Marcelo Fernández-Viña

Size: px
Start display at page:

Download "Marcelo Fernández-Viña"

Transcription

1 Marcelo Fernández-Viña Histocompatibility, Immunogenetics and Disease Profiling Laboratory Stanford Blood Center Applications of NGS in Immunogenetics HLA Typing KIR Typing Blood Group Typing Engraftment tests HLA expression 2 KIR typing Nelson WC, Pyo CW, Vogan D, Wang R, Pyon YS, Hennessey C, Smith A, Pereira S, Ishitani A, Geraghty DE. An integrated genotyping approach for HLA and other complex genetic systems. Hum Immunol Dec;76(12): doi: /j.humimm PubMed PMID:

2 KIR typing Selvaraj S, Schmitt AD, Dixon JR, Ren B. Complete haplotype phasing of the MHC and KIR loci with targeted HaploSeq. BMC Genomics Nov 5;16:900. doi: /s PubMed PMID: ; PubMed Central PMCID: PMC KIR Norman PJ, Hollenbach JA, Nemat-Gorgani N, Marin WM, Norberg SJ, Ashouri E, Jayaraman J, Wroblewski EE, Trowsdale J, Rajalingam R, Oksenberg JR, Chiaroni J, Guethlein LA, Traherne JA, Ronaghi M, Parham P. Defining KIR and HLA Class I Genotypes at Highest Resolution via High-Throughput Sequencing. Am J Hum Genet Aug 4;99(2): doi: /j.ajhg PubMed PMID: ; PubMed Central PMCID: PMC

3 Figure 1. Pipeline for Analyzing Sequence Data from Highly Polymorphic and Structurally Divergent KIR Haplotypes(A) The PING (Pushing Immunogenetics to the Next Generation) pipeline has two broad arms and two modules. The first module (PING_gc) determines KIR... Paul J. Norman, Jill A. Hollenbach, Neda Nemat-Gorgani, Wesley M. Marin, Steven J. Norberg, Elham Ashouri, Jyothi Jayaraman, Emily E. Wroblewski, John Trowsdale, Raja Rajalingam, Jorge R. Oksenberg, Jacques Chiaroni, Lisbeth A. Guethlein, James A. Traherne, Mostafa Ronaghi, Peter Parham Defining KIR and HLA Class I Genotypes at Highest Resolution via High-Throughput Sequencing null, Volume 99, Issue 2, 2016, Figure 2. KIR Gene Copy-Number Genotype Determined by Read DepthThe ratio of reads mapping to a specific KIR gene to those mapping to KIR3DL3 can be used for calculating KIR copy number. The results from 97 samples are shown and sorted by ratio. KIR2DL4 (left)... Paul J. Norman, Jill A. Hollenbach, Neda Nemat-Gorgani, Wesley M. Marin, Steven J. Norberg, Elham Ashouri, Jyothi Jayaraman, Emily E. Wroblewski, John Trowsdale, Raja Rajalingam, Jorge R. Oksenberg, Jacques Chiaroni, Lisbeth A. Guethlein, James A. Traherne, Mostafa Ronaghi, Peter Parham Defining KIR and HLA Class I Genotypes at Highest Resolution via High-Throughput Sequencing null, Volume 99, Issue 2, 2016, Figure 3. The KIR Region Is >99.99% Covered by Sequence Data(A) Target KIR region on chromosome 19: the gene locations are shown in orange, and pseudogenes are shown in gray. The KIR region varies in gene content, and shown are examples of two frequent A an... Paul J. Norman, Jill A. Hollenbach, Neda Nemat-Gorgani, Wesley M. Marin, Steven J. Norberg, Elham Ashouri, Jyothi Jayaraman, Emily E. Wroblewski, John Trowsdale, Raja Rajalingam, Jorge R. Oksenberg, Jacques Chiaroni, Lisbeth A. Guethlein, James A. Traherne, Mostafa Ronaghi, Peter Parham Defining KIR and HLA Class I Genotypes at Highest Resolution via High-Throughput Sequencing null, Volume 99, Issue 2, 2016,

4 Figure 6. High-Resolution KIR Allele and Copy-Number Genotypes of 97 IHWG CellsFour examples of high-resolution allele and copy-number genotypes of KIR. Individual 1 (SP0010) is homozygous for the KIR A haplotype. Individual 2 (CB6B) has two different B haplot... Paul J. Norman, Jill A. Hollenbach, Neda Nemat-Gorgani, Wesley M. Marin, Steven J. Norberg, Elham Ashouri, Jyothi Jayaraman, Emily E. Wroblewski, John Trowsdale, Raja Rajalingam, Jorge R. Oksenberg, Jacques Chiaroni, Lisbeth A. Guethlein, James A. Traherne, Mostafa Ronaghi, Peter Parham Defining KIR and HLA Class I Genotypes at Highest Resolution via High-Throughput Sequencing null, Volume 99, Issue 2, 2016, Figure 7. Capture of HLA Class I Genes for High-Resolution Allele Genotyping(A) Shown is the read depth across each of the HLA class I genes from a representative sample (chosen by virtue of having a read number closest to the mean number of HLA-specific reads... Paul J. Norman, Jill A. Hollenbach, Neda Nemat-Gorgani, Wesley M. Marin, Steven J. Norberg, Elham Ashouri, Jyothi Jayaraman, Emily E. Wroblewski, John Trowsdale, Raja Rajalingam, Jorge R. Oksenberg, Jacques Chiaroni, Lisbeth A. Guethlein, James A. Traherne, Mostafa Ronaghi, Peter Parham Defining KIR and HLA Class I Genotypes at Highest Resolution via High-Throughput Sequencing null, Volume 99, Issue 2, 2016, Blood Groups Fichou Y, Mariez M, Le Maréchal C, Férec C. The experience of extended blood group genotyping by nextgeneration sequencing (NGS): investigation of patients with sickle-cell disease. Vox Sang Jul 21. doi: /vox [Epub ahead of print] PubMed PMID:

5 13 14 ABO Lang K, Wagner I, Schöne B, Schöfl G, Birkner K, Hofmann JA, Sauter J, Pingel J, Böhme I, Schmidt AH, Lange V. ABO allele-level frequency estimation based on populationscale genotyping by next generation sequencing. BMC Genomics May 20;17:374. doi: /s PubMed PMID: ; PubMed Central PMCID: PMC

6

7 ABO Typing Sample specific barcodes and sequencing adaptors are introduced during PCR, rendering the products suitable for direct sequencing on Illumina MiSeq or HiSeq instruments. Complete sequence coverage of exons 6 and 7 enables molecular discrimination of the ABO subgroups and many alleles. The workflow was applied to ABO genotype more than a million samples. Finally, sequence analysis revealed 287 distinct so far not described alleles of which the most abundant one was identified in 174 samples. 19 Aloisio M, Licastro D, Caenazzo L, Torboli V, D'Eustacchio A, Severini GM, Athanasakis E. A technical application of quantitative next generation sequencingfor chimerism evaluation. Mol Med Rep Oct;14(4): doi: /mmr PubMed PMID: ; PubMed Central PMCID: PMC NGS protocol was conducted, coupled with a custom bioinformatics pipeline, for chimerism quantification. Based on the technology of Ion AmpliSeq, a 44-amplicon custom chimerism panel was designed, and a custom bioinformatics pipeline dedicated to the genotyping and quantification of NGS data was coded. The custom chimerism panel allowed identification of an average of 16 informative recipient alleles. The limit of detection of the protocol was fixed at 1% due to the NGS background (<1%). The protocol followed the standardion AmpliSeq library preparation and I on Torrent Personal Genome Machineguidelines. Overall, the present study added to the scientific literature, identifying novel technical details for a possible future application of NGS for chimerism quantification. 21 7

8 Expression of HLA alleles 22 Nature Genetics 41, (2009) A genome-wide association study identifies variants in the HLA-DPlocus associated with chronic hepatitis B in Asians YoichiroKamatani, SukanyaWattanapokayakit, HidenoriOchi, TakahisaKawaguchi, Atsushi Takahashi, NaoyaHosono, Michiaki Kubo, Tatsuhiko Tsunoda, NaoyukiKamatani, HiromitsuKumada, Aekkachai Puseenam, Thanyachai Sura, YataroDaigo 1, Kazuaki Chayama, WasunChantratita, Yusuke Nakamura & Koichi Matsuda A Novel Variant Marking HLA-DP Expression Levels Predicts Recovery from Hepatitis B Virus Infection Rasmi Thomasa, Chloe L. Thio, Richard Apps,Ying Qa, Xiaojiang Gao, Darlene Marti, Judy L. Stein, Kelly A. Soderberg, M. Anthony Moody, James J. Goedert, Gregory D. Kirk, W. Keith Hoots, Steven Wolinsky and Mary Carrington Variation in the 3 untranslated region of HLA-DPB1 is associated with spontaneous clearance of hepatitis B virus in both Japanese and U.S. populations. The mechanism facilitating viral clearance may be related to the A G single-nucleotide polymorphism rs , which marks HLA-DP cell-surface expression. The rs g allele is associated with high expression of HLA-DP, and the rs a allele is associated with low expression. The 496GG genotype, which confers recessive susceptibility to HBV persistence, also associates in a recessive manner with significantly higher levels of HLA-DP surface protein and transcript level expression in healthy donors, suggesting that differences in expression of HLA-DP may increase the risk of persistent HBV infection. 8

9 HLA-DP surface protein levels correlate with the 496A/G genotype in the 3 UTR region of HLA-DPB1. Rasmi Thomas et al. J. Virol. 2012;86: HLA-DPB1 mrna levels correlate significantly with the 496A/G variant in the 3 UTR region of HLA-DPB1. Rasmi Thomas et al. J. Virol. 2012;86: High HLA-DP Expression and Graft-versus-Host Disease Effie W. Petersdorf, M.D., Mari Malkki, Ph.D., Colm O huigin, Ph.D., Mary Carrington, Ph.D., Ted Gooley, Ph.D., Michael D. Haagenson, M.S., Mary M. Horowitz, M.D., Stephen R. Spellman, M.B.S., Tao Wang, Ph.D., and Philip Stevenson, M.S. N Engl J Med 2015; 373: August 13, 2015DOI: /NEJMoa

10 DPB1 Genomic Structure, Associated DPB1 Single- Nucleotide-Polymorphism Haplotypes, and Resulting HLA-DP Expression. Fleischhauer K. N Engl J Med 2015;373: Hazard Ratios for Outcomes of HLA-DPB1 Mismatches in Transplant Recipients, According to the rs Allele Linked to the Mismatch. Petersdorf EW et al. N Engl J Med 2015;373: Probability of Grade II, III, or IV Acute Graft-versus-Host Disease. Petersdorf EW et al. N Engl J Med 2015;373:

11 DPB1 Genomic Structure, Associated DPB1 Single- Nucleotide-Polymorphism Haplotypes, and Resulting HLA-DP Expression. Fleischhauer K. N Engl J Med 2015;373: Expression of HLA alleles Define expression variants Determine variation at the RNA level NGS may provide additional specificity for further characerization of Genotypes Possible application for evaluation in tissue expression 32 Summary KIR and Blood Group Typing has been developed Test Formats and combinations with HLA typing Quantitation and Expression studies could be applied in the clinical routine setting 33 11

NK cells are part of the innate immune response. Early response to injury and infection

NK cells are part of the innate immune response. Early response to injury and infection NK cells are part of the innate immune response Early response to injury and infection Functions: Natural Killer (NK) Cells. Cytolysis: killing infected or damaged cells 2. Cytokine production: IFNγ, GM-CSF,

More information

KIR gene polymorphism study in the Uygur population in Xinjiang, China

KIR gene polymorphism study in the Uygur population in Xinjiang, China KIR gene polymorphism study in the Uygur population in Xinjiang, China G.-Y. Lin and Y.-B. Wang No. 474 Hospital of Chinese PLA, Urumqi, China Corresponding author: G.-Y. Lin E-mail: lgy474@yeah.net Genet.

More information

Genetic polymorphism at the KIR gene locus: determination of gene, genotype, and haplotype frequencies in the Xinjiang Han population

Genetic polymorphism at the KIR gene locus: determination of gene, genotype, and haplotype frequencies in the Xinjiang Han population Genetic polymorphism at the KIR gene locus: determination of gene, genotype, and haplotype frequencies in the Xinjiang Han population G.-Y. Lin 1, B. Yu 2, W.-J. Hu 1, Y.-Z. Zhang 1, X.-J. Zuo 1 and Y.-B.

More information

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination

More information

HLA DRB1 Gene Study in Different Population Groups From Mumbai, Maharashtra, India

HLA DRB1 Gene Study in Different Population Groups From Mumbai, Maharashtra, India Kamla-Raj 2005 Int J Hum Genet, 5(4): 267-271 (2005) HLA DRB1 Gene Study in Different Population Groups From Mumbai, Maharashtra, India S.R. Kankonkar and U. Shankarkumar* Tissue Typing Laboratory, P.G.Institute

More information

The E-M Algorithm in Genetics. Biostatistics 666 Lecture 8

The E-M Algorithm in Genetics. Biostatistics 666 Lecture 8 The E-M Algorithm in Genetics Biostatistics 666 Lecture 8 Maximum Likelihood Estimation of Allele Frequencies Find parameter estimates which make observed data most likely General approach, as long as

More information

Natural Selection. Population Dynamics. The Origins of Genetic Variation. The Origins of Genetic Variation. Intergenerational Mutation Rate

Natural Selection. Population Dynamics. The Origins of Genetic Variation. The Origins of Genetic Variation. Intergenerational Mutation Rate Natural Selection Population Dynamics Humans, Sickle-cell Disease, and Malaria How does a population of humans become resistant to malaria? Overproduction Environmental pressure/competition Pre-existing

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu February 12, 2015 Lecture 3:

More information

BIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES.

BIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES. Enduring Understanding 4.C Independent Study Assignment Assignment Instructions Both components of this assignment (Part I and Part II) should be completed on the pages provided. Each numbered component

More information

Linkage disequilibrium organization of the human KIR superlocus: implications for KIR data analyses

Linkage disequilibrium organization of the human KIR superlocus: implications for KIR data analyses Immunogenetics (2010) 62:729 740 DOI 10.1007/s00251-010-0478-4 ORIGINAL PAPER Linkage disequilibrium organization of the human KIR superlocus: implications for KIR data analyses Pierre-Antoine Gourraud

More information

Distribution of KIR genes in the Lur population of Iran

Distribution of KIR genes in the Lur population of Iran Distribution of KIR genes in the Lur of Iran Farhad Shahsavar 1, Alireza Azargoon 2, Mehrzad Jafarzadeh 3*, Shahab Forutani 4, Behnam Asadifar 3 1. Department of Immunology, Lorestan University of Medical

More information

Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing

Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing So Yeun Kwon, Hwan Young Lee, and Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul,

More information

Genetic Control of Human NK Cell Repertoire

Genetic Control of Human NK Cell Repertoire This information is current as of December 29, 2018. Genetic Control of Human NK Cell Repertoire Heather G. Shilling, Neil Young, Lisbeth A. Guethlein, Nathalie W. Cheng, Clair M. Gardiner, Dolly Tyan

More information

MRC-Holland MLPA. Description version 14; 21 January 2015

MRC-Holland MLPA. Description version 14; 21 January 2015 SALSA MLPA probemix P229-B2 OPA1 Lot B2-0412. As compared to version B1-0809, two reference probes and the 88 and 96 nt control fragments have been replaced (QDX2). The OPA1 gene product is a nuclear-encoded

More information

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed

More information

Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food

Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food Whole genome sequencing (WGS) - there s a new tool in town Henrik Hasman DTU - Food Welcome to the NGS world TODAY Welcome Introduction to Next Generation Sequencing DNA purification (Hands-on) Lunch (Sandwishes

More information

On coding genotypes for genetic markers with multiple alleles in genetic association study of quantitative traits

On coding genotypes for genetic markers with multiple alleles in genetic association study of quantitative traits Wang BMC Genetics 011, 1:8 http://www.biomedcentral.com/171-156/1/8 METHODOLOGY ARTICLE Open Access On coding genotypes for genetic markers with multiple alleles in genetic association study of quantitative

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Principal components analysis (PCA) of all samples analyzed in the discovery phase. Colors represent the phenotype of study populations. a) The first sample

More information

Natural killer cell immunoglobulin-like receptor (KIR) locus profiles in African and South Asian populations

Natural killer cell immunoglobulin-like receptor (KIR) locus profiles in African and South Asian populations (2002) 3, 86 95 2002 Nature Publishing Group All rights reserved 1466-4879/02 $25.00 www.nature.com/gene Natural killer cell immunoglobulin-like receptor (KIR) locus profiles in African and South Asian

More information

KIR AND HLA HAPLOTYPE ANALYSIS IN A FAMILY LACKING THE KIR 2DL1-2DP1 GENES

KIR AND HLA HAPLOTYPE ANALYSIS IN A FAMILY LACKING THE KIR 2DL1-2DP1 GENES 18 (1), 2015 55-64 DOI: 10.1515/bjmg-2015-0006 ORIGINAL ARTICLE KIR AND HLA HAPLOTYPE ANALYSIS IN A FAMILY LACKING THE KIR 2DL1-2DP1 GENES Vojvodić S *, Ademović-Sazdanić D *Corresponding Author: Associate

More information

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS. !! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms

More information

Genotype Imputation. Biostatistics 666

Genotype Imputation. Biostatistics 666 Genotype Imputation Biostatistics 666 Previously Hidden Markov Models for Relative Pairs Linkage analysis using affected sibling pairs Estimation of pairwise relationships Identity-by-Descent Relatives

More information

Linear Regression (1/1/17)

Linear Regression (1/1/17) STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression

More information

Q Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2.

Q Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2. NCEA Level 2 Biology (91157) 2018 page 1 of 6 Assessment Schedule 2018 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Q Expected Coverage Achievement Merit Excellence

More information

Evolution and pathogenicity in the deadly chytrid pathogen of amphibians. Erica Bree Rosenblum UC Berkeley

Evolution and pathogenicity in the deadly chytrid pathogen of amphibians. Erica Bree Rosenblum UC Berkeley Evolution and pathogenicity in the deadly chytrid pathogen of amphibians Erica Bree Rosenblum UC Berkeley Emerging infectious disease Emerging infectious disease EID events have risen significantly over

More information

Objective 3.01 (DNA, RNA and Protein Synthesis)

Objective 3.01 (DNA, RNA and Protein Synthesis) Objective 3.01 (DNA, RNA and Protein Synthesis) DNA Structure o Discovered by Watson and Crick o Double-stranded o Shape is a double helix (twisted ladder) o Made of chains of nucleotides: o Has four types

More information

NETWORK BIOLOGY AND COMPLEX DISEASES. Ahto Salumets

NETWORK BIOLOGY AND COMPLEX DISEASES. Ahto Salumets NETWORK BIOLOGY AND COMPLEX DISEASES Ahto Salumets CENTRAL DOGMA OF BIOLOGY https://en.wikipedia.org/wiki/central_dogma_of_molecular_biology http://www.qaraqalpaq.com/genetics.html CHROMOSOMES SINGLE-NUCLEOTIDE

More information

Supplementary Information

Supplementary Information Supplementary Information A versatile genome-scale PCR-based pipeline for high-definition DNA FISH Magda Bienko,, Nicola Crosetto,, Leonid Teytelman, Sandy Klemm, Shalev Itzkovitz & Alexander van Oudenaarden,,

More information

Unit 2 Lesson 4 - Heredity. 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity

Unit 2 Lesson 4 - Heredity. 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity Unit 2 Lesson 4 - Heredity 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity Give Peas a Chance What is heredity? Traits, such as hair color, result from the information stored in genetic

More information

MRC-Holland MLPA. Description version 09; 25 April 2017

MRC-Holland MLPA. Description version 09; 25 April 2017 SALSA MLPA probemix P143-C2 MFN2-MPZ Lot C2-0317. As compared to version C1-0813, one reference probe has been removed and two replaced, in addition several probe lengths have been adjusted. This P143

More information

Lab Math Quantitative expression of Concentrations Molarity

Lab Math Quantitative expression of Concentrations Molarity Lab Math Quantitative expression of Concentrations Molarity Carlos A. Saavedra-Matiz, MD Newborn Screening Program Wadsworth Center New York State Department of Health March 10, 2015 APHL-CDC Solution:

More information

Chronic Granulomatous Disease Medical Management

Chronic Granulomatous Disease Medical Management Chronic Granulomatous Disease Medical Management N I C H O L A S H A R T O G, M D D i r e c t o r o f P e d i a t r i c / A d u l t P r i m a r y I m m u n o d e f i c i e n c y C l i n i c A s s i s t

More information

Introduction to de novo RNA-seq assembly

Introduction to de novo RNA-seq assembly Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies

More information

Genotype Imputation. Class Discussion for January 19, 2016

Genotype Imputation. Class Discussion for January 19, 2016 Genotype Imputation Class Discussion for January 19, 2016 Intuition Patterns of genetic variation in one individual guide our interpretation of the genomes of other individuals Imputation uses previously

More information

Molecular Population Genetics

Molecular Population Genetics Molecular Population Genetics The 10 th CJK Bioinformatics Training Course in Jeju, Korea May, 2011 Yoshio Tateno National Institute of Genetics/POSTECH Top 10 species in INSDC (as of April, 2011) CONTENTS

More information

Indications and outcomes after UD HSCT

Indications and outcomes after UD HSCT Indications and outcomes after UD HSCT Jakob R Passweg 1 Impact on Outcome: Patient Age, Disease Severity I II III Title: Optimization of Therapy for Severe AplasticAnemia Based on Clinical, Biological

More information

Visit to BPRC. Data is crucial! Case study: Evolution of AIRE protein 6/7/13

Visit to BPRC. Data is crucial! Case study: Evolution of AIRE protein 6/7/13 Visit to BPRC Adres: Lange Kleiweg 161, 2288 GJ Rijswijk Utrecht CS à Den Haag CS 9:44 Spoor 9a, arrival 10:22 Den Haag CS à Delft 10:28 Spoor 1, arrival 10:44 10:48 Delft Voorzijde à Bushalte TNO/Lange

More information

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and

More information

Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5

Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 Association Testing with Quantitative Traits: Common and Rare Variants Timothy Thornton and Katie Kerr Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 1 / 41 Introduction to Quantitative

More information

GREENWOOD PUBLIC SCHOOL DISTRICT Genetics Pacing Guide FIRST NINE WEEKS Semester 1

GREENWOOD PUBLIC SCHOOL DISTRICT Genetics Pacing Guide FIRST NINE WEEKS Semester 1 FIRST NINE WEEKS Semester 1 1 Aug. 4 1 Introduction to Course Aug. 7 11 5 2 Aug. 14 18 5 Overarching Science Engineering Practices (SEPs) These concepts and skills should be continuously embedded during

More information

Genome Analysis In Domestic Animals By H. Geldermann

Genome Analysis In Domestic Animals By H. Geldermann Genome Analysis In Domestic Animals By H. Geldermann If you are searched for the ebook by H. Geldermann Genome Analysis in Domestic Animals in pdf form, then you've come to faithful website. We furnish

More information

Unraveling the genetic expression of the highly variable immune receptors of a killer Vendelbosch, S.

Unraveling the genetic expression of the highly variable immune receptors of a killer Vendelbosch, S. UvA-DARE (Digital Academic Repository) Unraveling the genetic expression of the highly variable immune receptors of a killer Vendelbosch, S. Link to publication Citation for published version (APA): Vendelbosch,

More information

Logistic Regression Model for Analyzing Extended Haplotype Data

Logistic Regression Model for Analyzing Extended Haplotype Data Genetic Epidemiology 15:173 181 (1998) Logistic Regression Model for Analyzing Extended Haplotype Data Sylvan Wallenstein, 1 * Susan E. Hodge, 3 and Ainsley Weston 2 1 Department of Biomathematical Sciences,

More information

Genetical theory of natural selection

Genetical theory of natural selection Reminders Genetical theory of natural selection Chapter 12 Natural selection evolution Natural selection evolution by natural selection Natural selection can have no effect unless phenotypes differ in

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

APPLICATION FOR RESEARCH GRANT Page 8

APPLICATION FOR RESEARCH GRANT Page 8 APPLICATION FOR RESEARCH GRANT Page 8 F. PROJECT SUMMARY Applicants must provide, in the space below, a 200-word summary in lay language, of their research proposal. It is critical that the summary be

More information

How the host sees and responds to pathogens

How the host sees and responds to pathogens How the host sees and responds to pathogens David A. Relman, Stanford University IOM Forum on Microbial Threats March 17, 2005 Issues Pathogens and commensals: conserved patterns and pathways Sources of

More information

Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution. Classical vs. balanced views of genome structure

Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution. Classical vs. balanced views of genome structure Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution Classical vs. balanced views of genome structure - the proposal of the neutral theory by Kimura in 1968 led to the so-called neutralist-selectionist

More information

Yifei Bao. Beatrix. Manor Askenazi

Yifei Bao. Beatrix. Manor Askenazi Detection and Correction of Interference in MS1 Quantitation of Peptides Using their Isotope Distributions Yifei Bao Department of Computer Science Stevens Institute of Technology Beatrix Ueberheide Department

More information

High-throughput sequence alignment. November 9, 2017

High-throughput sequence alignment. November 9, 2017 High-throughput sequence alignment November 9, 2017 a little history human genome project #1 (many U.S. government agencies and large institute) started October 1, 1990. Goal: 10x coverage of human genome,

More information

Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;

Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China; Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin

More information

Exam 1 PBG430/

Exam 1 PBG430/ 1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.

More information

Legend: S spotted Genotypes: P1 SS & ss F1 Ss ss plain F2 (with ratio) 1SS :2 WSs: 1ss. Legend W white White bull 1 Ww red cows ww ww red

Legend: S spotted Genotypes: P1 SS & ss F1 Ss ss plain F2 (with ratio) 1SS :2 WSs: 1ss. Legend W white White bull 1 Ww red cows ww ww red On my honor, this is my work GENETICS 310 EXAM 1 June 8, 2018 I. Following are 3 sets of data collected from crosses: 1. Spotted by Plain gave all spotted in the F1 and 9 spotted and 3 plain in the F2.

More information

Application Evolution: Part 1.1 Basics of Coevolution Dynamics

Application Evolution: Part 1.1 Basics of Coevolution Dynamics Application Evolution: Part 1.1 Basics of Coevolution Dynamics S. chilense S. peruvianum Summer Semester 2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or

More information

Adaptation in the Human Genome. HapMap. The HapMap is a Resource for Population Genetic Studies. Single Nucleotide Polymorphism (SNP)

Adaptation in the Human Genome. HapMap. The HapMap is a Resource for Population Genetic Studies. Single Nucleotide Polymorphism (SNP) Adaptation in the Human Genome A genome-wide scan for signatures of adaptive evolution using SNP data Single Nucleotide Polymorphism (SNP) A nucleotide difference at a given location in the genome Joanna

More information

DNA, Chromosomes, and Genes

DNA, Chromosomes, and Genes N, hromosomes, and Genes 1 You have most likely already learned about deoxyribonucleic acid (N), chromosomes, and genes. You have learned that all three of these substances have something to do with heredity

More information

Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes.

Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Enduring understanding 3.A: Heritable information provides for continuity of life. Essential

More information

Drosophila melanogaster and D. simulans, two fruit fly species that are nearly

Drosophila melanogaster and D. simulans, two fruit fly species that are nearly Comparative Genomics: Human versus chimpanzee 1. Introduction The chimpanzee is the closest living relative to humans. The two species are nearly identical in DNA sequence (>98% identity), yet vastly different

More information

Annotation of Plant Genomes using RNA-seq. Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA)

Annotation of Plant Genomes using RNA-seq. Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA) Annotation of Plant Genomes using RNA-seq Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA) inuscu1-35bp 5 _ 0 _ 5 _ What is Annotation inuscu2-75bp luscu1-75bp 0 _ 5 _ Reconstruction

More information

Friday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo

Friday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo Friday Harbor 2017 From Genetics to GWAS (Genome-wide Association Study) Sept 7 2017 David Fardo Purpose: prepare for tomorrow s tutorial Genetic Variants Quality Control Imputation Association Visualization

More information

BIOLOGY STANDARDS BASED RUBRIC

BIOLOGY STANDARDS BASED RUBRIC BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:

More information

Chapter 17. From Gene to Protein. Biology Kevin Dees

Chapter 17. From Gene to Protein. Biology Kevin Dees Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting

More information

LECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50

LECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50 LECTURE #10 A. The Hardy-Weinberg Equilibrium 1. From the definitions of p and q, and of p 2, 2pq, and q 2, an equilibrium is indicated (p + q) 2 = p 2 + 2pq + q 2 : if p and q remain constant, and if

More information

Introduction to Linkage Disequilibrium

Introduction to Linkage Disequilibrium Introduction to September 10, 2014 Suppose we have two genes on a single chromosome gene A and gene B such that each gene has only two alleles Aalleles : A 1 and A 2 Balleles : B 1 and B 2 Suppose we have

More information

Genetics of host resistance in wheat

Genetics of host resistance in wheat UKCPVS 07/03/2018 Genetics of host resistance in wheat Keith Gardner Wagtail association mapping project 4 fungal diseases 4 variable years Multiple trial locations 2015 26,000 SNPs 520 UK/NW Europe wheat

More information

Genomes and Their Evolution

Genomes and Their Evolution Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Going Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014

Going Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014 Going Beyond SNPs with Next Genera5on Sequencing Technology 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Next Genera5on Sequencing Technology (NGS) NGS technology Discover more

More information

Genetics (patterns of inheritance)

Genetics (patterns of inheritance) MENDELIAN GENETICS branch of biology that studies how genetic characteristics are inherited MENDELIAN GENETICS Gregory Mendel, an Augustinian monk (1822-1884), was the first who systematically studied

More information

Q2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus. Q8 (Biology) (4.6)

Q2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus. Q8 (Biology) (4.6) Q1 (4.6) What is variation? Q2 (4.6) Put the following in order from biggest to smallest: Gene DNA Cell Chromosome Nucleus Q3 (4.6) What are genes? Q4 (4.6) What sort of reproduction produces genetically

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

Solutions to Problem Set 4

Solutions to Problem Set 4 Question 1 Solutions to 7.014 Problem Set 4 Because you have not read much scientific literature, you decide to study the genetics of garden peas. You have two pure breeding pea strains. One that is tall

More information

Product Description SALSA MLPA Probemix P229-B4 OPA1 To be used with the MLPA General Protocol.

Product Description SALSA MLPA Probemix P229-B4 OPA1 To be used with the MLPA General Protocol. Product Description SALSA Probemix P229-B4 OPA1 To be used with the MLPA General Protocol. Version B4. As compared to version B3, three reference probes have been replaced. For complete product history

More information

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying

More information

BIOLOGY FINAL EXAM REVIEW SHEET Chapters 10-15, 17-30

BIOLOGY FINAL EXAM REVIEW SHEET Chapters 10-15, 17-30 Name Hour Due Date: BIOLOGY FINAL EXAM REVIEW SHEET Chapters 10-15, 17-30 The exam was prepared by the Biology teachers in the science departments of CVHS and DHS. 1. What is a Punnett Square? 2. Cross

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Ch 11.4, 11.5, and 14.1 Review. Game

Ch 11.4, 11.5, and 14.1 Review. Game Ch 11.4, 11.5, and 14.1 Review Game What happens to the chromosome number during meiosis? A It doubles B It stays the same C It halves D It becomes diploid Ans: C Gametes are A Sex cells B Sperm and eggs

More information

Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses

Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses

More information

Parts 2. Modeling chromosome segregation

Parts 2. Modeling chromosome segregation Genome 371, Autumn 2017 Quiz Section 2 Meiosis Goals: To increase your familiarity with the molecular control of meiosis, outcomes of meiosis, and the important role of crossing over in generating genetic

More information

Evolution of the Sry gene within the African pygmy mice Nannomys

Evolution of the Sry gene within the African pygmy mice Nannomys Evolution of the Sry gene within the African pygmy mice Nannomys Subgenus of the genus Mus Widespread in Sub Saharan Africa ~ 20 species Mus minutoides Very high proportion (> 75%) of fertile sex reversed

More information

Lecture Notes: BIOL2007 Molecular Evolution

Lecture Notes: BIOL2007 Molecular Evolution Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits

More information

Recessive Genetic Disorders: a recessive trait is expressed when the individual is homozygous recessive for the trait.

Recessive Genetic Disorders: a recessive trait is expressed when the individual is homozygous recessive for the trait. Complex Inhertiance Recessive Genetic Disorders: a recessive trait is expressed when the individual is homozygous recessive for the trait. This is true for other species besides humans Carriers: Individuals

More information

Neutral Theory of Molecular Evolution

Neutral Theory of Molecular Evolution Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation

More information

Learning gene regulatory networks Statistical methods for haplotype inference Part I

Learning gene regulatory networks Statistical methods for haplotype inference Part I Learning gene regulatory networks Statistical methods for haplotype inference Part I Input: Measurement of mrn levels of all genes from microarray or rna sequencing Samples (e.g. 200 patients with lung

More information

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012 Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based

More information

Edward M. Golenberg Wayne State University Detroit, MI

Edward M. Golenberg Wayne State University Detroit, MI Edward M. Golenberg Wayne State University Detroit, MI Targeting Phragmites Success As Invasive Species Phragmites displays multiple life history parameters High seed output and small seed size Rapid growth

More information

Expression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia

Expression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia Expression QTLs and Mapping of Complex Trait Loci Paul Schliekelman Statistics Department University of Georgia Definitions: Genes, Loci and Alleles A gene codes for a protein. Proteins due everything.

More information

Algorithmics and Bioinformatics

Algorithmics and Bioinformatics Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32

More information

8. Use the following terms: interphase, prophase, metaphase, anaphase, telophase, chromosome, spindle fibers, centrioles.

8. Use the following terms: interphase, prophase, metaphase, anaphase, telophase, chromosome, spindle fibers, centrioles. Midterm Exam Study Guide: 2nd Quarter Concepts Cell Division 1. The cell spends the majority of its life in INTERPHASE. This phase is divided up into the G 1, S, and G 2 phases. During this stage, the

More information

Bioinformatics. Genotype -> Phenotype DNA. Jason H. Moore, Ph.D. GECCO 2007 Tutorial / Bioinformatics.

Bioinformatics. Genotype -> Phenotype DNA. Jason H. Moore, Ph.D. GECCO 2007 Tutorial / Bioinformatics. Bioinformatics Jason H. Moore, Ph.D. Frank Lane Research Scholar in Computational Genetics Associate Professor of Genetics Adjunct Associate Professor of Biological Sciences Adjunct Associate Professor

More information

Bayesian Inference of Interactions and Associations

Bayesian Inference of Interactions and Associations Bayesian Inference of Interactions and Associations Jun Liu Department of Statistics Harvard University http://www.fas.harvard.edu/~junliu Based on collaborations with Yu Zhang, Jing Zhang, Yuan Yuan,

More information

Roadmap. Sexual Selection. Evolution of Multi-Gene Families Gene Duplication Divergence Concerted Evolution Survey of Gene Families

Roadmap. Sexual Selection. Evolution of Multi-Gene Families Gene Duplication Divergence Concerted Evolution Survey of Gene Families 1 Roadmap Sexual Selection Evolution of Multi-Gene Families Gene Duplication Divergence Concerted Evolution Survey of Gene Families 2 One minute responses Q: How do aphids start producing males in the

More information

Observing Patterns in Inherited Traits

Observing Patterns in Inherited Traits Observing Patterns in Inherited Traits Chapter 10 Before you go on Review the answers to the following questions to test your understanding of previous material. 1. Most organisms are diploid. What does

More information

ACADEMIC POSITIONS Continuing Lecturer (July2008-present) Purdue University, Department of Biological Sciences.

ACADEMIC POSITIONS Continuing Lecturer (July2008-present) Purdue University, Department of Biological Sciences. David H. Bos Department of Biological Sciences Purdue University 915 W. State St. West Lafayette, IN 47907 phone: (765) 494-8528 fax: (765) 494-8527 Email: dbos@purdue.edu ACADEMIC POSITIONS Continuing

More information

Alterations to the Flat Weight For Age Scale BHA Data Published 22 September 2016

Alterations to the Flat Weight For Age Scale BHA Data Published 22 September 2016 Alterations to the Flat Weight For Age Scale BHA Data Published 22 September 2016 Introduction What is weight for age? It is an allowance given to younger horses, usually three-year-olds, to enable them

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Eukaryotic vs. Prokaryotic genes

Eukaryotic vs. Prokaryotic genes BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,

More information

LIFE SCIENCE CHAPTER 5 & 6 FLASHCARDS

LIFE SCIENCE CHAPTER 5 & 6 FLASHCARDS LIFE SCIENCE CHAPTER 5 & 6 FLASHCARDS Why were ratios important in Mendel s work? A. They showed that heredity does not follow a set pattern. B. They showed that some traits are never passed on. C. They

More information

genome a specific characteristic that varies from one individual to another gene the passing of traits from one generation to the next

genome a specific characteristic that varies from one individual to another gene the passing of traits from one generation to the next genetics the study of heredity heredity sequence of DNA that codes for a protein and thus determines a trait genome a specific characteristic that varies from one individual to another gene trait the passing

More information

Big Idea 3B Basic Review. 1. Which disease is the result of uncontrolled cell division? a. Sickle-cell anemia b. Alzheimer s c. Chicken Pox d.

Big Idea 3B Basic Review. 1. Which disease is the result of uncontrolled cell division? a. Sickle-cell anemia b. Alzheimer s c. Chicken Pox d. Big Idea 3B Basic Review 1. Which disease is the result of uncontrolled cell division? a. Sickle-cell anemia b. Alzheimer s c. Chicken Pox d. Cancer 2. Cancer cells do not exhibit, which can lead to the

More information