Application Evolution: Part 1.1 Basics of Coevolution Dynamics

Size: px
Start display at page:

Download "Application Evolution: Part 1.1 Basics of Coevolution Dynamics"

Transcription

1 Application Evolution: Part 1.1 Basics of Coevolution Dynamics S. chilense S. peruvianum Summer Semester 2013 Prof Aurélien Tellier FG Populationsgenetik

2 Color code Color code: Red = Important result or definition Purple: exercise to do Green: some bits of maths

3 Some Definitions Hosts and parasites exert reciprocal selective pressures on each other, which may lead to rapid reciprocal adaptation For organisms with short generation times host parasite coevolution can be observed in comparatively small time periods => possible to study evolutionary change in real-time: In the field In the laboratory These interactions are examples of evolution in action It contradict the common notion that evolution can only be detected across extended time scales.

4 Types of selection Host-parasite coevolution is characterized by reciprocal genetic change and thus changes in allele frequencies within populations. These changes can be determined by two main types of selection: Overdominant selection Negative frequency-dependent selection

5 A general model of natural selection Fitness table for a simple model: one species, one locus, two alleles Genotypes A 1 A 1 A 1 A 2 A 2 A 2 Frequency in offspring p 2 2pq q 2 Relative fitness 1 1-hs 1-s Frequency after selection p 2 / w 2 (1 ) / pq hs w q 2 (1 s) / w Where 2 2 w = p + pq hs + q s 2 (1 ) (1 ) Is the mean fitness of the population Based on Fisher s fundamental theorem of natural selection With 1 being the fitness of the homozygote A 1 A 1 genotype h is the dominance coefficient (heterozygous effect) s is the selection coefficient

6 Overdominant selection Overdominance occurs if the heterozygote phenotype has a fitness advantage over both homozygotes = "heterozygote advantage" = "heterosis". Fitness Genotypes

7 A model of overdominance Fitness table for a simple model: one species, one locus, two alleles Genotypes A 1 A 1 A 1 A 2 A 2 A 2 Frequency in offspring p 2 2pq q 2 Relative fitness 1 - s t Frequency after selection p 2 (1 s) / w 2 pq / w q 2 (1 t) / w When there is overdominance (h < 0) We can calculate the change in allele frequency from one generation to the next by selection p = s [ ps] pq qt w

8 A model of natural selection: overdominance Fitness table for a simple model: one species, one locus, two alleles Genotypes A 1 A 1 A 1 A 2 A 2 A 2 Frequency in offspring p 2 2pq q 2 Relative fitness 1 - s t Frequency after selection p 2 (1 s) / w 2 pq / w q 2 (1 t) / w We can calculate the equilibrium frequencies for both alleles pˆ t = s + t qˆ s = s + t Overdominance maintains variability as heterozygotes have an advantage A famous example of overdominance?

9 Overdominant selection: sickle cell anemia It is due to a mutation (allele a) in the hemoglobin gene sickle shape formation of red blood cells => causing clotting of blood vessels, restricted blood flow and reduced oxygen transport. The mutation confers resistance to malaria, caused by Plasmodium parasites. Homozygote (aa) and heterozygote (Aa) genotypes for the sickle-cell disease allele show malaria resistance Homozygote (aa) suffers from severe disease phenotype. Homozygote (AA) is susceptible to Plasmodium. Distribution of sickle cell anemia (source Distribution of malaria (source CHU Rouen, France)

10 Negative frequency-dependent selection An allele is subject to negative frequency dependent selection if a rare allelic variant has a selective advantage. For example, the parasite should adapt to the most common host genotype, because it can then infect a large number of hosts. In turn, a rare host genotype may then be favored by selection, its frequency will increase and eventually it becomes common. Subsequently the parasite should adapt to the former infrequent host genotype. Coevolution determined by negative frequency dependent selection is rapid, potentially occurring across few generations. It may maintains high genetic diversity by favoring uncommon alleles (see Haldane)

11 Observing negative frequency-dependent selection

12 Observing negative frequency-dependent selection

13 Observing negative frequency-dependent selection

14 Negative frequency-dependent selection An allele is subject to negative frequency dependent selection if a rare allelic variant has a selective advantage. Two outcome can occur: trench warfare dynamics arms race dynamics

15 Arms race dynamics The arms race dynamics sometimes called Red Queen dynamics Source:

16 The arms race dynamics Arms race dynamics Woolhouse et al Nat Genet Holub 2001 Nat Rev Genet

17 Arms race dynamics The arms race dynamics There is recurrent fixation of host and parasite alleles Polymorphism = presence of more than one allele in a population Polymorphism is only TRANSIENT in this dynamics this means that polymorphism is short lived and the population often has only one allele What does this mean for observing natural populations?

18 Trench warfare dynamics The trench warfare dynamics (Stahl et al. 1999) Source: Imperial War Museum An aerial reconnaissance photograph of the opposing trenches and no-man's land between Loos and Hulluch in Artois, France, taken at 7.15 pm, 22 July German trenches are at the right and bottom, British trenches are at the top left. The vertical line to the left of centre indicates the course of a pre-war road or track.

19 Trench warfare dynamics The trench warfare dynamics (Stahl et al. 1999) also called fluctuating selection dynamics Woolhouse et al Nat Genet There is variation of frequencies of host and parasite alleles Polymorphism = presence of more than one allele in a population Polymorphism is PERMANENT in this dynamics this means that polymorphism is long lived and the population contains several alleles

20 Trench warfare dynamics The trench warfare dynamics (Stahl et al. 1999) Holub 2001 Nat Rev Genet What does this mean for observing natural populations?

21 Observations in natural populations JEB, 2008

22 Extension to genomic signatures? Can you guess which signatures we expect for polymorphism in these two dynamics?

Genetical theory of natural selection

Genetical theory of natural selection Reminders Genetical theory of natural selection Chapter 12 Natural selection evolution Natural selection evolution by natural selection Natural selection can have no effect unless phenotypes differ in

More information

Functional divergence 1: FFTNS and Shifting balance theory

Functional divergence 1: FFTNS and Shifting balance theory Functional divergence 1: FFTNS and Shifting balance theory There is no conflict between neutralists and selectionists on the role of natural selection: Natural selection is the only explanation for adaptation

More information

Mechanisms of Evolution Microevolution. Key Concepts. Population Genetics

Mechanisms of Evolution Microevolution. Key Concepts. Population Genetics Mechanisms of Evolution Microevolution Population Genetics Key Concepts 23.1: Population genetics provides a foundation for studying evolution 23.2: Mutation and sexual recombination produce the variation

More information

Is there any difference between adaptation fueled by standing genetic variation and adaptation fueled by new (de novo) mutations?

Is there any difference between adaptation fueled by standing genetic variation and adaptation fueled by new (de novo) mutations? Visualizing evolution as it happens Spatiotemporal microbial evolution on antibiotic landscapes Michael Baym, Tami D. Lieberman,*, Eric D. Kelsic, Remy Chait, Rotem Gross, Idan Yelin, Roy Kishony Science

More information

Darwinian Selection. Chapter 7 Selection I 12/5/14. v evolution vs. natural selection? v evolution. v natural selection

Darwinian Selection. Chapter 7 Selection I 12/5/14. v evolution vs. natural selection? v evolution. v natural selection Chapter 7 Selection I Selection in Haploids Selection in Diploids Mutation-Selection Balance Darwinian Selection v evolution vs. natural selection? v evolution ² descent with modification ² change in allele

More information

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination

More information

(Write your name on every page. One point will be deducted for every page without your name!)

(Write your name on every page. One point will be deducted for every page without your name!) POPULATION GENETICS AND MICROEVOLUTIONARY THEORY FINAL EXAMINATION (Write your name on every page. One point will be deducted for every page without your name!) 1. Briefly define (5 points each): a) Average

More information

Evolutionary Genetics: Part 0.2 Introduction to Population genetics

Evolutionary Genetics: Part 0.2 Introduction to Population genetics Evolutionary Genetics: Part 0.2 Introduction to Population genetics S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Population genetics Evolution = changes

More information

Genetics and Natural Selection

Genetics and Natural Selection Genetics and Natural Selection Darwin did not have an understanding of the mechanisms of inheritance and thus did not understand how natural selection would alter the patterns of inheritance in a population.

More information

Natural Selection. DNA encodes information that interacts with the environment to influence phenotype

Natural Selection. DNA encodes information that interacts with the environment to influence phenotype Natural Selection DN encodes information that interacts with the environment to influence phenotype mong The Traits That Can Be Influenced By Genetically Determined Responses to the Environment re: 1.

More information

BIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES.

BIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES. Enduring Understanding 4.C Independent Study Assignment Assignment Instructions Both components of this assignment (Part I and Part II) should be completed on the pages provided. Each numbered component

More information

Evolution by Natural Selection

Evolution by Natural Selection Evolution by Natural Selection What is evolution? What is evolution? The change in the genetic makeup of a population over time (narrowly defined) Evolution accounts for the diversity of life on Earth

More information

SPEED OF ADAPTATION AND GENOMIC FOOTPRINTS OF HOST PARASITE COEVOLUTION UNDER ARMS RACE AND TRENCH WARFARE DYNAMICS

SPEED OF ADAPTATION AND GENOMIC FOOTPRINTS OF HOST PARASITE COEVOLUTION UNDER ARMS RACE AND TRENCH WARFARE DYNAMICS ORIGINAL ARTICLE doi:10.1111/evo.12427 SPEED OF ADAPTATION AND GENOMIC FOOTPRINTS OF HOST PARASITE COEVOLUTION UNDER ARMS RACE AND TRENCH WARFARE DYNAMICS Aurélien Tellier, 1,2 Stefany Moreno-Gámez, 3

More information

BIOL Evolution. Lecture 9

BIOL Evolution. Lecture 9 BIOL 432 - Evolution Lecture 9 J Krause et al. Nature 000, 1-4 (2010) doi:10.1038/nature08976 Selection http://www.youtube.com/watch?v=a38k mj0amhc&feature=playlist&p=61e033 F110013706&index=0&playnext=1

More information

Natural Selection results in increase in one (or more) genotypes relative to other genotypes.

Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Fitness - The fitness of a genotype is the average per capita lifetime contribution of individuals of that

More information

How does natural selection change allele frequencies?

How does natural selection change allele frequencies? How does natural selection change allele frequencies? Alleles conferring resistance to insecticides and antibiotics have recently increased to high frequencies in many species of insects and bacteria.

More information

Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution. Classical vs. balanced views of genome structure

Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution. Classical vs. balanced views of genome structure Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution Classical vs. balanced views of genome structure - the proposal of the neutral theory by Kimura in 1968 led to the so-called neutralist-selectionist

More information

Evolutionary Genetics Midterm 2008

Evolutionary Genetics Midterm 2008 Student # Signature The Rules: (1) Before you start, make sure you ve got all six pages of the exam, and write your name legibly on each page. P1: /10 P2: /10 P3: /12 P4: /18 P5: /23 P6: /12 TOT: /85 (2)

More information

Migration In evolutionary terms, migration is defined as movement that will result in gene flow, or the movement of genes from one place to another

Migration In evolutionary terms, migration is defined as movement that will result in gene flow, or the movement of genes from one place to another Biology 1B Evolution Lecture 5, Migration and forms of selection Migration In evolutionary terms, migration is defined as movement that will result in gene flow, or the movement of genes from one place

More information

Outline of lectures 3-6

Outline of lectures 3-6 GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results

More information

Study of similarities and differences in body plans of major groups Puzzling patterns:

Study of similarities and differences in body plans of major groups Puzzling patterns: Processes of Evolution Evolutionary Theories Widely used to interpret the past and present, and even to predict the future Reveal connections between the geological record, fossil record, and organismal

More information

The theory of evolution continues to be refined as scientists learn new information.

The theory of evolution continues to be refined as scientists learn new information. Section 3: The theory of evolution continues to be refined as scientists learn new information. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the conditions of the

More information

POPULATIONS. p t+1 = p t (1-u) + q t (v) p t+1 = p t (1-u) + (1-p t ) (v) Phenotypic Evolution: Process HOW DOES MUTATION CHANGE ALLELE FREQUENCIES?

POPULATIONS. p t+1 = p t (1-u) + q t (v) p t+1 = p t (1-u) + (1-p t ) (v) Phenotypic Evolution: Process HOW DOES MUTATION CHANGE ALLELE FREQUENCIES? Phenotypic Evolution: Process MUTATION SELECTION + POPULATIONS +/ MIGRATION DRIFT HOW DOES MUTATION CHANGE ALLELE FREQUENCIES? Assume: a single autosomal locus with 2 alleles. Frequency (A) = p Frequency

More information

There are 3 parts to this exam. Use your time efficiently and be sure to put your name on the top of each page.

There are 3 parts to this exam. Use your time efficiently and be sure to put your name on the top of each page. EVOLUTIONARY BIOLOGY EXAM #1 Fall 2017 There are 3 parts to this exam. Use your time efficiently and be sure to put your name on the top of each page. Part I. True (T) or False (F) (2 points each). Circle

More information

Neutral Theory of Molecular Evolution

Neutral Theory of Molecular Evolution Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation

More information

Selection Page 1 sur 11. Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION

Selection Page 1 sur 11. Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION Selection Page 1 sur 11 Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION * I- Introduction II- Modeling and selective values III- Basic model IV- Equation of the recurrence of allele

More information

Outline of lectures 3-6

Outline of lectures 3-6 GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 009 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

Q Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2.

Q Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2. NCEA Level 2 Biology (91157) 2018 page 1 of 6 Assessment Schedule 2018 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Q Expected Coverage Achievement Merit Excellence

More information

LECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50

LECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50 LECTURE #10 A. The Hardy-Weinberg Equilibrium 1. From the definitions of p and q, and of p 2, 2pq, and q 2, an equilibrium is indicated (p + q) 2 = p 2 + 2pq + q 2 : if p and q remain constant, and if

More information

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying

More information

Segregation versus mitotic recombination APPENDIX

Segregation versus mitotic recombination APPENDIX APPENDIX Waiting time until the first successful mutation The first time lag, T 1, is the waiting time until the first successful mutant appears, creating an Aa individual within a population composed

More information

Genes Within Populations

Genes Within Populations Genes Within Populations Chapter 20 1 Nothing in Biology Makes Sense Except in the Light of Evolution The American Biology Teacher, March 1973 (35:125-129). Theodosius Dobzhansky (1900-1975). 2 Genetic

More information

BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B

BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 Natural Selection and Variation through

More information

Evolutionary Genetics

Evolutionary Genetics Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP Natural Selection HS2018 The importance of the great principle of selection mainly lies in the power of selecting scarcely appreciable differences,

More information

Lecture #4-1/25/02 Dr. Kopeny

Lecture #4-1/25/02 Dr. Kopeny Lecture #4-1/25/02 Dr. Kopeny Genetic Drift Can Cause Evolution Genetic Drift: Random change in genetic structure of a population; due to chance Thought Experiment: What is your expectation regarding the

More information

The E-M Algorithm in Genetics. Biostatistics 666 Lecture 8

The E-M Algorithm in Genetics. Biostatistics 666 Lecture 8 The E-M Algorithm in Genetics Biostatistics 666 Lecture 8 Maximum Likelihood Estimation of Allele Frequencies Find parameter estimates which make observed data most likely General approach, as long as

More information

Polymorphism in multi-locus host-parasite co-evolutionary interactions. Running head : Tellier and Brown. Polymorphism in multi-locus gene-for-gene

Polymorphism in multi-locus host-parasite co-evolutionary interactions. Running head : Tellier and Brown. Polymorphism in multi-locus gene-for-gene Genetics: Published Articles Ahead of Print, published on October 8, 007 as 0.534/genetics.07.074393 Tellier and Brown, Genetics, Polymorphism in multi-locus host-parasite co-evolutionary interactions

More information

Linking levels of selection with genetic modifiers

Linking levels of selection with genetic modifiers Linking levels of selection with genetic modifiers Sally Otto Department of Zoology & Biodiversity Research Centre University of British Columbia @sarperotto @sse_evolution @sse.evolution Sally Otto Department

More information

Inbreeding depression due to stabilizing selection on a quantitative character. Emmanuelle Porcher & Russell Lande

Inbreeding depression due to stabilizing selection on a quantitative character. Emmanuelle Porcher & Russell Lande Inbreeding depression due to stabilizing selection on a quantitative character Emmanuelle Porcher & Russell Lande Inbreeding depression Reduction in fitness of inbred vs. outbred individuals Outcrossed

More information

Molecular Population Genetics

Molecular Population Genetics Molecular Population Genetics The 10 th CJK Bioinformatics Training Course in Jeju, Korea May, 2011 Yoshio Tateno National Institute of Genetics/POSTECH Top 10 species in INSDC (as of April, 2011) CONTENTS

More information

1 Errors in mitosis and meiosis can result in chromosomal abnormalities.

1 Errors in mitosis and meiosis can result in chromosomal abnormalities. Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal

More information

Problems for 3505 (2011)

Problems for 3505 (2011) Problems for 505 (2011) 1. In the simplex of genotype distributions x + y + z = 1, for two alleles, the Hardy- Weinberg distributions x = p 2, y = 2pq, z = q 2 (p + q = 1) are characterized by y 2 = 4xz.

More information

Concepts of Evolution

Concepts of Evolution Concepts of Evolution Isn t Evolution Just A Theory? How does the scientific meaning of a term like theory differ from the way it is used in everyday life? Can the facts of science change over time? If

More information

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics: Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships

More information

because more individuals are heterozygous than homozygous recessive.

because more individuals are heterozygous than homozygous recessive. 1. A pesticide that was rarely used in 1932 was used with increasing frequency until it was banned altogether by 1972. Fruit flies (Drosophila melanogaster) that are resistant to this pesticide carry the

More information

Natural Selection. Population Dynamics. The Origins of Genetic Variation. The Origins of Genetic Variation. Intergenerational Mutation Rate

Natural Selection. Population Dynamics. The Origins of Genetic Variation. The Origins of Genetic Variation. Intergenerational Mutation Rate Natural Selection Population Dynamics Humans, Sickle-cell Disease, and Malaria How does a population of humans become resistant to malaria? Overproduction Environmental pressure/competition Pre-existing

More information

19. Genetic Drift. The biological context. There are four basic consequences of genetic drift:

19. Genetic Drift. The biological context. There are four basic consequences of genetic drift: 9. Genetic Drift Genetic drift is the alteration of gene frequencies due to sampling variation from one generation to the next. It operates to some degree in all finite populations, but can be significant

More information

AGREE or DISAGREE? What s your understanding of EVOLUTION?

AGREE or DISAGREE? What s your understanding of EVOLUTION? AGREE or DISAGREE? What s your understanding of EVOLUTION? Statement 1. Humans evolved from monkeys. Reasons for AGREE 0% Reasons for DISAGREE 100% Outcompeted by humans Humans and monkeys are evolving

More information

Slide 1. Slide 2. Slide 3. Concepts of Evolution. Isn t Evolution Just A Theory? Evolution

Slide 1. Slide 2. Slide 3. Concepts of Evolution. Isn t Evolution Just A Theory? Evolution Slide 1 Concepts of Evolution Slide 2 Isn t Evolution Just A Theory? How does the scientific meaning of a term like theory differ from the way it is used in everyday life? Can the facts of science change

More information

Educational Items Section

Educational Items Section Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Educational Items Section Hardy-Weinberg model Robert Kalmes, Jean-Loup Huret Institut de Recherche sur

More information

EXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?

EXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important? Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population

More information

Housekeeping. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 3: More Evolution, Geologic time, and Mass Extinctions

Housekeeping. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 3: More Evolution, Geologic time, and Mass Extinctions BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 3: More Evolution, Geologic time, and Mass Extinctions http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Housekeeping We

More information

Population Genetics of Selection

Population Genetics of Selection Population Genetics of Selection Jay Taylor School of Mathematical and Statistical Sciences Arizona State University Jay Taylor (Arizona State University) Population Genetics of Selection 2009 1 / 50 Historical

More information

Microevolution 2 mutation & migration

Microevolution 2 mutation & migration Microevolution 2 mutation & migration Assumptions of Hardy-Weinberg equilibrium 1. Mating is random 2. Population size is infinite (i.e., no genetic drift) 3. No migration 4. No mutation 5. No selection

More information

HOST PARASITE interactions are recognized as a

HOST PARASITE interactions are recognized as a Copyright Ó 27 by the Genetics Society of America DOI.534/genetics.7.74393 Polymorphism in Multilocus Host Parasite Coevolutionary Interactions Aurélien Tellier and James K. M. Brown Department of Disease

More information

Outline of lectures 3-6

Outline of lectures 3-6 GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 013 Population genetics Outline of lectures 3-6 1. We ant to kno hat theory says about the reproduction of genotypes in a population. This results

More information

8. Genetic Diversity

8. Genetic Diversity 8. Genetic Diversity Many ways to measure the diversity of a population: For any measure of diversity, we expect an estimate to be: when only one kind of object is present; low when >1 kind of objects

More information

Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency

Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency Bruce Walsh lecture notes Introduction to Quantitative Genetics SISG, Seattle 16 18 July 2018 1 Outline Genetics of complex

More information

1. What is the definition of Evolution? a. Descent with modification b. Changes in the heritable traits present in a population over time c.

1. What is the definition of Evolution? a. Descent with modification b. Changes in the heritable traits present in a population over time c. 1. What is the definition of Evolution? a. Descent with modification b. Changes in the heritable traits present in a population over time c. Changes in allele frequencies in a population across generations

More information

Life Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM

Life Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents

More information

Processes of Evolution

Processes of Evolution 15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection

More information

Observing Patterns in Inherited Traits

Observing Patterns in Inherited Traits Observing Patterns in Inherited Traits Chapter 10 Before you go on Review the answers to the following questions to test your understanding of previous material. 1. Most organisms are diploid. What does

More information

The neutral theory of molecular evolution

The neutral theory of molecular evolution The neutral theory of molecular evolution Introduction I didn t make a big deal of it in what we just went over, but in deriving the Jukes-Cantor equation I used the phrase substitution rate instead of

More information

Microevolution. Chapter 17

Microevolution. Chapter 17 Microevolution Chapter 17 Selective Breeding & Evolution Evolution is genetic change in a line of descent through successive generations Selective breeding practices yield evidence that heritable changes

More information

A simple genetic model with non-equilibrium dynamics

A simple genetic model with non-equilibrium dynamics J. Math. Biol. (1998) 36: 550 556 A simple genetic model with non-equilibrium dynamics Michael Doebeli, Gerdien de Jong Zoology Institute, University of Basel, Rheinsprung 9, CH-4051 Basel, Switzerland

More information

Evolution of Populations. Chapter 17

Evolution of Populations. Chapter 17 Evolution of Populations Chapter 17 17.1 Genes and Variation i. Introduction: Remember from previous units. Genes- Units of Heredity Variation- Genetic differences among individuals in a population. New

More information

UNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology

UNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance

More information

Evolution of phenotypic traits

Evolution of phenotypic traits Quantitative genetics Evolution of phenotypic traits Very few phenotypic traits are controlled by one locus, as in our previous discussion of genetics and evolution Quantitative genetics considers characters

More information

EVOLUTION UNIT. 3. Unlike his predecessors, Darwin proposed a mechanism by which evolution could occur called.

EVOLUTION UNIT. 3. Unlike his predecessors, Darwin proposed a mechanism by which evolution could occur called. EVOLUTION UNIT Name Read Chapters 1.3, 20, 21, 22, 24.1 and 35.9 and complete the following. Chapter 1.3 Review from The Science of Biology 1. Discuss the influences, experiences and observations that

More information

Population Genetics I. Bio

Population Genetics I. Bio Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn

More information

Enduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.

Enduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc. Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding

More information

Since we re not going to have review this week either

Since we re not going to have review this week either Since we re not going to have review this week either I am posting these slides to help with reviewing the material that we didn t cover during discussion sessions these past two weeks. Of course, take

More information

Lesson 2 Evolution of population (microevolution)

Lesson 2 Evolution of population (microevolution) Lesson 2 Evolution of population (microevolution) 1. A gene pool consists of a. all the aleles exposed to natural selection. b. the total of all alleles present in a population. c. the entire genome of

More information

Biology Eighth Edition Neil Campbell and Jane Reece

Biology Eighth Edition Neil Campbell and Jane Reece BIG IDEA I The process of evolution drives the diversity and unity of life. Enduring Understanding 1.A Change in the genetic makeup of a population over time is evolution. Essential Knowledge 1.A.1 Natural

More information

Ecology and Evolutionary Biology 2245/2245W Exam 3 April 5, 2012

Ecology and Evolutionary Biology 2245/2245W Exam 3 April 5, 2012 Name p. 1 Ecology and Evolutionary Biology 2245/2245W Exam 3 April 5, 2012 Print your complete name clearly at the top of each page. This exam should have 6 pages count the pages in your copy to make sure.

More information

Unit 2 Lesson 4 - Heredity. 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity

Unit 2 Lesson 4 - Heredity. 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity Unit 2 Lesson 4 - Heredity 7 th Grade Cells and Heredity (Mod A) Unit 2 Lesson 4 - Heredity Give Peas a Chance What is heredity? Traits, such as hair color, result from the information stored in genetic

More information

THE WORK OF GREGOR MENDEL

THE WORK OF GREGOR MENDEL GENETICS NOTES THE WORK OF GREGOR MENDEL Genetics-. - Austrian monk- the father of genetics- carried out his work on. Pea flowers are naturally, which means that sperm cells fertilize the egg cells in

More information

How to Use This Presentation

How to Use This Presentation How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

Question: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation?

Question: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation? October 12, 2009 Bioe 109 Fall 2009 Lecture 8 Microevolution 1 - selection The Hardy-Weinberg-Castle Equilibrium - consider a single locus with two alleles A 1 and A 2. - three genotypes are thus possible:

More information

DNA, Chromosomes, and Genes

DNA, Chromosomes, and Genes N, hromosomes, and Genes 1 You have most likely already learned about deoxyribonucleic acid (N), chromosomes, and genes. You have learned that all three of these substances have something to do with heredity

More information

Alleles Notes. 3. In the above table, circle each symbol that represents part of a DNA molecule. Underline each word that is the name of a protein.

Alleles Notes. 3. In the above table, circle each symbol that represents part of a DNA molecule. Underline each word that is the name of a protein. Alleles Notes Different versions of the same gene are called alleles. Different alleles give the instructions for making different versions of a protein. This table shows examples for two human genes.

More information

STAT 536: Migration. Karin S. Dorman. October 3, Department of Statistics Iowa State University

STAT 536: Migration. Karin S. Dorman. October 3, Department of Statistics Iowa State University STAT 536: Migration Karin S. Dorman Department of Statistics Iowa State University October 3, 2006 Migration Introduction Migration is the movement of individuals between populations. Until now we have

More information

Introduction to Quantitative Genetics. Introduction to Quantitative Genetics

Introduction to Quantitative Genetics. Introduction to Quantitative Genetics Introduction to Quantitative Genetics Historical Background Quantitative genetics is the study of continuous or quantitative traits and their underlying mechanisms. The main principals of quantitative

More information

Biological Change Over Time. Lecture 12: Evolution. Microevolution. Microevolutionary Processes. Genotypes, Phenotypes and Environmental Effects

Biological Change Over Time. Lecture 12: Evolution. Microevolution. Microevolutionary Processes. Genotypes, Phenotypes and Environmental Effects Lecture 12: Evolution Biological Change Over Time Key terms: Reading: Ch16: Microevolution Ch17:Speciation Ch18:Macroevolution Microevolution Changes with in species Well defined mechanism Easily observed

More information

AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny

AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny 1A1- Natural selection is a major mechanism of evolution. 1A2: Natural selection acts on phenotypic variations in

More information

Evolution PCB4674 Midterm exam2 Mar

Evolution PCB4674 Midterm exam2 Mar Evolution PCB4674 Midterm exam2 Mar 22 2005 Name: ID: For each multiple choice question select the single est answer. Answer questions 1 to 20 on your scantron sheet. Answer the remaining questions in

More information

Microevolution Changing Allele Frequencies

Microevolution Changing Allele Frequencies Microevolution Changing Allele Frequencies Evolution Evolution is defined as a change in the inherited characteristics of biological populations over successive generations. Microevolution involves the

More information

Full file at CHAPTER 2 Genetics

Full file at   CHAPTER 2 Genetics CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces

More information

These are my slides and notes introducing the Red Queen Game to the National Association of Biology Teachers meeting in Denver in 2016.

These are my slides and notes introducing the Red Queen Game to the National Association of Biology Teachers meeting in Denver in 2016. These are my slides and notes introducing the Red Queen Game to the National Association of Biology Teachers meeting in Denver in 2016. Thank you SSE and the Huxley Award for sending me to NABT 2016! I

More information

Mechanisms of Evolution

Mechanisms of Evolution Mechanisms of Evolution 36-149 The Tree of Life Christopher R. Genovese Department of Statistics 132H Baker Hall x8-7836 http://www.stat.cmu.edu/ ~ genovese/. Plan 1. Two More Generations 2. The Hardy-Weinberg

More information

Population genetics. Key Concepts. Hardy-Weinberg equilibrium 3/21/2019. Chapter 6 The ways of change: drift and selection

Population genetics. Key Concepts. Hardy-Weinberg equilibrium 3/21/2019. Chapter 6 The ways of change: drift and selection Chapter 6 The ways of change: drift and selection Population genetics Study of the distribution of alleles in populations and causes of allele frequency changes Key Concepts Diploid individuals carry two

More information

REVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly).

REVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly). Name: REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin didn

More information

Mathematical modelling of Population Genetics: Daniel Bichener

Mathematical modelling of Population Genetics: Daniel Bichener Mathematical modelling of Population Genetics: Daniel Bichener Contents 1 Introduction 3 2 Haploid Genetics 4 2.1 Allele Frequencies......................... 4 2.2 Natural Selection in Discrete Time...............

More information

URN MODELS: the Ewens Sampling Lemma

URN MODELS: the Ewens Sampling Lemma Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 3, 2014 1 2 3 4 Mutation Mutation: typical values for parameters Equilibrium Probability of fixation 5 6 Ewens Sampling

More information

6.6 Meiosis and Genetic Variation. KEY CONCEPT Independent assortment and crossing over during meiosis result in genetic diversity.

6.6 Meiosis and Genetic Variation. KEY CONCEPT Independent assortment and crossing over during meiosis result in genetic diversity. 6.6 Meiosis and Genetic Variation KEY CONCEPT Independent assortment and crossing over during meiosis result in genetic diversity. 6.6 Meiosis and Genetic Variation! Sexual reproduction creates unique

More information

Lecture 2: Introduction to Quantitative Genetics

Lecture 2: Introduction to Quantitative Genetics Lecture 2: Introduction to Quantitative Genetics Bruce Walsh lecture notes Introduction to Quantitative Genetics SISG, Seattle 16 18 July 2018 1 Basic model of Quantitative Genetics Phenotypic value --

More information

tices of the following two main types. One culling criterion is to favor the phenotypes above a threshold value. In the other

tices of the following two main types. One culling criterion is to favor the phenotypes above a threshold value. In the other Proc. Nat. cad. Sci. US Vol. 7, No., pp. 77-73, December 97 Some Population Genetic Models Combining rtificial and Natural Selection Pressures (culling/viability selection/stable equilibria/genotypic phenotypic

More information

The Genetics of Natural Selection

The Genetics of Natural Selection The Genetics of Natural Selection Introduction So far in this course, we ve focused on describing the pattern of variation within and among populations. We ve talked about inbreeding, which causes genotype

More information

BIO S380T Page 1 Summer 2005: Exam 2

BIO S380T Page 1 Summer 2005: Exam 2 BIO S380T Page 1 Part I: Definitions. [5 points for each term] For each term, provide a brief definition that also indicates why the term is important in ecology or evolutionary biology. Where I ve provided

More information