Functional divergence 1: FFTNS and Shifting balance theory
|
|
- Leslie Patrick
- 5 years ago
- Views:
Transcription
1 Functional divergence 1: FFTNS and Shifting balance theory There is no conflict between neutralists and selectionists on the role of natural selection: Natural selection is the only explanation for adaptation 1
2 A review of fitness Fitness has two components: 1. Viability; an individual s ability to survive to reproduce 2. Fecundity; an individual s reproductive output. A review of fitness Evolutionary fitness is symbolized with W Genotype Phenotype Symbolism AA Aa W AA W Aa 1 1 aa W aa
3 A review of fitness: Directional selection Fitness AA Aa aa Genotypes W AA > W Aa > W aa Directional selection occurs when selection favors the phenotype at an extreme of the range of phenotypes. exerts pressure for FIXATION (frequency goes to 1) imposes a direction on evolution A review of fitness: overdominat selection 1 Fitness AA Aa aa W AA < W Aa > W aa Genotypes Overdominant selection occurs when the heterozygote has a greater fitness than either homozygote. also called balancing selection or heterozygote advantage maintains a stable polymorphism; acts against fixation 3
4 A review of fitness: Symbolism for generation 0 Genotype AA Aa aa Frequency 2 p 0 2p 0 q 0 2 q 0 Phenotype W AA W Aa W aa Survival ratio: W AA : W Aa : W aa Genotype ratio: p 2 W AA : 2pqW Aa : q 2 W aa Problem: the genotype ratios do not sum to 1. A review of fitness: Normalize by dividing by the grand total after selection: W = p 2 W AA + 2pqW Aa + q 2 W aa W = AVERAGE FITNESS Genetic load: 1 W 4
5 Fisher s fundamental theorem of natural selection: FFTNS In words: The rate of increase in the average fitness of a population is equal to the genetic component of the variation in fitness Fisher s fundamental theorem of natural selection: FFTNS FFTNS is based on the well known formula for the response of a population to phenotypic selection (R). R = h 2 S h 2 : The proportion of total phenotypic variance that is predictably transmitted to next generation (i.e., additive genetic component of variance) S: SELECTION DIFFERENTIAL; the difference between the mean phenotype of those under selection and the mean phenotype of the population. 5
6 FFTNS R = W = Va W ( W ) The change in population fitness depends on just two parameters. W : The average fitness of the population V a (W): Additive component of the total variation in fitness Biological implications of FFTNS 1. Populations can t adapt without genetic variance in fitness Va(W) : zero or positive only Va(W) = 0, then change in average fitness = 0 2. Rate of population evolution depends on mean fitness 3. Fitness always increases Not as trivial as it seems. populations only go to local maximum populations cannot explore entire set of outcomes selection can prevent further adaptation 6
7 Adaptive topography Adaptive topography; a surface of mean fitness for a population where peaks represent the highest values of mean fitness, and valleys the lowest values of mean fitness. Also called: Adaptive landscape Fitness topography Fitness landscape Adaptive topography The most simple case: 1 locus, 2 alleles, directional selection W = p 2 W AA + 2pqW Aa + q 2 W aa Ave fitness of popualtion W AA =0.1 W Aa = 0.75 W aa = 1 Directional selection frequncey of allele "a" 7
8 Adaptive topography Another simple case: 1 locus, 2 alleles, overdominant selection W = p 2 W AA + 2pqW Aa + q 2 W aa Ave fitness of poplation W AA = 0.5 W Aa = 1 W aa = freqeuncy of allele "a" Adaptive topography More complex case: 1 locus, 3 alleles, overdominant & directional selection. we need a De Finetti diagram 8
9 Introduction to the De Finetti diagram: Indicates: Allele 1: freq = 0.35 Allele 2: freq = 0.15 Allele 3: freq = 0.50 Allele 1 Alleles 2 and 3 have freq =0 at this vertex Alleles 1 and 2have freq =0 at this vertex Allele 2 Allele 3 Alleles 1 and 3 have freq =0 at this vertex Adaptive topography More complex case: 1 locus, 3 alleles, overdominant & directional selection Lines: fitness contours where the frequencies of the three alleles yield the same population fitness Allele 1 Lowest mean fitness Local peak in mean fitness Valley on the fitness landscape Global peak in mean fitness Allele 2 Allele 3 9
10 Adaptive topography More complex case: 1 locus, 3 alleles, overdominant & directional selection start here end here start here end here Difficult assumptions of FFTNS 1. Constant fitness through time 2. Complete linkage equilibrium 3. Fitness must be the phenotype 4. No genetic drift not useful as a general model over long periods of time very useful for examining specific aspects of the evolutionary process 10
11 A new term: the marginal fitness of an allele Marginal fitness: the average fitness of all individuals in a population that bear a certain allele. Also called: average affect of an allele Notation for a allele: W a marginal fitness Allele A (freq = p) Allele a (freq = q) W a = q(w aa ) + p(w Aa ) Allele A (freq = p) Allele a (freq = q) Allele c (freq = r) W a = q(w aa ) + p(w Aa ) + r(w ac ) W a - W = 0; no change in frequency of a W a - W > 0; the a allele increases in frequency W a - W < 0; the a allele decreases in frequency 11
12 Adaptation in human populations: sickle cell haemoglobin Sickle morphology of RBCs leads to a crisis Sickle morphology is triggered by extreme deoxygenating event (0.1 to 1 second). Crisis leads to anemia 12
13 Sickle cell crisis and anemia have profound clinical consequences S-RBC lifespan: 20 days (verses 120) The genetics you probably already know A allele: normal hemoglobin S allele: single amino acid substitution at position 6 (GLU Val) Genotypes AA AS SS Blood Phenotype Normal 40% sickling of RBCs Sickle cell anaemia AS phenotyoe: 1. Selective sickling of plasmodium infected cells: direct destruction [?] 2. High oxygen radical production by sickle-cells kills parasites [?] 3. Promotes immune system attack 13
14 S allele is maintained in human populations by natural selection A and S allele polymorphism is classic example of overdominant selection Genotypes AA AS SS Blood Phenotype Normal 40% sickling of RBCs Sickle cell anaemia Mortality 1 moderate Low very high Fitness * : Fitness and mortality are estimated as an average over 72 west African populations of humans. Data from Cavalli-Sforza and Bodmer (1971). * Cerebral anemia is not fun 14
15 A and S allele polymorphism is classic example of overdominant selection Ave fitness of poplation freqeuncy of allele "S" As before, the fitness of the population can only go uphill. Marginal fitness calculations verify this result. Initial freq of S = 0.01: W S = 0.99 and W = 0.89 W S - W = 0.11; the S allele will increase Initial freq of S = 0.25: W S = 0.8 and W = 0.89 W S - W = ; the S allele will decrease Peak in average fitness of population Natural selection arrives at a solution that protects about 20% of the population There is another allele called C 15
16 A and C allele polymorphism is classic example of directional selection Genotypes AA AC Blood Phenotype Normal Normal Fitness 0.89 * 0.89 * Data from Cavalli-Sforza and Bodmer (1971). CC Resistant 1 * Cerebral anemia is not fun A and C allele polymorphism is classic example of directional selection Ave fitness of popualtion frequncey of allele "a" c As before, the fitness of the population can only go uphill. Marginal fitness calculations verify this result. Initial freq of C = 0.01: W C = and W = W C - W = ; the C allele will slowly increase Initial freq of C = 0.25: W C = and W = 0.90 W C - W= +0.02; the C allele will increase Peak in average fitness of population Natural selection arrives at a solution that protects about 100% of the population 16
17 Most human populations have adapted by going to a balanced A/S polymorphism Let s consider a population with A, S and C alleles Frequency of A = p Frequency of S = q Frequency of C = r Genotypes AA AS SS AC SC CC Frequency p 2 2pq q 2 2pr 2qr r 2 Fitness Mortality 1 moderate low Very high moderate moderate low Anaemia none some severe none some none 1: Fitness and mortality are estimated as an average over 72 west African populations of humans. Data from Cavalli-Sforza and Bodmer (1971). 17
18 Let s consider a population with A, S and C alleles Population close to balanced A/S polymorphism: Frequency of A = = p Frequency of S = = q Frequency of C = = r W = W S = q(w SS ) + p(w AS ) + r(w SC ) W S = 0.12(0.2) (1) (0.71) W S = W C = r(w CC ) + p(w AC ) + q(w SC ) W C = 0.001(1.31) (0.89) (0.71) W C = Importance of historical effects 2. Natural selection can prevent adaptation Let s consider a population with A, S and C alleles Assume both S and C are rare: Frequency of A = = p Frequency of S = 0.05 = q Frequency of C = 0.01 = r W S = W C = W = W S - W= 0.06; The S allele invades! W C - W = -0.01; the C allele cannot invade! 18
19 Adaptive topography for three allele case [same as before] S allele In this region the C allele only needs to be a littler more than 10% The C allele has to start with a high frequency in order for it to invade A allele C allele Let s consider a population with A, S and C alleles Assume both S and C are rare: Frequency of A = 0.64 = p Frequency of S = 0.25 = q Frequency of C = 0.11 = r W S = W C = W = W S - W = -0.10; The S allele is a gonner! W C - W = +0.01; the C allele invades! 19
20 Adaptive topography for three allele case Natural selection cannot move population across the valley! Two other population genetic forces can: 1. Strong genetic drift: increase C > 10% 2. Inbreeding: does not change allele frequencies reduce frequency of AS heterozygote Increase frequency of CC homozygote Sewall Wright: shifting balance theory (SBT) of evolution The problem as I see it is that of a mechanism by which species may continually find its way from lower to higher peaks 20
21 SBT: assumptions Assumption 1: Large amount of polymorphism in equilibrium. Variation must be relevant to fitness Fitness variation is relevant to minor factors Assumption 2: Each gene has many phenotypic effects [pleiotropy] Assumption 3: Complex adaptive topography Assumption 4: Multiple, partially isolated populations 21
22 22
23 23
24 SBT: Three phases 1. Phase of genetic Drift [exploration] 2. Phase of Mass selection 3. Phase of inter-population selection 24
25 Difficulties with SBT 1. Species never get stuck on peaks; there is always a way off. 2. N e of natural populations too large for drift to move them around to the degree required by SBT SBT has been controversial since the beginning 25
26 Modern difficulties with SBT 1. Requires: low migration rates for exploration and transition [phases 1 and 2]; and higher migration rates for phase Population structures typical of natural populations seem to be too small for phase 1 3. Group selection is a weak force for evolution, and hence unlikely to result in a shift in equilibrium: an extremely high amount of migration is required among sub-populations for phase 3 to work. 4. Alternatives seem more likely. Wright suggested some alternatives 1. Change in environment.. 2. Mutation.. 3. Change in strength of selection.. It seems that SBT and the alternatives require some waiting 26
27 SBT and FFTNS are important theories Their status and role are quite different from that of the neutral theory 27
Genetical theory of natural selection
Reminders Genetical theory of natural selection Chapter 12 Natural selection evolution Natural selection evolution by natural selection Natural selection can have no effect unless phenotypes differ in
More informationNatural Selection. DNA encodes information that interacts with the environment to influence phenotype
Natural Selection DN encodes information that interacts with the environment to influence phenotype mong The Traits That Can Be Influenced By Genetically Determined Responses to the Environment re: 1.
More informationApplication Evolution: Part 1.1 Basics of Coevolution Dynamics
Application Evolution: Part 1.1 Basics of Coevolution Dynamics S. chilense S. peruvianum Summer Semester 2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or
More informationDarwinian Selection. Chapter 7 Selection I 12/5/14. v evolution vs. natural selection? v evolution. v natural selection
Chapter 7 Selection I Selection in Haploids Selection in Diploids Mutation-Selection Balance Darwinian Selection v evolution vs. natural selection? v evolution ² descent with modification ² change in allele
More informationPOPULATIONS. p t+1 = p t (1-u) + q t (v) p t+1 = p t (1-u) + (1-p t ) (v) Phenotypic Evolution: Process HOW DOES MUTATION CHANGE ALLELE FREQUENCIES?
Phenotypic Evolution: Process MUTATION SELECTION + POPULATIONS +/ MIGRATION DRIFT HOW DOES MUTATION CHANGE ALLELE FREQUENCIES? Assume: a single autosomal locus with 2 alleles. Frequency (A) = p Frequency
More informationQuestion: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation?
October 12, 2009 Bioe 109 Fall 2009 Lecture 8 Microevolution 1 - selection The Hardy-Weinberg-Castle Equilibrium - consider a single locus with two alleles A 1 and A 2. - three genotypes are thus possible:
More information(Write your name on every page. One point will be deducted for every page without your name!)
POPULATION GENETICS AND MICROEVOLUTIONARY THEORY FINAL EXAMINATION (Write your name on every page. One point will be deducted for every page without your name!) 1. Briefly define (5 points each): a) Average
More informationNatural Selection results in increase in one (or more) genotypes relative to other genotypes.
Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Fitness - The fitness of a genotype is the average per capita lifetime contribution of individuals of that
More informationSelection Page 1 sur 11. Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION
Selection Page 1 sur 11 Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION * I- Introduction II- Modeling and selective values III- Basic model IV- Equation of the recurrence of allele
More informationIs there any difference between adaptation fueled by standing genetic variation and adaptation fueled by new (de novo) mutations?
Visualizing evolution as it happens Spatiotemporal microbial evolution on antibiotic landscapes Michael Baym, Tami D. Lieberman,*, Eric D. Kelsic, Remy Chait, Rotem Gross, Idan Yelin, Roy Kishony Science
More informationMicroevolution 2 mutation & migration
Microevolution 2 mutation & migration Assumptions of Hardy-Weinberg equilibrium 1. Mating is random 2. Population size is infinite (i.e., no genetic drift) 3. No migration 4. No mutation 5. No selection
More informationStudy of similarities and differences in body plans of major groups Puzzling patterns:
Processes of Evolution Evolutionary Theories Widely used to interpret the past and present, and even to predict the future Reveal connections between the geological record, fossil record, and organismal
More informationGenetics and Natural Selection
Genetics and Natural Selection Darwin did not have an understanding of the mechanisms of inheritance and thus did not understand how natural selection would alter the patterns of inheritance in a population.
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationFebuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution. Classical vs. balanced views of genome structure
Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution Classical vs. balanced views of genome structure - the proposal of the neutral theory by Kimura in 1968 led to the so-called neutralist-selectionist
More information6.891: Computational Evolutionary Biology. R.C. Berwick & a cast of thousands Today: the forces of evolution, III
6.891: Computational Evolutionary Biology R.C. Berwick & a cast of thousands Today: the forces of evolution, III The forces of evolution, III Does selection maximize fitness? Does sex make you fitter?
More informationLife Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 009 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationMechanisms of Evolution Microevolution. Key Concepts. Population Genetics
Mechanisms of Evolution Microevolution Population Genetics Key Concepts 23.1: Population genetics provides a foundation for studying evolution 23.2: Mutation and sexual recombination produce the variation
More informationThere are 3 parts to this exam. Use your time efficiently and be sure to put your name on the top of each page.
EVOLUTIONARY BIOLOGY EXAM #1 Fall 2017 There are 3 parts to this exam. Use your time efficiently and be sure to put your name on the top of each page. Part I. True (T) or False (F) (2 points each). Circle
More informationPopulation genetics. Key Concepts. Hardy-Weinberg equilibrium 3/21/2019. Chapter 6 The ways of change: drift and selection
Chapter 6 The ways of change: drift and selection Population genetics Study of the distribution of alleles in populations and causes of allele frequency changes Key Concepts Diploid individuals carry two
More informationChapter 7: Covalent Structure of Proteins. Voet & Voet: Pages ,
Chapter 7: Covalent Structure of Proteins Voet & Voet: Pages 163-164, 185-194 Slide 1 Structure & Function Function is best understood in terms of structure Four levels of structure that apply to proteins
More informationACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics
ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying
More informationBIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES.
Enduring Understanding 4.C Independent Study Assignment Assignment Instructions Both components of this assignment (Part I and Part II) should be completed on the pages provided. Each numbered component
More information8. Genetic Diversity
8. Genetic Diversity Many ways to measure the diversity of a population: For any measure of diversity, we expect an estimate to be: when only one kind of object is present; low when >1 kind of objects
More informationMigration In evolutionary terms, migration is defined as movement that will result in gene flow, or the movement of genes from one place to another
Biology 1B Evolution Lecture 5, Migration and forms of selection Migration In evolutionary terms, migration is defined as movement that will result in gene flow, or the movement of genes from one place
More informationPopulation Genetics of Selection
Population Genetics of Selection Jay Taylor School of Mathematical and Statistical Sciences Arizona State University Jay Taylor (Arizona State University) Population Genetics of Selection 2009 1 / 50 Historical
More informationEvolution Module. 6.2 Selection (Revised) Bob Gardner and Lev Yampolski
Evolution Module 6.2 Selection (Revised) Bob Gardner and Lev Yampolski Integrative Biology and Statistics (BIOL 1810) Fall 2007 1 FITNESS VALUES Note. We start our quantitative exploration of selection
More informationThe Wright Fisher Controversy. Charles Goodnight Department of Biology University of Vermont
The Wright Fisher Controversy Charles Goodnight Department of Biology University of Vermont Outline Evolution and the Reductionist Approach Adding complexity to Evolution Implications Williams Principle
More informationD. Incorrect! That is what a phylogenetic tree intends to depict.
Genetics - Problem Drill 24: Evolutionary Genetics No. 1 of 10 1. A phylogenetic tree gives all of the following information except for. (A) DNA sequence homology among species. (B) Protein sequence similarity
More informationEvolutionary Genetics Midterm 2008
Student # Signature The Rules: (1) Before you start, make sure you ve got all six pages of the exam, and write your name legibly on each page. P1: /10 P2: /10 P3: /12 P4: /18 P5: /23 P6: /12 TOT: /85 (2)
More informationBIOL Evolution. Lecture 9
BIOL 432 - Evolution Lecture 9 J Krause et al. Nature 000, 1-4 (2010) doi:10.1038/nature08976 Selection http://www.youtube.com/watch?v=a38k mj0amhc&feature=playlist&p=61e033 F110013706&index=0&playnext=1
More information2. the variants differ with respect to their expected abilities to survive and reproduce in the present environment (S 0), then
Key ideas from lecture 1. Evolution by Natural Selection as a syllogism* (Endler 1986) 1. If there is heritable variation (h 2 >0), and 2. the variants differ with respect to their expected abilities to
More informationThe Genetics of Natural Selection
The Genetics of Natural Selection Introduction So far in this course, we ve focused on describing the pattern of variation within and among populations. We ve talked about inbreeding, which causes genotype
More informationPopulation Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationBig Idea #1: The process of evolution drives the diversity and unity of life
BIG IDEA! Big Idea #1: The process of evolution drives the diversity and unity of life Key Terms for this section: emigration phenotype adaptation evolution phylogenetic tree adaptive radiation fertility
More informationThe Mechanisms of Evolution
The Mechanisms of Evolution Figure.1 Darwin and the Voyage of the Beagle (Part 1) 2/8/2006 Dr. Michod Intro Biology 182 (PP 3) 4 The Mechanisms of Evolution Charles Darwin s Theory of Evolution Genetic
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationDarwinian Selection. Chapter 6 Natural Selection Basics 3/25/13. v evolution vs. natural selection? v evolution. v natural selection
Chapter 6 Natural Selection Basics Natural Selection Haploid Diploid, Sexual Results for a Diallelic Locus Fisher s Fundamental Theorem Darwinian Selection v evolution vs. natural selection? v evolution
More informationHow does natural selection change allele frequencies?
How does natural selection change allele frequencies? Alleles conferring resistance to insecticides and antibiotics have recently increased to high frequencies in many species of insects and bacteria.
More informationEvolution and the Genetics of Structured populations. Charles Goodnight Department of Biology University of Vermont
Evolution and the Genetics of Structured populations Charles Goodnight Department of Biology University of Vermont Outline What is Evolution Evolution and the Reductionist Approach Fisher/Wright Controversy
More informationNeutral Theory of Molecular Evolution
Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation
More informationLong-Term Response and Selection limits
Long-Term Response and Selection limits Bruce Walsh lecture notes Uppsala EQG 2012 course version 5 Feb 2012 Detailed reading: online chapters 23, 24 Idealized Long-term Response in a Large Population
More information19. Genetic Drift. The biological context. There are four basic consequences of genetic drift:
9. Genetic Drift Genetic drift is the alteration of gene frequencies due to sampling variation from one generation to the next. It operates to some degree in all finite populations, but can be significant
More informationEvolutionary Theory. Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A.
Evolutionary Theory Mathematical and Conceptual Foundations Sean H. Rice Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Contents Preface ix Introduction 1 CHAPTER 1 Selection on One
More informationLecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency
Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency Bruce Walsh lecture notes Introduction to Quantitative Genetics SISG, Seattle 16 18 July 2018 1 Outline Genetics of complex
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 013 Population genetics Outline of lectures 3-6 1. We ant to kno hat theory says about the reproduction of genotypes in a population. This results
More informationLECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50
LECTURE #10 A. The Hardy-Weinberg Equilibrium 1. From the definitions of p and q, and of p 2, 2pq, and q 2, an equilibrium is indicated (p + q) 2 = p 2 + 2pq + q 2 : if p and q remain constant, and if
More informationBiological Change Over Time. Lecture 12: Evolution. Microevolution. Microevolutionary Processes. Genotypes, Phenotypes and Environmental Effects
Lecture 12: Evolution Biological Change Over Time Key terms: Reading: Ch16: Microevolution Ch17:Speciation Ch18:Macroevolution Microevolution Changes with in species Well defined mechanism Easily observed
More informationIntroduction to Quantitative Genetics. Introduction to Quantitative Genetics
Introduction to Quantitative Genetics Historical Background Quantitative genetics is the study of continuous or quantitative traits and their underlying mechanisms. The main principals of quantitative
More informationEvolution of phenotypic traits
Quantitative genetics Evolution of phenotypic traits Very few phenotypic traits are controlled by one locus, as in our previous discussion of genetics and evolution Quantitative genetics considers characters
More informationPopulation Structure
Ch 4: Population Subdivision Population Structure v most natural populations exist across a landscape (or seascape) that is more or less divided into areas of suitable habitat v to the extent that populations
More informationEvolution by Natural Selection
Evolution by Natural Selection What is evolution? What is evolution? The change in the genetic makeup of a population over time (narrowly defined) Evolution accounts for the diversity of life on Earth
More informationQ Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2.
NCEA Level 2 Biology (91157) 2018 page 1 of 6 Assessment Schedule 2018 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Q Expected Coverage Achievement Merit Excellence
More informationThe Population Genetics of Selection
5 The Population Genetics of Selection Theoretical population genetics is surely a most unusual subject. At times it appears to have little connection with the parent subject on which it must depend, namely
More informationLecture #4-1/25/02 Dr. Kopeny
Lecture #4-1/25/02 Dr. Kopeny Genetic Drift Can Cause Evolution Genetic Drift: Random change in genetic structure of a population; due to chance Thought Experiment: What is your expectation regarding the
More informationURN MODELS: the Ewens Sampling Lemma
Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 3, 2014 1 2 3 4 Mutation Mutation: typical values for parameters Equilibrium Probability of fixation 5 6 Ewens Sampling
More informationThe neutral theory of molecular evolution
The neutral theory of molecular evolution Introduction I didn t make a big deal of it in what we just went over, but in deriving the Jukes-Cantor equation I used the phrase substitution rate instead of
More informationEvolutionary Genetics
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP Natural Selection HS2018 The importance of the great principle of selection mainly lies in the power of selecting scarcely appreciable differences,
More information- point mutations in most non-coding DNA sites likely are likely neutral in their phenotypic effects.
January 29 th, 2010 Bioe 109 Winter 2010 Lecture 10 Microevolution 3 - random genetic drift - one of the most important shifts in evolutionary thinking over the past 30 years has been an appreciation of
More information1 Errors in mitosis and meiosis can result in chromosomal abnormalities.
Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal
More informationSolutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin
Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin CHAPTER 1 1.2 The expected homozygosity, given allele
More informationQuantitative Trait Variation
Quantitative Trait Variation 1 Variation in phenotype In addition to understanding genetic variation within at-risk systems, phenotype variation is also important. reproductive fitness traits related to
More informationSTABILIZING SELECTION ON HUMAN BIRTH WEIGHT
STABILIZING SELECTION ON HUMAN BIRTH WEIGHT See Box 8.2 Mapping the Fitness Landscape in Z&E FROM: Cavalli-Sforza & Bodmer 1971 STABILIZING SELECTION ON THE GALL FLY, Eurosta solidaginis GALL DIAMETER
More informationMicroevolution Changing Allele Frequencies
Microevolution Changing Allele Frequencies Evolution Evolution is defined as a change in the inherited characteristics of biological populations over successive generations. Microevolution involves the
More informationLinking levels of selection with genetic modifiers
Linking levels of selection with genetic modifiers Sally Otto Department of Zoology & Biodiversity Research Centre University of British Columbia @sarperotto @sse_evolution @sse.evolution Sally Otto Department
More informationBIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B
BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 Natural Selection and Variation through
More informationMolecular Population Genetics
Molecular Population Genetics The 10 th CJK Bioinformatics Training Course in Jeju, Korea May, 2011 Yoshio Tateno National Institute of Genetics/POSTECH Top 10 species in INSDC (as of April, 2011) CONTENTS
More informationEvolution of quantitative traits
Evolution of quantitative traits Introduction Let s stop and review quickly where we ve come and where we re going We started our survey of quantitative genetics by pointing out that our objective was
More informationMathematical modelling of Population Genetics: Daniel Bichener
Mathematical modelling of Population Genetics: Daniel Bichener Contents 1 Introduction 3 2 Haploid Genetics 4 2.1 Allele Frequencies......................... 4 2.2 Natural Selection in Discrete Time...............
More informationPopulation Genetics: a tutorial
: a tutorial Institute for Science and Technology Austria ThRaSh 2014 provides the basic mathematical foundation of evolutionary theory allows a better understanding of experiments allows the development
More informationAP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny
AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny 1A1- Natural selection is a major mechanism of evolution. 1A2: Natural selection acts on phenotypic variations in
More informationReproduction and Evolution Practice Exam
Reproduction and Evolution Practice Exam Topics: Genetic concepts from the lecture notes including; o Mitosis and Meiosis, Homologous Chromosomes, Haploid vs Diploid cells Reproductive Strategies Heaviest
More informationLecture Notes: BIOL2007 Molecular Evolution
Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits
More informationEXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?
Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population
More informationPopulation Genetics. with implications for Linkage Disequilibrium. Chiara Sabatti, Human Genetics 6357a Gonda
1 Population Genetics with implications for Linkage Disequilibrium Chiara Sabatti, Human Genetics 6357a Gonda csabatti@mednet.ucla.edu 2 Hardy-Weinberg Hypotheses: infinite populations; no inbreeding;
More informationAGREE or DISAGREE? What s your understanding of EVOLUTION?
AGREE or DISAGREE? What s your understanding of EVOLUTION? Statement 1. Humans evolved from monkeys. Reasons for AGREE 0% Reasons for DISAGREE 100% Outcompeted by humans Humans and monkeys are evolving
More informationTheory of Natural Selection
5 The Theory of Natural Selection T his chapter introduces formal population genetic models. We first establish what the variables are that the models are concerned with, and the general structure of population
More informationProblems for 3505 (2011)
Problems for 505 (2011) 1. In the simplex of genotype distributions x + y + z = 1, for two alleles, the Hardy- Weinberg distributions x = p 2, y = 2pq, z = q 2 (p + q = 1) are characterized by y 2 = 4xz.
More informationoverproduction variation adaptation Natural Selection speciation adaptation Natural Selection speciation
Evolution Evolution Chapters 22-25 Changes in populations, species, or groups of species. Variances of the frequency of heritable traits that appear from one generation to the next. 2 Areas of Evolutionary
More informationIntroduction to Natural Selection. Ryan Hernandez Tim O Connor
Introduction to Natural Selection Ryan Hernandez Tim O Connor 1 Goals Learn about the population genetics of natural selection How to write a simple simulation with natural selection 2 Basic Biology genome
More informationREVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly).
Name: REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin didn
More informationEcology and Evolutionary Biology 2245/2245W Exam 3 April 5, 2012
Name p. 1 Ecology and Evolutionary Biology 2245/2245W Exam 3 April 5, 2012 Print your complete name clearly at the top of each page. This exam should have 6 pages count the pages in your copy to make sure.
More informationHistory of Evolution. Biol 490 Evolution
Biol 490 Evolution History of Evolution On November 24, 1859, Charles Darwin published On the Origin of Species by Means of Natural Selection. Darwin made two points: (1) Today s organisms descended from
More informationNOTES CH 17 Evolution of. Populations
NOTES CH 17 Evolution of Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Populations 17.1 Genes & Variation Darwin
More informationList the five conditions that can disturb genetic equilibrium in a population.(10)
List the five conditions that can disturb genetic equilibrium in a population.(10) The five conditions are non-random mating, small population size, immigration or emigration, mutations, and natural selection.
More informationEvolution - Unifying Theme of Biology Microevolution Chapters 13 &14
Evolution - Unifying Theme of Biology Microevolution Chapters 13 &14 New Synthesis Natural Selection Unequal Reproductive Success Examples and Selective Forces Types of Natural Selection Speciation http://www.biology-online.org/2/11_natural_selection.htm
More informationThere are 3 parts to this exam. Take your time and be sure to put your name on the top of each page.
EVOLUTIONARY BIOLOGY BIOS 30305 EXAM #2 FALL 2011 There are 3 parts to this exam. Take your time and be sure to put your name on the top of each page. Part I. True (T) or False (F) (2 points each). 1)
More informationEVOLUTION UNIT. 3. Unlike his predecessors, Darwin proposed a mechanism by which evolution could occur called.
EVOLUTION UNIT Name Read Chapters 1.3, 20, 21, 22, 24.1 and 35.9 and complete the following. Chapter 1.3 Review from The Science of Biology 1. Discuss the influences, experiences and observations that
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationEnduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.
Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding
More informationThe theory of evolution continues to be refined as scientists learn new information.
Section 3: The theory of evolution continues to be refined as scientists learn new information. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the conditions of the
More informationEffective population size and patterns of molecular evolution and variation
FunDamental concepts in genetics Effective population size and patterns of molecular evolution and variation Brian Charlesworth Abstract The effective size of a population,, determines the rate of change
More information1. they are influenced by many genetic loci. 2. they exhibit variation due to both genetic and environmental effects.
October 23, 2009 Bioe 109 Fall 2009 Lecture 13 Selection on quantitative traits Selection on quantitative traits - From Darwin's time onward, it has been widely recognized that natural populations harbor
More informationSelection and Population Genetics
Selection and Population Genetics Evolution by natural selection can occur when three conditions are satisfied: Variation within populations - individuals have different traits (phenotypes). height and
More informationLecture WS Evolutionary Genetics Part I 1
Quantitative genetics Quantitative genetics is the study of the inheritance of quantitative/continuous phenotypic traits, like human height and body size, grain colour in winter wheat or beak depth in
More informationA DISEASE ECOLOGIST S GUIDE TO EVOLUTION: EVIDENCE FROM HOST- PARASITE RELATIONSHIPS
A DISEASE ECOLOGIST S GUIDE TO EVOLUTION: EVIDENCE FROM HOST- PARASITE RELATIONSHIPS SARAH A. ORLOFSKE TEACHING EVOLUTION WORKSHOP UNIVERSITY OF COLORADO BOULDER sarah.orlofske@colorado.edu Ph.D. Candidate
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More information