013, p. 107-109 DOI: http://dx.doi.org/10.1128/jmbe.v14i1.496 Supplemental Materials for Engaging Students in a Bioinformatics Activity to Introduce Gene
More informationEvolutionary Analysis of Viral Genomes
University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More informationSequence Alignments. Dynamic programming approaches, scoring, and significance. Lucy Skrabanek ICB, WMC January 31, 2013
Sequence Alignments Dynamic programming approaches, scoring, and significance Lucy Skrabanek ICB, WMC January 31, 213 Sequence alignment Compare two (or more) sequences to: Find regions of conservation
More informationSupplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two
Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for
More informationGeometrical Concept-reduction in conformational space.and his Φ-ψ Map. G. N. Ramachandran
Geometrical Concept-reduction in conformational space.and his Φ-ψ Map G. N. Ramachandran Communication paths in trna-synthetase: Insights from protein structure networks and MD simulations Saraswathi Vishveshwara
More informationPhysiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
More informationPROTEIN SECONDARY STRUCTURE PREDICTION: AN APPLICATION OF CHOU-FASMAN ALGORITHM IN A HYPOTHETICAL PROTEIN OF SARS VIRUS
Int. J. LifeSc. Bt & Pharm. Res. 2012 Kaladhar, 2012 Research Paper ISSN 2250-3137 www.ijlbpr.com Vol.1, Issue. 1, January 2012 2012 IJLBPR. All Rights Reserved PROTEIN SECONDARY STRUCTURE PREDICTION:
More informationTranslation. Genetic code
Translation Genetic code If genes are segments of DNA and if DNA is just a string of nucleotide pairs, then how does the sequence of nucleotide pairs dictate the sequence of amino acids in proteins? Simple
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/65602 holds various files of this Leiden University dissertation. Author: Ruchisansakun, S. Title: Balsaminaceae in Southeast Asia: systematics, evolution,
More informationModel Mélange. Physical Models of Peptides and Proteins
Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.
More informationMajor questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
More information2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW
Name: Period: 2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW 1. List the characteristics of living things. (p 7) 2. Use the Aquatic Food Web above to answer the following questions (Ch. 2) a. Which
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationBig Idea 1: Does the process of evolution drive the diversity and unit of life?
AP Biology Syllabus 2016-2017 Course Overview: AP Biology is equivalent to an introductory college level biology program in order to develop student led inquiry into science. The class is designed to go
More informationAnalysis of putative DNA barcodes for identification and distinction of native and invasive plant species
Babson College Digital Knowledge at Babson Babson Faculty Research Fund Working Papers Babson Faculty Research Fund 2010 Analysis of putative DNA barcodes for identification and distinction of native and
More informationSnork Synthesis Lab Lab Directions
Snork Synthesis Lab Lab Directions This activity, modified from the original at The Biology Corner, will help you practice your understanding of protein synthesis. Submit your lab answers according to
More informationELECTRONIC APPENDIX. This is the Electronic Appendix to the article
ELECTRONIC APPENDIX This is the Electronic Appendix to the article Mitochondrial genomes suggest that hexapods and crustaceans are mutually paraphyletic by Charles E. Cook, Qiaoyun Yue, Michael Akam Proc.
More informationOn the optimality of the standard genetic code: the role of stop codons
On the optimality of the standard genetic code: the role of stop codons Sergey Naumenko 1*, Andrew Podlazov 1, Mikhail Burtsev 1,2, George Malinetsky 1 1 Department of Non-linear Dynamics, Keldysh Institute
More information