UNIVERSIDAD POLITÉCNICA DE MADRID

Transcription

1 UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIEROS AGRÓNOMOS Functional characterization of YODA, a mitogen-activated protein kinase kinase kinase (MAP3K) that regulates a novel innate immunity pathway in Arabidopsis thaliana. TESIS DOCTORAL SARA SOPEÑA TORRES Bachelor in Biochemistry and Biology, MSc in Agroforestry Biotechnology 2015

2

3 UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIEROS AGRÓNOMOS Departamento de Biotecnología y Biología Vegetal Centro de Biotecnología y Genómica de Plantas (UPM-INIA) PhD Thesis: Functional characterization of YODA, a mitogen-activated protein kinase kinase kinase (MAP3K) that regulates a novel innate immunity pathway in Arabidopsis thaliana. Author: Sara Sopeña Torres Bachelor in Biochemistry and Biology, MSc in Agroforestry Biotechnology Director: Antonio Molina Fernández Bachelor in Biology PhD in Biology Madrid, 2015

4

5 ACKNOWLEDGEMENTS This PhD Thesis has been performed in the laboratory of Dr. Antonio Molina at the Centro de Biotecnología y Genómica de Plantas (CBGP UPM-INIA) of the Universidad Politécnica de Madrid. I would like to acknowledge the following people for their contribution to this work: Dr. Antonio Molina Fernández (CBGP, UPM), for his supervision during this Thesis, valuable comments and helpful discussion. Dr. Lucía Jordá Miró (CBGP, UPM), for theoretical and practical training, collaboration in several experiments included in this Thesis and proofreading. Dr. Clara Sánchez Rodríguez (CBGP, UPM), for her previous work in the characterization of elk2/yda11 mutant. Dr. Dierk Scheel and Dr. Justin Lee (Leibniz Institute of Plant Biochemistry (IPB), Halle-Saale, Germany) for hosting me during my PhD stages at IPB and for their collaboration and valuable comments that allowed me to carry out some essential experiments to determine the molecular function of YDA. Dr. Stefanie Ranf (IPB, Halle-Saale, Germany) for practical training in MAPK phosphorylation assays and calcium measurements in Arabidopsis thaliana. Dr. Miguel Ángel Torres (CBGP, UPM), for practical training in Pseudomonas syringae pv. tomato DC3000 assays and ROS measurements. Dr. Eva Miedes (CBGP, UPM), for her help in plant cell wall fractionationing, and performing the biochemical characterization and glycome profiling experiments at Dr. Michael Hahn s laboratory (Complex Carbohydrate Research Center, University of Georgia, USA) Dr. Pawel Bednarek (Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poland), for performing the secondary metabolites quantification. Dr. Paul Schulze-Lefert and Sabine Haigis (Max Planck Institute for Plant Breeding Research, Cologne, Germany), for performing the Golovinomyces orontii pathogenicity assays. Dr. Viviana Escudero Welsch (CBGP, UPM), for her valuable help and support during the development of this Thesis. v

6 I greatly appreciate the collaboration of Dr. Antonio Molina s laboratory former and present members for useful discussion and technical assistance. This work was supported by the Ministerio de Ciencia e Innovación of Spain (Grants BIO and BES ). The stages at Dr. Scheel s laboratory were supported by the Ministerio de Educación y Ciencia of Spain (Grants EEBB-I and EEBB-I ). vi

7 AGRADECIMIENTOS La realización de esta Tesis ha supuesto un arduo trabajo, y he de reconocer que sin el apoyo, el ánimo y los consejos de las personas con las que he compartido todo este tiempo, tanto en el laboratorio como fuera de él, nunca hubiera sido posible sacar este proyecto adelante. Quisiera agradecer a Antonio la confianza que ha depositado en mí desde que me convenció para embarcarme en este largo viaje. Me ha hecho ver que puedo abrirme camino en un mundo tan competitivo como el de la ciencia, que soy capaz de conseguir lo que me proponga, y que todo termina saliendo, independientemente de lo que cueste o lo que se tarde. A Lucía y a Vivi, muchísimas gracias por estar siempre ahí cuando os he necesitado. Sobre todo por haber tenido la paciencia de aguantarme todo este tiempo, y por ayudarme a superar los obstáculos del camino, que no han sido pocos Por todas las risas, llantos, alegrías y desengaños. Sin vosotras este viaje habría sido muy aburrido! A todos mis compañeros del , especialmente a Eva, que con su llegada dio color al laboratorio, y a Muñoz, que siempre afronta cualquier adversidad con buen humor. A la gente del CBGP, sois muchos y muy grandes. Gracias por toda la ayuda, las charlas, las risas y los momentos compartidos. To Dierk Scheel and all the people from his lab, thank you very much for your time and patience, especially to Stefi, Nicole, Lennart and Susanne, for making my life much easier during my stays at the IPB. A mis padres y a mi hermana, que me han apoyado y defendido siempre, a pesar de todas mis cabezonerías y mis berrinches. Sois únicos, y me siento muy afortunada de teneros a mi lado. Os quiero muchísimo. Y a Jose, mi compañero, gracias por quererme con todo lo que venía en el pack, por estar ahí en todo momento y por mantenerme cuerda durante esta larga etapa. Siempre consigues sacarme una sonrisa, por negros que sean los nubarrones que haya en el cielo. vii

8

9 ABBREVIATIONS [Ca 2+ ] cyt cytoplasmic calcium concentration 4MI3G 4-methoxyindol-3-ylmethyl glucosinolate ABA abscisic acid ABC ATP-binding cassette AEQ aequorin AGB1 Arabidopsis β subunit of heterotrimeric G protein ANOVA Analysis of Variance AP2/ERF APETALA2/ETHYLENE-RESPONSE ELEMENT BINDING FACTOR ATP adenosine triphosphate AtPep, Pep Arabidopsis endogenous danger peptide Avr Avirulence BAK1 BRI1-Associated Kinase 1 bhlh basic helix-loop-helix BIK1 Botrytis Induced Kinase 1 BIN2 Brassinosteroid Insensitive 2 BIR1 BAK1-Interacting Receptor-like kinase 1 BRI1 Brassinosteroid Insensitive 1 BRs brassinosteroids bzip basic domain leucine zipper Ca 2+ CaM CA-YDA CBEL CBGP CBL CC-NBS-LRR cdna CDPK, CPK CEBiP calcium ion calmodulin constitutive active form of YDA cellulose-binding elicitor lectin Centro de Biotecnología y Genómica de Plantas (UPM-INIA) calcineurin B-like Coiled-Coil Nucleotide Binding Site Leucine-Rich Repeat Resistance protein complementary deoxyribonucleic acid Calcium-Dependent Protein Kinase Chitin Elicitor-Binding Protein CERK1 Chitin Elicitor Receptor Kinase 1 CESA cellulose synthase cfu colony forming units CKs cytokinins Cl - chloride ion CLV CLAVATA Col-0 Arabidopsis thaliana accession Columbia-0 COS chitin oligosaccharide ix

10 CWI cell wall integrity DAMP damage-associated molecular pattern DNA deoxyribonucleic acid dpi days post inoculation DR disease rating EFR Elongation Factor-thermo unstable (EF-Tu) Receptor EF-Tu elongation factor-thermo unstable EGF epidermal growth factor EIX Ethylene-Inducing Xylanase elf18 elongation factor-tu epitope 18 elk erecta-like mutant emax enigmatic MAMP of Xanthomonas er erecta mutant ER ERECTA Receptor Like Kinase ERf ERECTA family ERL ERECTA-like receptor ET ethylene ETI effector-triggered immunity flg22 flagellin epitope 22 FLS2 FLAGELLIN SENSING2 FW fresh weight G protein guanine nucleotide binding protein Gas gibberellins Gβγ β and γ subunit heterodimer of heterotrimeric G protein gdna genomic deoxyribonucleic acid GO Gene Ontology GSK3 Glycogen Synthase Kinase 3 H + H 2 O 2 hydrogen ion hydrogen peroxide HC1, HC2 hemicellulosic fractions 1 and 2 Hpa Hyaloperonospora arabidopsidis hpi hours post-inoculation HPLC High-Performance Liquid Chromatography HR hypersensitive response HRP horseradish peroxidase I3A indol-3-ylmethylamine I3G indol-3-ylmethyl glucosinolate IG indol glucosinolate JA jasmonic acid K + La-0 potassium ion Arabidopsis thaliana accession Landsberg x

11 Lec lectin Log Logarithmic scale LORE Lipooligosaccharide-specific Reduced Elicitation LPS lipopolysaccharide LRR leucine-rich repeat LysM lysin motif MAMP microbe-associated molecular pattern MAP3K, MEKK Mitogen-Activated Protein Kinase Kinase Kinase MAPK, MPK Mitogen-Activated Protein Kinase MAPKK, MKK Mitogen-Activated Protein Kinase Kinase MKP MAP Kinase Phosphatase MLO Mildew Resistance locus O MS Murashige and Skoog medium NADPH nicotinamide adenine dinucleotide phosphate NO nitric oxide NO 3- OD 600 OG PAMP Pc, PcBMM nitrate ion Optical Density (600 nm) oligogalacturonide pathogen-associated molecular pattern Plectosphaerella cucumerina isolate BMM PC1, PC2 pectic fractions 1 and 2 PCR polymerase chain reaction PEPR AtPep Receptor PGN peptidoglycan PNS protein and neutral sugars fraction PP2A protein phosphatase 2A PP2C protein phosphatase 2C PR Pathogenesis Related PRR PAMP/pattern recognition receptor PTI PAMP/pattern-triggered immunity Pto Pseudomonas syringae pathovar tomato PUB plant U-box protein qpcr quantitative real-time polymerase chain reaction qrt-pcr quantitative real-time reverse transcription polymerase chain reaction QTL quantitative trait locus R protein Resistance protein RBOH, RboH Respiratory Burst Oxidase Homologue ReMAX Receptor of emax RIL recombinant inbred line RLCK Receptor-Like Cytoplasmic Kinase RLK Receptor-Like Kinase xi

12 RLP Receptor-Like Protein RLU relative light units RNA ribonucleic acid ROS reactive oxygen species RT room temperature SA salicylic acid SAR systemic acquired resistance SCFE1 Sclerotinia culture filtrate elicitor 1 SD standard deviation SE standard error SERK Somatic Embryogenesis Receptor Kinase SOBIR1 Suppressor of BIR1-1 TB trypan blue staining TF transcription factor TIR-NBS-LRR Toll/Interleukin 1 Receptor-Like-NBS-LRR protein TMM TOO MANY MOUTHS Trp tryptophan TS total sugars UA uronic acid WAK Wall-Associated Kinase WRKY transcription factor with a W-box binding domain WT wild-type Xoo Xanthomonas oryzae pathovar oryzae YDA YODA xii

13 TABLE OF CONTENTS ACKNOWLEDGEMENTS... v AGRADECIMIENTOS... vii ABBREVIATIONS... ix TABLE OF CONTENTS... xiii SUMMARY... xvii RESUMEN... xix 1. INTRODUCTION Plant innate immunity and mechanisms of pathogens/pests recognition PAMPs and DAMPs in PTI Bacterial PAMPs PAMPs from fungi and oomycetes Plant derived DAMPs Plant pattern recognition receptors (PRRs) and PAMPs/DAMPs recognition PRR co-receptors and cytoplasmic protein interactors Function of SERK proteins in PTI BIR1 and SOBIR1 function in PTI Receptor-like cytoplasmic kinases PTI signalling attenuation through PRRs stability regulation PTI molecular responses Ca 2+ -mediated signalling in PTI Production of Reactive Oxygen Species (ROS) Mitogen-activated protein kinase (MAPK) cascades in PTI Transcriptional regulation of PTI Effector-triggered immunity (ETI) Additional mechanisms of defense contributing to plant resistance to pathogens The role of secondary metabolites in basal and induced resistance Plant cell wall and resistance to pathogens Hormonal regulation of innate immunity xiii

14 1.9. The function of RLKs/RLPs in the regulation of plant development Arabidopsis thaliana - Plectosphaerella cucumerina pathosystem OBJECTIVES MATERIALS AND METHODS Plant material Arabidopsis growth conditions Pathogens and growth conditions Pathogenicity assays PcBMM fungal genomic biomass quantification Trypan blue stainings Callose deposition Aequorin luminescence measurements MAPK phosphorylation detection ROS burst assays Quantification of Trp derivatives Morphometric and stomatal analyses Arabidopsis DNA extraction Arabidopsis RNA extraction and cdna synthesis Generation and characterization of Arabidopsis double mutants Gene expression analyses Expression profiling Phosphoproteomic analyses Biochemical characterization of plant cell walls Glycome Profiling Phylogenetic analyses Informatics resources and bioinformatics tools RESULTS Map-based cloning and characterization of ELK2/YDA gene Expression of the constitutively active YDA protein (CA-YDA) confers enhanced resistance to PcBMM Expression of CA-YDA confers broad-spectrum resistance to pathogens Resistance of CA-YDA plants to powdery mildew disease xiv

15 Resistance of CA-YDA plants to Hyaloperonospora arabidopsidis Resistance of CA-YDA plants to P. syringae pv. tomato DC YDA and ER RLK define a novel immune pathway ER-YDA pathway regulates ER-associated developmental processes YDA is not a molecular component of the immune pathways mediated by CERK1 and FLS2 PRRs yda11 is not impaired in PAMP perception and activation of PTI responses [Ca 2+ ] cyt after PAMP treatment is similar in yda11 and wild-type plants Phosphorylation of MPKs is not impaired in yda11 upon PAMP treatment YDA and MPK3 genetically interact to regulate PTI and resistance to PcBMM Expression of PTI marker genes is not impaired in yda11 plants Hormone signalling and biosynthesis of Trp-derived metabolites are not impaired in yda11 mutant Comparative transcriptomic analysis revealed some set of defensive genes differentially regulated in yda11 plants CA-YDA plants do not show enhanced PTI responses Transcriptomic analysis of CA-YDA plants Phosphoproteomic analysis of CA-YDA plants Characterization of cell wall composition of yda11 and CA-YDA plants revealed significant alterations in CA-YDA cell wall integrity DISCUSSION CONCLUSIONS REFERENCES SUPPLEMENTAL TABLES... CD xv

16

17 SUMMARY Plant mitogen-activated protein kinase (MAPK) cascades transduce environmental signals and developmental cues into cellular responses. Among these signals are the pathogen- or microbe-associated molecular patterns (PAMPs or MAMPs) and the damage-associated molecular patterns (DAMPs). These PAMPs/DAMPs, upon recognition by plant pattern recognition receptors (PRRs), such as Receptor-Like Kinases (RLKs) and Receptor-Like Proteins (RLPs), activate molecular responses, including MAPK cascades, which regulate the onset of PAMP-triggered immunity (PTI). This Thesis describes the functional characterization of the MAPK kinase kinase (MAP3K) YODA (YDA) as a key regulator of Arabidopsis PTI. YDA has been previously described to control several developmental processes, such as stomatal patterning, zygote elongation and inflorescence architecture. We characterized a hypomorphic, nonembryo lethal mutant allele of YDA (elk2 or yda11) that was found to be highly susceptible to biotrophic and necrotrophic pathogens. Remarkably, plants expressing a constitutive active form of YDA (CA-YDA), with a deletion in the N-terminal domain, showed broad-spectrum resistance to different types of pathogens, including fungi, oomycetes and bacteria, indicating that YDA plays a relevant function in plant resistance to pathogens. Our data indicated that this function is independent of the immune responses regulated by the well characterized FLS2 and CERK1 RLKs, which are the PRRs recognizing flg22 and chitin PAMPs, respectively, and are required for Arabidopsis resistance to bacteria and fungi. We demonstrate that YDA controls resistance to the necrotrophic fungus Plectosphaerella cucumerina and stomatal patterning by genetically interacting with ERECTA (ER) RLK, a PRR involved in regulating these processes. In contrast, the genetic interaction between ER and YDA in the regulation of other ER-associated developmental processes was additive, rather than epistatic. Genetic analyses indicated that MPK3, a MAP kinase that functions downstream of YDA in stomatal development, also regulates plant resistance to P. cucumerina in a YDA-dependent manner, suggesting that the YDA-associated MAPK transduction module is shared in plant development and PTI. Our experiments revealed that YDA-mediated resistance was independent of signalling pathways regulated by defensive hormones like salicylic acid, jasmonic acid, abscisic acid or ethylene, and of the tryptophan-derived metabolites pathway, which are involved in plant immunity. In addition, we showed that PAMP-mediated PTI responses, such as the increase of cytoplasmic Ca 2+ concentration, reactive oxygen species (ROS) burst, MAPK phosphorylation, and expression of defense-related genes are not impaired in the yda11 mutant. Furthermore, xvii

18 the expression of CA-YDA protein does not result in enhanced PTI responses, further suggesting the existence of additional mechanisms of resistance regulated by YDA that differ from those regulated by the PTI receptors FLS2 and CERK1. In line with these observations, our transcriptomic data revealed the over-representation in CA-YDA plants of defensive genes, such as those encoding antimicrobial peptides and cell death regulators, and genes encoding cell wall-related proteins, suggesting a potential link between plant cell wall composition and integrity and broad spectrum resistance mediated by YDA. In addition, phosphoproteomic data revealed an over-representation of genes encoding wall-related proteins in CA-YDA plants in comparison with wild-type plants. The putative role of the ER-YDA pathway in regulating cell wall integrity was further supported by biochemical and glycomics analyses of er, yda11 and CA-YDA cell walls, which revealed significant changes in the cell wall composition of these genotypes compared with that of wild-type plants. In summary, our data indicate that ER and YDA are components of a novel immune pathway that regulates cell wall integrity and defensive responses, which confer broad-spectrum resistance to pathogens. xviii

19 RESUMEN Las cascadas de señalización mediadas por proteína quinasas activadas por mitógeno (MAP quinasas) son capaces de integrar y transducir señales ambientales en respuestas celulares. Entre estas señales se encuentran los PAMPs/MAMPs (Pathogen/Microbe-Associated Molecular Patterns), que son moléculas de patógenos o microorganismos, o los DAMPs (Damaged-Associated Molecular Patterns), que son moléculas derivadas de las plantas producidas en respuesta a daño celular. Tras el reconocimiento de los PAMPs/DAMPs por receptores de membrana denominados PRRs (Pattern Recognition Receptors), como los receptores con dominio quinasa (RLKs) o los receptores sin dominio quinasa (RLPs), se activan respuestas moleculares, incluidas cascadas de MAP quinasas, que regulan la puesta en marcha de la inmunidad activada por PAMPs (PTI). Esta Tesis describe la caracterización funcional de la MAP quinasa quinasa quinasa (MAP3K) YODA (YDA), que actúa como un regulador clave de la PTI en Arabidopsis. Se ha descrito previamente que YDA controla varios procesos de desarrollo, como la regulación del patrón estomático, la elongación del zigoto y la arquitectura floral. Hemos caracterizado un alelo mutante hipomórfico de YDA (elk2 o yda11) que presenta una elevada susceptibilidad a patógenos biótrofos y necrótrofos. Notablemente, plantas que expresan una forma constitutivamente activa de YDA (CA-YDA), con una deleción en el dominio N-terminal, presentan una resistencia de amplio espectro frente a diferentes tipos de patógenos, incluyendo hongos, oomicetos y bacterias, lo que indica que YDA juega un papel importante en la regulación de la resistencia de las plantas a patógenos. Nuestros datos indican que esta función es independiente de las respuestas inmunes mediadas por los receptores previamente caracterizados FLS2 y CERK1, que reconocen los PAMPs flg22 y quitina, respectivamente, y que están implicados en la resistencia de Arabidopsis frente a bacterias y hongos. Hemos demostrado que YDA controla la resistencia frente al hongo necrótrofo Plectosphaerella cucumerina y el patrón estomático mediante su interacción genética con la RLK ERECTA (ER), un PRR implicado en la regulación de estos procesos. Por el contrario, la interacción genética entre ER y YDA en la regulación de otros procesos de desarrollo es aditiva en lugar de epistática. Análisis genéticos indicaron que MPK3, una MAP quinasa que funciona aguas abajo de YDA en el desarrollo estomático, es un componente de la ruta de señalización mediada por YDA para la resistencia frente a P. cucumerina, lo que sugiere que el desarrollo de las plantas y la PTI comparten el módulo de transducción de MAP quinasas asociado a YDA. xix

20 Nuestros experimentos han revelado que la resistencia mediada por YDA es independiente de las rutas de señalización reguladas por las hormonas de defensa ácido salicílico, ácido jasmónico, ácido abscísico o etileno, y también es independiente de la ruta de metabolitos secundarios derivados del triptófano, que están implicados en inmunidad vegetal. Además, hemos demostrado que respuestas asociadas a PTI, como el aumento en la concentración de calcio citoplásmico, la producción de especies reactivas de oxígeno, la fosforilación de MAP quinasas y la expresión de genes de defensa, no están afectadas en el mutante yda11. La expresión constitutiva de la proteína CA-YDA en plantas de Arabidopsis no provoca un aumento de las respuestas PTI, lo que sugiere la existencia de mecanismos de resistencia adicionales regulados por YDA que son diferentes de los regulados por FLS2 y CERK1. En línea con estos resultados, nuestros datos transcriptómicos revelan una sobrerepresentación en plantas CA-YDA de genes de defensa que codifican, por ejemplo, péptidos antimicrobianos o reguladores de muerte celular, o proteínas implicadas en la biogénesis de la pared celular, lo que sugiere una conexión potencial entre la composición e integridad de la pared celular y la resistencia de amplio espectro mediada por YDA. Además, análisis de fosfoproteómica indican la fosforilación diferencial de proteínas relacionadas con la pared celular en plantas CA-YDA en comparación con plantas silvestres. El posible papel de la ruta ER- YDA en la regulación de la integridad de la pared celular está apoyado por análisis bioquímicos y glicómicos de las paredes celulares de plantas er, yda11 y CA-YDA, que revelaron cambios significativos en la composición de la pared celular de estos genotipos en comparación con la de plantas silvestres. En resumen, nuestros datos indican que ER y YDA forman parte de una nueva ruta de inmunidad que regula la integridad de la pared celular y respuestas defensivas, confiriendo una resistencia de amplio espectro frente a patógenos. xx

21 1. INTRODUCTION

22

23 Introduction 1. INTRODUCTION 1.1. Plant innate immunity and mechanisms of pathogens/pests recognition Throughout their life cycles, plants are constantly exposed to numerous environmental stresses, such as pathogen infection, pest attack, drought, flooding, cold or heat. The perception of these stresses and their transduction into appropriate defensive responses are essential for plant adaptation and survival. Plants lack specialized immune cells, but have evolved an effective defense system in which each cell can trigger immune responses autonomously (Zipfel, 2014). A two-tier recognition system was proposed for plant innate immunity (Jones and Dangl, 2006; Dodds and Rathjen, 2010). The first layer of this system is based on the sensitive perception of conserved pathogen- or microbe-associated molecular patterns (PAMPs or MAMPs, thereafter PAMPs) by surface-localized pattern recognition receptors (PRRs), leading to PAMP-triggered immunity or pattern-triggered immunity (PTI). The second layer is mediated by intracellular immune receptors, known as resistance (R) proteins, which can directly or indirectly detect the presence of effectors secreted within host cells by pathogens and pests, activating an immune response called effector-triggered immunity (ETI) (Figure 1.1; Jones and Dangl, 2006; Spoel and Dong, 2012). ETI frequently culminates in a programmed cell death (hypersensitive response, HR) of the infected cells and the production of antimicrobial molecules in the surrounding tissues (Spoel and Dong, 2012). The identification of a diverse set of PAMPs/effectors and their corresponding PRRs, as well as the structural characterization of their interactions, have contributed to understand relevant molecular features of the mechanisms of pathogens/pests recognition by plants, which are described below PAMPs and DAMPs in PTI PAMPs are conserved microbial epitopes within molecules that are essential for microbial survival. They are widely distributed among different groups of microbes, and can be recognized by a broad range of potential hosts. Despite overall conservation, the immunogenic epitopes of PAMPs are under positive selection to evade host immune detection (Monaghan and Zipfel, 2012). Plants are also able to detect damage-associated molecular patterns (DAMPs), which are either plant products resulting from the enzymatic activity of invading pathogens or host catalytic proteins, or plant endogenous peptides synthesized and/or 3

24 Introduction released following pathogen attack (Boller and Felix, 2009). Recognition of DAMPs also triggers immune responses that share some features with those activated by PAMPs (Figure 1.1; Yamaguchi and Huffaker, 2011). PAMPs Fungus Oomycete DAMPs?? ER LeEIX Ve / Cf Peps OGs Chitin/PGN Chitin/PGN PEPR1 WAK1 CERK1 LYM1 PEPR2 LYM3 elf18 flg22 EFR PAMPs FLS2 Bacterium SOBIR1 Haustorium BAK1 TTSS Cell surface immune receptors effectors PTI effectors Cell wall Plasma membrane ETI Immunity gene expression Intracellular immune receptors Nucleus Figure 1.1. Overview of the plant immune system. Pathogens of all lifestyle classes express PAMPs and MAMPs as they colonize plants (shapes are color coded to the pathogens). In addition, DAMPs are released from the cytoplasm and the cell wall upon cellular damage (green circles and diamonds). These PAMPs and DAMPs are perceived at the cell surface by pattern recognition receptors (PRRs), which can carry different motifs in their extracellular domains. This recognition initiates PAMP- or patterntriggered immunity (PTI). Pathogens deliver virulence effectors to the apoplast to block PAMP perception (not shown) and to the plant cytoplasm. These effectors are addressed to specific subcellular locations where they can suppress PTI and facilitate virulence, but they can be detected by specific intracellular immune receptors that activate effector-triggered immunity (ETI). Adapted from Dangl et al., 2013, and Robatzek,

25 Introduction Bacterial PAMPs Plants recognize many different bacterial PAMPs, such as lipopolysaccharides (LPS), peptidoglycans (PGN), flagellin, or the bacterial elongation factor Tu (EF-Tu). The elicitor-active epitope of flagellin, the major structural protein of bacterial flagella, was found to be a 22- amino acid peptide (flg22) located in the highly conserved N-terminus of flagellin, which is recognized by Arabidopsis thaliana and other plant species (Felix et al., 1999; Zipfel, 2014). However, plants seem able to recognize multiple epitopes within flagellin as some fieldisolated Pseudomonas syringae strains harbor a 28-amino acid epitope, flgii-28, that induces immune responses in several Solanaceae species, but it is not perceived by Arabidopsis flg22 receptor FLS2 (FLAGELLIN-SENSING2) (Cai et al., 2011; Clarke et al., 2013). Elf18, an N- acetylated peptide comprising the first 18 amino acids of the bacterial elongation factor Tu (EF-Tu), one of the most abundant bacterial protein, acts as a PAMP in Arabidopsis and other Brassicaceae, but not in other plant families, such as Solanaceae (Kunze et al., 2004). In rice, an elf18-independent EF-Tu perception system has evolved sensing a conserved, middle region fragment of bacterial EF-Tu, termed EFa50 (Furukawa et al., 2014). LPS are outer membrane glycolipids of Gram-negative bacteria known to induce innate immune responses in mammals, insects and plants. The main structure of LPS that functions as PAMP is the conserved lipid A, since it was found to induce transcriptional changes associated with plant defense responses, although the core oligosaccharide and the O-antigen structure are also recognized as PAMPs (Newman et al., 2013; Ranf et al., 2015). PGN, which consists of a conserved backbone of glycan strands cross-linked by highly variable peptide bridges, is an essential and unique cell wall component of all bacteria. It has been shown that PGN sugar backbone and breakdown products trigger immune responses in different plant species (Gust et al., 2007; Newman et al., 2013). Other bacterial PAMPs have been partially characterized, such as emax, an enigmatic proteinaceous PAMP partially purified from Xanthomonas axonopodis pv. citri that induce ethylene biosynthesis in several species of the Brassicaceae family, but it is not active in tomato, tobacco or pea (Jehle et al., 2013a) PAMPs from fungi and oomycetes Several PAMPs from fungi or oomycetes have been identified that can trigger immune signalling in different plant species. Almost all the plants can perceive fungal ergosterol and chitin, or PAMPs from different oomycetes such as arachidonic acid, elicitins, Pep13 and 5

26 Introduction cellulose-binding elicitor lectin (CBEL) (Zipfel 2014). Ergosterol, a 5,7-diene oxysterol, is the most predominant sterol found in fungal cell membranes, and acts as a PAMP molecule in tobacco and tomato plants (Klemptner et al., 2014). Chitin is a polymer of β-1,4-n-acetil-dglucosamine found in fungal cell walls that can be degraded by plant chitinases generating short chitin oligosaccharides (4 to 8-mer COS), which can induce defense responses in several plant systems (Shibuya and Minami, 2001; Liu et al., 2012). Pep13, the first molecule clearly defined as a PAMP in the 90s, is a 13-amino acid peptide fragment within a cell wall-associated calcium-dependent transglutaminase from the phytopathogenic oomycete Phytophthora sojae, which was shown to elicit plant defense in parsley and potato (Nürnberger et al., 1994; Brunner et al., 2002). The cellulose-binding elicitor lectin (CBEL glycoprotein) from Phytophthora parasitica var. nicotianae was shown to trigger defense responses in Arabidopsis and tobacco (Gaulin et al., 2006). The two cellulose-binding domains of CBEL are essential and sufficient to stimulate defense responses. The fungal hydrolytic enzyme ethylene-inducing xylanase (EIX) is an example of the large variety of fungal secreted proteins that are recognized by plants. EIX itself activates defense responses independent of its enzymatic activity in many plant species (Furman-Matarasso et al., 1999). More recently, the proteinaceous PAMP SCFE1 (Sclerotinia culture filtrate elicitor1) from Sclerotinia sclerotiorum has been partially purified and found to induce several PTI responses in Arabidopsis (Zhang et al., 2013) Plant derived DAMPs Examples of DAMPs include oligo-α-galacturonides (OGs) released from plant cell walls by fungal hydrolytic enzymes (Ferrari et al., 2013), some pectin-derived oligosaccharides (Decreux and Messiaen, 2005), and a collection of endogenous peptides, such as the plant elicitor peptides from Arabidopsis (AtPeps), that have been found to regulate developmental and immune responses (Huffaker et al., 2006; Yamaguchi and Huffaker, 2011). OGs elicit a wide range of defense responses in several plant species and are released from plant cell walls upon partial degradation of homogalacturonan, a pectic polysaccharide that maintains wall integrity and cell-cell cohesion (Brutus et al., 2010). Interestingly, the biological activity of OGs depends on their degree of polymerization (Côté and Hahn, 1994), and the presence of enzymatic modifications, such as esterification, acetylation or methylation, was also correlated with their capacity to regulate the expression of defense responses (Ferrari et al., 2013). AtPep peptides (AtPep1-AtPep8) are small peptides (23 to 36 amino acids in length) derived from the C-terminal part of eight small precursor proteins encoded by PROPEP genes, 6

27 Introduction whose expression is regulated by diverse stimuli like wounding or PAMPs (Huffaker and Ryan, 2007; Bartels et al., 2013). Synthetic AtPep peptides induce immune responses similar to those triggered by PAMPs, including the expression of defensive marker genes (Huffaker et al., 2006; Krol et al., 2010; Bartels et al., 2013). PROPEP orthologues are present in numerous species of dicots and monocots, and interestingly, treatment with Peps or overexpression of the PROPEP precursor genes enhances disease resistance in Arabidopsis and maize, highlighting the role of Peps as defensive regulators across plant species (Yamaguchi and Huffaker, 2011). Other molecules can be released upon cell rupture during pathogen attack or wounding and they might serve as danger signals. For example, ATP is actively released from plant cells in response to fungal elicitors, abiotic stresses, and mechanical stimuli, and it has been shown to regulate immune responses (Choi et al., 2014) Plant pattern recognition receptors (PRRs) and PAMPs/DAMPs recognition All plant PRRs characterized so far are plasma membrane-localized receptor-like kinases (RLKs) or receptor-like proteins (RLPs). RLKs contain an extracellular domain potentially involved in ligand binding, a single-pass transmembrane domain, and an intracellular kinase domain. RLPs have a similar structure than RLKs, but they lack the cytosolic kinase domain. The nature of the extracellular domains of PRRs is diverse, as they can contain, among others, leucine-rich repeats (LRR), lysin motifs (LysM), lectin motifs (Lec), or epidermal growth factor (EGF)-like domains (Figure 1.2; Macho and Zipfel, 2014). The Arabidopsis genome encodes more than 600 members of the RLK gene family (Shiu and Bleecker, 2001). Despite this large number of RLKs, only a few of them have been characterized in detail being the majority of them related with PTI functionality. In addition, more than 50 RLPs have been identified in Arabidopsis and from those some have been recently described as PRRs in PTI (Ron and Avni, 2004; Fritz-Laylin et al., 2005; Ramonell et al., 2005; Wang et al., 2008; Zhang et al., 2010; Fradin et al., 2011). One of the best studied LRR-RLKs is FLS2, which recognizes bacterial flagellin by direct binding of flg22 peptide (Gómez-Gómez and Boller, 2000; Chinchilla et al., 2006; Sun et al., 2013). FLS2 was initially identified in Arabidopsis, but functional orthologues have been described in Nicotiana benthamiana (Hann and Rathjen, 2007), tomato (Robatzek et al., 2007), rice (Takai et al., 2008) and grapevine (Trdá et al., 2014). Although FLS2 receptor is conserved in most plant species (Boller and Felix, 2009), the ligand recognition specificities vary among these FLS2 proteins. For example, in tomato the minimal recognized flagellin epitope is smaller 7

28 Introduction and more diverse than in Arabidopsis (Robatzek et al., 2007). Upon flg22 binding, FLS2 rapidly forms a complex with the regulatory LRR-RLK BAK1/SERK3 (BRI1-Associated Kinase1), a member of the somatic embryogenesis receptor kinase (SERK) family (Chinchilla et al., 2007), which acts as a co-receptor for multiple LRR-RLKs (Liebrand et al., 2014). A recent study has demonstrated that flg22 binds to the concave surface of the FLS2 extracellular domain (comprising LRR3 to LRR16), thereby promoting the direct interaction with BAK1 ectodomain, while the C-terminus of flg22 stabilizes the dimerization by acting as a bridge between the two RLKs ectodomains (Sun et al., 2013). Once the complex is formed, transphosphorylation events occur between FLS2 and BAK1, and downstream signalling is initiated (Figure 1.3). The Arabidopsis LRR-RLK EFR perceives EF-Tu by directly recognizing the conserved N- acetylated epitope elf18 (Zipfel et al., 2006). EFR and FLS2 both belong to clade XII of LRR-RLKs and they function similarly. EFR forms heteromeric complexes with at least four co-receptorlike kinases belonging to the SERK family, including BAK1, within seconds to minutes of ligand binding (Schulze et al., 2010; Roux et al., 2011; Schwessinger et al., 2011). In contrast to the wide conservation of the flagellin-fls2 perception system, the ability to perceive elf18 seems restricted to Brassicaceae (Boller and Felix, 2009). Transgenic overexpression of Arabidopsis EFR in tomato and N. benthamiana corroborated that EFR confers elf18 perception as these transgenic plants displayed an enhanced resistance to a diverse range of bacterial pathogens further proving the role of EFR in plant innate immunity (Lacombe et al., 2010). Fungal chitin is recognized in Arabidopsis by CERK1, which contains three extracellular LysM domains that bind long-chain chitin oligomers (6 to 8-mer COS), inducing CERK1 homodimerization and the phosphorylation of the intracellular kinase domain, activating immune signalling (Miya et al., 2007; Wan et al., 2008; Petutschnig et al., 2010; Liu et al., 2012). CERK1 can also bind shorter chitin oligomers (4 to 5 residues), but their perception does not induce receptor homodimerization and immune responses are not triggered (Liu et al., 2012). In contrast, the rice orthologue of Arabidopsis CERK1, OsCERK1, contains only one LysM motif in the extracellular domain and does not bind chitin (Shinya et al., 2012). OsCERK1 interacts with the LysM-RLP CEBiP (Chitin Elicitor-Binding Protein), a GPI-anchored protein that specifically binds chitin in rice (Kaku et al., 2006; Shimizu et al., 2010). It has been proposed that Arabidopsis CERK1 acts in concert with other LysM-RLKs (LYK4 and LYK5) to sense fungal chitin oligomers (Cao et al., 2014). Both Arabidopsis and rice CERK1 orthologues, as well as other LysM-RLPs (LYM1 and LYM3 in Arabidopsis, LYP4 and LYP6 in rice) are also required for PGN-triggered innate immunity (Willmann et al., 2011; Kouzai et al., 2014). 8

29 Introduction LRR-RLK LRR-RLP EGF-RLK LecRLK LysM-RLK/LysM-RLP FLS2, EFR PEPR1/2 EIX1/2 Ve1 ReMAX RLP42, Cfs LYK5 LYM1 OsLYP4 LYM3 OsLYP6 BAK1 BAK1 SOBIR1 SOBIR1 WAK1 DORN1 LORE CERK1 CERK1 OsCERK1 Leucine-rich repeats EGF-like domain Transmembrane domain GPI anchor LysM domain Lectin domain Kinase domain Figure 1.2. Classification of plant pattern-recognition receptors (PRRs) depending on their extracellular domain. PRR extracellular domain can contain leucine-rich repeats (LRR), lysin motifs (LysM), lectin motifs (Lec) or epidermal growth factor (EGF)-like domains. LRR-type PRRs bind to proteins or peptides, such as bacterial flagellin, bacterial EF-Tu or endogenous Pep peptides. Other domains are involved in the recognition of carbohydrate-containing molecules, such as fungal chitin, bacterial peptidoglycans, extracellular ATP, or plant cell wall-derived oligogalacturonides and pectins. LRR-RLKs form heterodimers with the LRR-RLK BAK1 in a ligand-dependent manner, while LRR-RLPs interact with BAK1, the LRR-RLK SOBIR1 or both. The inactive kinase domain of LYK5 is indicated in grey. Adapted from Böhm et al., Additional plant PRRs have been identified, such as Arabidopsis LecRLK LORE, rice LRR- RLK XA21, and several Arabidopsis RLPs, like ReMAX/RLP1 and RLP30. Arabidopsis LORE is a bulb-type lectin S-domain-1 RLK that was recently found to recognize the lipid A moiety of Pseudomonas sp. and X. campestris LPS (Ranf et al., 2015). Although LORE-mediated sensing of LPS is restricted to the plant family Brassicaceae, heterologous expression of LORE conferred sensitivity to LPS in N. benthamiana (Ranf et al., 2015). Rice LRR-RLK XA21 was first described as a locus conferring resistance to the pathogen X. oryzae pv. oryzae (Xoo; Ronald et al., 1992; Song et al., 1995). At the plasma membrane, XA21 binds to XB24 (XA21 binding protein 24), a rice specific ATPase that promotes XA21 autophosphorylation, keeping it in an inactive state 9

30 Introduction (Chen et al., 2010). Upon recognition of Xoo, XA21 dissociates from XB24 and is activated, triggering downstream defense responses (Chen et al., 2010). Recently, it has been shown that XA21 interacts constitutively with OsSERK2, rice BAK1 orthologue, and that this interaction is required for full downstream signalling initiation (Chen et al., 2014), but the specific ligand of XA21 remains unknown (Bahar et al., 2014). Partial purification of two novel PAMPs, enigmatic MAMP of Xanthomonas (emax) and Sclerotinia culture filtrate elicitor1 (SCFE1), allowed the identification of two novel LRR-RLPs from Arabidopsis (ReMAX/RLP1 and RLP30), in screenings based on the differential sensitivity of Arabidopsis accessions to these PAMP-containing fractions (Jehle et al., 2013a; Zhang et al., 2013). The ReMAX gene is crucifer specific, but it was found that a chimeric ReMAX protein, harboring the LRR ReMAX domain fused to the transmembrane and cytoplasmic domains of tomato EIX RLP, perceives emax and is functional when transiently expressed in the N. benthamiana heterologous system (Jehle et al., 2013a). Other LRR-RLPs that have been involved in plant immunity are the tomato Eix1 and Eix2, two PRRs that bind fungal xylanase (Ron and Avni, 2004); the tomato Ve1, that recognizes Ave1, a protein present in race 1 strains of Verticillium that appears to be conserved in multiple phytopathogenic fungi and bacteria (Fradin et al., 2009; de Jonge et al., 2012); Arabidopsis RBGP1/RLP42, that perceives fungal endopolygalacturonases (Zhang et al., 2014); or tomato Cf-9, which confers resistance to the filamentous fungus Cladosporium fulvum (Jones et al., 1994) Several RLKs have been identified (e.g. PEPR1, PEPR2, WAK1 and DORN1/LecRK-I.9) which are involved in DAMP perception. The LRR-RLKs PEPR1 and PEPR2 recognize endogenous AtPep peptides, such as AtPep1, AtPep2 or AtPep3 (Yamaguchi et al., 2006, 2010; Krol et al., 2010). Both receptors, which show sequence and functional homologies with FLS2 and EFR, interact with BAK1 and other PAMP defense components, activate signalling mechanisms typically associated with PAMP perception and induce the transcription of a set of defense-related genes which are also induced by flg22, elf18 and chitin (Krol et al., 2010; Yamaguchi et al., 2010; Yamaguchi and Huffaker, 2011). AtPep perception has been proposed to be part of a PTI amplification loop. Remarkably, PEPR signalling seems to coordinate hormone-related defense pathways and control ethylene-dependent local and systemic immune responses (Liu et al., 2013; Tintor et al., 2013; Ross et al., 2014). The perception of OGs is mediated by wall-associated kinases (WAKs), a small family of receptors encoded by five tightly clustered Arabidopsis genes, which have an extracellular domain containing several EGF-like repeats (Verica et al., 2003). However, WAK1 and WAK2 bind OGs and pectin in vitro through an N-terminal extracellular domain that does not contain the EGF-like repeats 10

31 Introduction (Decreux et al., 2006; Kohorn et al., 2009). Interestingly, a domain-swap approach producing chimeric receptors derived from EFR and WAK1 demonstrated that WAK1 is capable to sense OGs in vivo and to trigger defense responses (Brutus et al., 2010). In addition, the constitutive overexpression of WAK1 in Arabidopsis confers enhanced resistance to Botrytis cinerea (Brutus et al., 2010). Recently, the Arabidopsis DORN1/LecRK-I.9 protein was identified as a receptor for extracellular ATP (eatp; Choi et al., 2014). This Lec-RLK receptor can also bind other biologically active nucleotides, such as ADP or GTP, although the affinity for ATP is higher. DORN1 has a very different molecular structure from the known animal counterparts that have been described to bind ATP (Choi et al., 2014), so the identification of DORN1 thus defines a novel class of eukaryotic ATP receptors PRR co-receptors and cytoplasmic protein interactors Function of SERK proteins in PTI Several plant PRRs share the common regulatory LRR-RLK BAK1 as signalling partner (Chinchilla et al., 2009; Postel et al., 2010; Liebrand et al., 2014). BAK1/SERK3 belongs to the somatic embryogenesis receptor kinase (SERK) family, which contains five closely related members in Arabidopsis (Hecht et al., 2001; Albrecht et al., 2008). BAK1 was initially identified as an interactor and positive regulator of the brassinosteroid receptor BRI1 (Brassinosteroid Insensitive1) (Li et al., 2002; Nam and Li, 2002). In addition to brassinosteroid responses, BAK1 is involved in cell death control as bak1 knock-out mutants have a spreading lesion phenotype upon pathogen infection as well as premature senescence (Kemmerling et al., 2007; Jeong et al., 2010). Notably, BAK1 is an essential regulator of PTI, as it interacts with multiple PAMP and DAMP receptors, such as FLS2, EFR, PEPR1, PEPR2, Eix1, Eix2, Ve1 and RLP30, but not with CERK1 (Figure 1.2; Chinchilla et al., 2007; Heese et al., 2007; Fradin et al., 2009; Bar et al., 2010; Krol et al., 2010; Roux et al., 2011; Schwessinger et al., 2011; Sun et al., 2013; Zhang et al., 2013). In rice XA21 forms a constitutive complex with OsSERK2, the BAK1 orthologue in rice (Chen et al., 2014). Arabidopsis SERK proteins are involved in diverse signalling pathways and are often functionally redundant (Albrecht et al., 2008). Accordingly, BKK1/SERK4 was found to play a role in brassinosteroid signalling, cell death control and plant immunity, where it was shown to interact with FLS2, EFR and PEPRs (He et al., 2007; Albrecht et al., 2008; Jeong et al., 2010; 11

32 Introduction Roux et al., 2011). As signalling mediated by the majority of the RLKs described so far relies on BAK1 and other SERKs, it has been suggested that, in addition to their role as kinase activity enhancers, SERK proteins could generate specific phosphorylation events in cis and trans within PRR complexes regulating interaction with specific substrates and activation of specific signalling branches leading to different downstream responses (Macho and Zipfel, 2014) BIR1 and SOBIR1 function in PTI In a screening to identify new regulators of plant innate immunity, Gao and collaborators (2009) found BIR1 (BAK1-Interacting Receptor-like kinase 1), an LRR-RLK that interacts with BAK1 and other SERK proteins in vivo. Mutants in BIR1 exhibited extensive cell death and constitutive defense responses. Consequently, it was proposed that BIR1 functions as a negative regulator of defense associated to LRR-RLKs. A suppressor screening of bir1-1 phenotype yielded mutations in the LRR-RLK SOBIR1 (suppressor of BIR1-1) (Gao et al., 2009), also known as EVERSHED (EVR) due to its role as an inhibitor of floral organ abscission (Leslie et al., 2010). SOBIR1 was then suggested to act as a positive regulator of defense, which is normally inhibited by BIR1 in wild-type Arabidopsis. It was recently shown that SOBIR1 constitutively interacts in planta with a broad range of LRR-RLPs that act in development or in immunity. For example, in tomato, SOBIR1 associates with Ve1 and Ve2 (Liebrand et al., 2013; Fradin et al., 2014), Eix2, Cf proteins, and homologues of Arabidopsis CLAVATA2 (CLV2) and TOO MANY MOUTHS (TMM), two LRR-RLPs that play a role in meristem maintenance and stomatal patterning, respectively (Liebrand et al., 2013). Furthermore, the functionality of Arabidopsis ReMAX/RLP1, RLP30, and RBPG1/RLP42 was found to depend on SOBIR1 (Figure 1.2; Jehle et al., 2013b; Zhang et al., 2013; Zhang et al., 2014). Remarkably, some of these RLPs also require BAK1 and other members of the SERK family for full functionality, supporting the idea that RLPs associated with SOBIR1 or SOBIR1-like protein kinases might function as bimolecular RLKs (Gust and Felix, 2014). In resting conditions, BAK1 and other SERK proteins associate with the negative regulator BIR1, preventing the initiation of a defense response. BIR1 also supresses SOBIR1 function, and thereby negatively regulates LRR-RLP-mediated responses (Gao et al., 2009; Liebrand et al., 2014). Similarly, the LRR-RLK BIR2 has emerged as a new negative regulator of PTI, since it constitutively interacts with BAK1 preventing its association with FLS2 in the absence of flg22 (Halter et al., 2014). 12

33 Introduction Receptor-like cytoplasmic kinases PRRs and associated transmembrane proteins require cytoplasmic partners to link PRR activation with downstream intracellular signalling. In this context, receptor-like cytoplasmic kinases (RLCKs) have emerged as direct substrates of PRR complexes and essential regulators of PTI signalling. Some RLCKs are potentially anchored to the plasma membrane, enabling functional and physical association with RLKs to relay intracellular signalling via transphosphorylation events (Lin et al., 2013b). The Arabidopsis BIK1, which is a membrane localized RLCK positively regulating resistance to B. cinerea and other necrotrophic pathogens (Veronese et al., 2006; Williams et al., 2011), associates with FLS2 and BAK1 in planta. After flg22 perception, BAK1 phosphorylates BIK1, which in turn phosphorylates both BAK1 and FLS2, and thus promotes its dissociation from the complex to activate downstream signalling components (Figure 1.3; Lu et al., 2010; Zhang et al., 2010). BIK1 also interacts with EFR and CERK1, and is required for PAMP-induced resistance to Pseudomonas syringae (Zhang et al., 2010). In addition, BIK1 interacts with PEPR1 and likely with PEPR2, and is required for ethylene-induced defenses (Liu et al., 2013). Interestingly, the NADPH oxidase AtRBOHD was recently identified as a direct target of flg22-activated BIK1, since it directly phosphorylates AtRBOHD residues that are essential for its activation, demonstrating the important role of BIK1 in ROS burst and thus in Arabidopsis innate immunity (Figure 1.3; Kadota et al., 2014). BIK1 is part of a large family of RLCKs that includes PBS1 and PBS1-like (PBL) kinases, which have been demonstrated to strongly interact with FLS2 in absence of flg22, and to release from the FLS2 complex upon flg22 perception (Zhang et al., 2010). Furthermore, PBL1, PBL2 and PBL5 can also regulate flg22-induced ROS burst, contributing to PTI defenses (Zhang et al., 2010; Liu et al., 2013). Similarly, PBL27 was found to be an immediate downstream component of CERK1 and contributes to the regulation of chitin-induced immunity in Arabidopsis (Shinya et al., 2014). Another RLCK, BSK1, was initially identified as a substrate of the brassinosteroid receptor BRI1, acting as a positive regulator of brassinosteroid responses (Tang et al., 2008). Recently, it has been found that BSK1 physically associates with FLS2 and is required for a subset of flg22-induced responses, including the ROS burst, but not for MAPK activation (Shi et al., 2013). Similarly to BIK1, BSK1 is released from FLS2 complex upon flg22 perception (Figure 1.3; Shi et al., 2013). Interestingly, while BSK1 seems to positively regulate brassinosteroid and immune-dependent responses, BIK1 acts as a negative regulator in brassinosteroid signalling, but a positive regulator in immune responses (Lin et al., 2013a). 13

34 Introduction PTI signalling attenuation through PRRs stability regulation A tight control of PRR signalling is crucial for preventing excessive or prolonged activation of immune responses that would be detrimental to the host. Given the key role played by protein kinases in early PTI signalling, it is likely that protein phosphatases negatively regulate early immune components. Only a few examples of protein phosphatases acting at the level of plant PRR complexes are known. KAPP, a protein phosphatase 2C (PP2C), was identified as a negative regulator of the flagellin signal transduction pathway, as it interacts with FLS2 and maintains the FLS2 kinase domain in a dephosphorylated and inactive state (Gómez-Gómez et al., 2001). KAPP was also reported to interact with multiple plant RLKs, including BRI1 (Ding et al., 2007), but its role is still unclear. In rice, the PP2C XB15 interacts with and dephosphorylates the PRR XA21 leading to the negative regulation of XA21-dependent immunity (Park et al., 2008). Recently, a PP2A phosphatase was found to constitutively associate with BAK1 in planta (Segonzac et al., 2014). Interestingly, PP2A does not dissociate from BAK1 upon elicitation, although BAK1-associated PP2A activity rapidly decreases upon ligand binding to the receptor complex (Segonzac et al., 2014). Attenuation of RLK signalling can be also achieved by degradation of PRRs. Two closely related U-box E3 ubiquitin ligases, PUB12 and PUB13, form a constitutive complex with BAK1 and are recruited to FLS2 complex upon flg22 perception (Lu et al., 2011). BAK1 phosphorylates PUB12 and PUB13 directly, and is required for FLS2 and PUB12/13 association. Once activated, PUB12 and PUB13 poly-ubiquitinate FLS2, leading to its degradation and dampening of flg22-induced responses (Lu et al., 2011). In addition of targeting substrates for degradation, ubiquitination can modulate the activity or localization of a target protein. For example, ubiquitination of rice XA21 by the E3 ubiquitin ligase XB3 positively regulates XA21 signalling, and silencing of Xb3 increases rice susceptibility to Xoo infection (Wang et al., 2006). An additional mechanism of regulation of PRRs activity is their internalization upon PAMP perception. Thus, FLS2 translocates into intracellular vesicles after flg22 perception, and then it is degraded (Robatzek et al., 2006). Flg22-dependent degradation of FLS2 may serve as a means to desensitize cells to the same stimulus, likely to prevent continuous signalling from the activated receptor (Smith et al., 2014). According to this, new synthesis of FLS2 restores receptor levels at the plasma membrane and recovers sensitivity of plant cells to flg22 (Smith et al., 2014). Receptor-mediated endocytosis has also been described for the tomato receptor Eix2, and rice XA21 is also proposed to undergo endocytic trafficking (Chen et al., 2010; Sharfman et al., 2011). 14

35 Introduction 1.5. PTI molecular responses PAMP perception by PRRs initiates PTI, which involves the activation of the kinase intracellular domain of PRRs leading to subsequent phosphorylation of substrates that contribute to intracellular signal transduction. Early responses characteristically associated with PAMP perception include changes of ion fluxes (e.g. K + ), increased calcium (Ca 2+ ) concentration in the cytoplasm, production of reactive oxygen species (ROS) burst and activation of calciumdependent protein kinases (CDPKs) and mitogen-activated protein kinase (MAPK) cascades, which are events detectable within minutes. These processes are followed, within several hours to days, by extensive transcriptional reprogramming, cell wall remodelling and metabolic changes including biosynthesis of antimicrobial compounds, such as pathogenesis-related (PR) proteins, phytoalexins and tryptophan (Trp)-derived metabolites (Boller and Felix, 2009; Monaghan and Zipfel, 2012) Ca 2+ -mediated signalling in PTI One of the earliest known physiological responses observed after PAMP/DAMP perception is an increase of Ca 2+ concentration ([Ca 2+ ]) in the cytosol (Ca 2+ burst), which occurs at 30 seconds to 2 minutes (Jeworutzki et al., 2010; Ranf et al., 2011). These Ca 2+ ions enter the cytosol from extracellular and vacuolar pools through not well-characterized channels and/or facilitators, and this process is positively regulated by BIK1 and possibly by additional proteins of BIK1 family (Knight et al., 1996; Jeworutzki et al., 2010; Li et al., 2014). The Ca 2+ influx induces the opening of other ion channels, leading to influx of H + and efflux of K +, Cl -, and NO - 3, which results in an extracellular alkalinization and a depolarization of the plasma membrane (Jeworutzki et al., 2010). In eukaryotes, Ca 2+ is an ubiquitous second messenger involved in multiple physiological processes, including responses to abiotic stresses, hormones and pathogenic infections (Kudla et al., 2010). Different variations in the cytosolic concentration of Ca 2+, in terms of duration, amplitude, frequency, and spatial distribution, are known as Ca 2+ signatures (Webb et al., 1996), and have been associated with signalling responses to different PAMPs (Gust et al., 2007; Aslam et al., 2009; Ranf et al., 2011). These Ca 2+ signatures may be decoded by distinct calcium sensors into specific protein-protein interactions, defined phosphorylation cascades, or transcriptional responses (Kudla et al., 2010). Calcium sensors perceive changes in the cytosolic concentration of Ca 2+, and Ca 2+ directly binds to the EF-hand motif of these proteins to modulate their activity. Plants possess 15

36 Introduction three main families of calcium sensors: calmodulin (CaM), calcineurin B-like (CBL) and calciumdependent protein kinases (CDPKs). The Arabidopsis genome encodes 34 CDPKs and 8 additional CDPK-related kinases (Hrabak et al., 2003). CDPKs harbor an N-terminal variable domain, a protein kinase domain, and a C-terminal CDPK-activation domain, that contains an autoinhibitory junction region and a calmodulin-like Ca 2+ binding domain with up to four EFhand motifs with different calcium binding affinities (Romeis and Herde, 2014). At basal cytoplasmic Ca 2+ levels, CDPKs adopt a resting state, in which the autoinhibitory region blocks the kinase active site. Calcium binding induces a conformational change that release the autoinhibitory segment, rendering the CDPK active and thus promoting autophosphorylation reactions as well as phosphorylation of its target substrates (Boudsocq et al., 2012; Romeis and Herde, 2014). Diverse cellular localizations of CDPKs have been observed, including the cytosol, nucleus, plasma membrane and endoplasmic reticulum, indicating that CDPKs have access to a range of potential substrates throughout the cell (Boudsocq and Sheen, 2013), and also highlight their implication in several cellular processes. Remarkably, CDPKs play a key role in the defense-induced ROS burst by direct phosphorylation of the NADPH-oxidase AtRBOHD (Dubiella et al., 2013). Furthermore, CDPKs mediate transient and sustained transcriptional reprogramming in innate immune responses and regulate the activation of phytohormone signalling pathways and cell death (Boudsocq et al., 2010; Coca and San Segundo, 2010; Boudsocq and Sheen, 2013) Production of Reactive Oxygen Species (ROS) The reactive oxygen species (ROS) signalling network is an evolutionary conserved signal transduction network found in all aerobic organisms (Mittler et al., 2011). During normal metabolic processes, plant cells produce a variety of ROS as unavoidable byproducts, including superoxide anion and hydrogen peroxide. However, plant cells have the capacity to detoxify or scavenge them using a plethora of detoxifying and scavenging mechanisms that maintain nontoxic levels of ROS. The balance between production and scavenging allows ROS to be used as signals that control a broad range of biological processes such as growth, development, and responses to abiotic and biotic stimuli (Mittler et al., 2011). Plant ROS have different cellular origins, such as diamine oxidases, cell wall peroxidases and the plasma membrane localized NADPH oxidases, called RBOH (respiratory burst oxidase homologues; Torres, 2010). RBOHs constitute a multigenic family comprised of 10 members (Torres and Dangl, 2005). Genetic studies revealed that, whereas some RBOH proteins perform specific functions, AtRbohD and 16

37 Introduction AtRbohF can mediate multiple functions, such as defense responses, cell death regulation or stomatal closure, frequently with additive effects (Suzuki et al., 2011). The apoplastic production of ROS is one of the fastest defense responses of plants after pathogen recognition, and is a transient reaction also known as oxidative burst or ROS burst (Boller and Felix, 2009; Torres, 2010). In Arabidopsis, the plasma membrane localized RBOHD is responsible for PAMP/DAMP-induced ROS burst (Ranf et al., 2011). RBOHD can associate with FLS2 and EFR upon PAMP perception, and then full activation of RBOHD takes place by phosphorylation on different residues by both the CDPK CPK5 and BIK1 (Dubiella et al., 2013; Kadota et al., 2014; Li et al., 2014). RBOHD activity can also be regulated by direct binding of Ca 2+ to its N-terminal EF-hand motifs (Ogasawara et al., 2008; Kimura et al., 2012). Full oxidative burst, and probably RBOHD activity, in response to PAMPs and some pathogens seems to depend on additional molecular components, as in mutants impaired in the β (agb1) and γ (agg1 agg2) subunits of the Arabidopsis heterotrimeric G protein ROS production is significantly reduced (Liu et al., 2013; Lorek et al., 2013; Torres et al., 2013). These data suggest that the Gβγ1+γ2 heterodimer might constitute the active complex that regulates ROS production (Torres et al., 2013). ROS can also induce cytosolic Ca 2+ elevations (Rentel and Knight, 2004), and PAMP/DAMP-induced ROS burst has a positive feedback effect on cytosolic Ca 2+ levels by inducing a second cytosolic Ca 2+ elevation or prolonged plateau, that might play a role in cell to cell systemic signalling (Ranf et al., 2011). ROS production in response to pathogens is often associated with the hypersensitive response (HR), and seems to be directly modulated by nitric oxide (NO) through nitrosylation of a Cys residue that abolish RBOHD ability to synthesize ROS (Yun et al., 2011). Additionally, interaction between NADPH oxidases and plant hormone signalling modulates ROS function in defense. Finally, RBOHD was shown to be required for the initiation and self-propagation of a rapid cell to cell systemic signal that is dependent upon H 2 O 2 accumulation in the apoplast to generate a ROS wave (Mittler et al., 2011). 17

38 Introduction BIR2 BAK1 FLS2 BIR2 BAK1 FLS2 flg22 RBOHD ROS Ca 2+ Ion channel channels BIK1 PUBs PP2A BSK1 BIK1 KAPP P KAPP BSK1 PUBs? PP2A P P P P BIK1 P? Ca 2+? MAP3K P MKKs MPKs P P P CPK28 CPK4/11 CPK5/6 P Nucleus TF P MAPK specific FRK1 P TF P MAPK dominant CYP81F2 P TF MAPK-CDPK P TF Synergistic effect NHL10 TF P CDPK specific PHI1 Defense gene expression and PTI Figure 1.3. A model of FLS2-mediated signalling pathway in Arabidopsis. In the absence of ligand, the signalling potential of FLS2 is attenuated by its association with the phosphatase KAPP. In this state, FLS2 associates with at least BIK1 and BSK1. BAK1 also associates with BIK1 and the phosphatase PP2A and is sequestered away from FLS2 by BIR2. Upon flg22 perception, FLS2 heterodimerizes with its coreceptor BAK1. Flg22 binding allows the release of BAK1 from BIR2 and the dissociation or inactivation of KAPP and PP2A phosphatases. The FLS2-BAK1 oligomer undergoes a series of transphosphorylation events and phosphorylates BIK1, which dissociates from the complex to phosphorylate downstream targets for signal transduction. One such target is the NADPH oxidase RBOHD, which upon phosphorylation triggers a ROS burst. The perception of flg22 also triggers the activation of Ca 2+ channels, resulting in an increase of cytoplasmic Ca 2+ concentration. Ca 2+ directly binds to CDPKs, and both Ca 2+ and CDPKs together with BIK1 control the activities of RBOHD. The ROS produced by RBOHD can induce secondary Ca 2+ fluxes, further amplifying the signalling cascade. Downstream of receptor activation, MAPKs and CDPKs are activated by an unknown mechanism (broken arrows) and regulate transcription factors either independently or synergistically, and ultimately contribute to induction of flg22-responsive genes. Adapted from Boudsocq and Sheen, 2013; Belkhadir et al., 2014; and Lozano- Durán and Zipfel,

39 Introduction Mitogen-activated protein kinase (MAPK) cascades in PTI MAPK cascades are highly conserved signalling modules found in all eukaryotic cells, including plants, fungi and animals. Plant MAPK cascades play pivotal roles in regulating cell division, plant development and signalling responses to a variety of stress stimuli, including pathogen infection, wounding, salinity, temperature, drought, osmolarity and ozone (Figure 1.4). In plant immunity, these cascades transduce environmental stimuli perceived by PRRs into a wide range of cellular responses (Colcombet and Hirt, 2008). A MAPK cascade is minimally composed of three modules: MAP kinase kinase kinases (MAP3Ks or MEKKs), MAP kinase kinases (MAPKKs or MKKs) and MAP kinases (MAPKs or MPKs). The Arabidopsis genome encodes approximately 60 MAP3Ks, 10 MAPKKs and 20 MAPKs (Ichimura et al., 2002; Colcombet and Hirt, 2008). A similar repertoire of genes has been found in other sequenced plant genomes, including rice (Oryza sativa), poplar (Populus sp.) or grapevine (Vitis vinifera) (Hamel et al., 2006; Hyun et al., 2010; Wang et al., 2014). This suggests that there would be some level of redundancy, and that the spatial and temporal activities of different components may be strictly regulated (Rasmussen et al., 2012). The MAPK signalling in immunity is initiated by the stimulus-triggered activation of MAP3Ks, which may be directly or indirectly regulated by a PRR. MAP3Ks are serine/threonine kinases that phosphorylate two serine and/or threonine residues (S/T-X 5 -S/T) located within the activation loop of the MAPKK. MAPKKs are dual-specificity kinases that, in turn, trigger MAPK activation through phosphorylation of conserved threonine and tyrosine residues in their T-X-Y activation motifs, where X is typically a glutamic or aspartic acid. MAPKs are serine/threonine kinases that subsequently phosphorylate a wide range of substrates, including other kinases and transcription factors (TFs), to alter patterns of gene expression or modulate the activity of other proteins (Colcombet and Hirt, 2008; Rasmussen et al., 2012; Meng and Zhang, 2013). MAPK phosphatases (MKPs) form an additional group of proteins that are involved in the time-dependent control or in the shut-down of the pathway after signalling (Colcombet and Hirt, 2008). The majority of our current knowledge of MAPK-mediated signalling comes from the intensive study and characterization of three MAPKs, namely MPK3, MPK4 and MPK6, that are activated by PAMPs such as flg22 and elf18. MPK11, a close homologue of MPK4, has also been shown to be activated by PAMP treatment (Bethke et al., 2012; Eschen-Lippold et al., 2012). Arabidopsis MPK3 and MPK6, but not MPK4, are also activated by chitin, PGN or OGs (Zipfel et al., 2006; Gust et al., 2007; Miya et al., 2007; Denoux et al., 2008). In Arabidopsis, 19

40 Introduction flg22 recognition activates at least two MAPK cascades: i) one consisting of MKK4 and MKK5, which redundantly activate MPK3 and MPK6 (Asai et al., 2002; Ren et al., 2002); ii) the second is composed of MEKK1, MKK1/MKK2, and MPK4, and has been suggested to negatively regulate immunity, since mutants of these kinases display constitutive activation of defensive responses and dwarf phenotypes associated to the accumulation of salicylic acid (SA) and other defense-related compounds (Figure 1.4; Ichimura et al., 2006; Suarez-Rodriguez et al., 2007; Qiu et al., 2008b). MAPK cascades are also fundamental components of effector-triggered immunity (ETI). In Arabidopsis, it has been shown that the R protein SUMM2 (suppressor of mkk1 mkk2, 2) becomes active when the MEKK1-MKK1/MKK2-MPK4 cascade is disrupted by pathogen effectors. As a result, these MAPK cascade is proposed to be guarded by SUMM2 (Zhang et al., 2012). Moreover, MPK4 negatively regulates SUMM1/MEKK2, a MAP3K sharing high homology with MEKK1, and MEKK2 functions as a positive regulator of SUMM2-mediated plant immunity (Kong et al., 2012). The molecular connection between the PRR immune complexes and the downstream MAP3Ks remains to be elucidated (Bigeard et al., 2015). Some data suggest that PAMP-induced MPK3/4/6 activation is in part dependent on Ca 2+ burst but independent of CDPKs and ROS burst (Boudsocq et al., 2010; Ranf et al., 2011; Xu et al., 2014). In addition, flg22-induced activation of MPK3/4/6 in a bik1 pbl1 mutant is similar to that of wild-type plants, suggesting that BIK1 and PBL1 are not required for PAMP-induced MAPK activation (Feng et al., 2012). Furthermore, the analysis of a quadruple mutant for essential genes of SA, JA and ET pathways revealed that MAPK activation is independent of these three hormones (Tsuda et al., 2009). As mentioned before, MAPK cascades are also essential in abiotic stress and developmental signalling (Figure 1.4). In Arabidopsis, the most complete MAPK cascade functioning in abiotic stress consists of the MEKK1-MKK2-MPK4/MPK6 module, which has been shown to function in salt and cold stress (Teige et al., 2004). Additionally, MKK1 is activated by salt stress, drought and wounding, and can phosphorylate MPK4, suggesting a role in abiotic stress signalling (Teige et al., 2004; Xing et al., 2008). The MAPK module MKK4/MKK5-MPK3/MPK6 described for flg22 signalling also functions downstream of the MAP3K YODA (MAPKKK4) and is involved in different developmental pathways, including stomatal patterning and inflorescence architecture (Wang et al., 2007; Meng et al., 2012). However, there is no evidence of any YODA function in plant immunity. 20

41 Introduction Ligand/Stimuli Receptors/ Sensors MAPKKK MAPKK MAPK Response Pathogen/PAMP (e.g. flg22) FLS2 BAK1 MEKK1 MKK1/2 MPK4? MKK4/5 MPK3/6 Immunity Pathogen? MAPKKKα MEK2 SIPK HR, cell death EPFs TMM ERfs YDA MKK4/5 MPK3/6 Stomatal develop Localized cell division IDA HAE HSL2?? MPK3/6 Abscission MEKK1 MKK2 MPK6 Cold?? MKK1 MPK4 Freezing tolerance MEKK1 MKK2 MPK4 Salt? MKKK20? MPK6 Salt tolerance? MKK9 MPK3 MEKK1 MKK2 Drought? MPK4 Drought tolerance? MKK1 Wounding? MEKK1 MKK1 MPK4? MKK3 MPK8? MKK9 MPK6 Wounding response Figure 1.4. Schematic depiction of some of the MAPK signalling cascades acting in biotic and abiotic stresses and in plant development. Only stablished signalling pathways are depicted. Adapted from Colcombet and Hirt, 2008; Smékalová et al., 2014; Xu and Zhang, Transcriptional regulation of PTI Transcriptional reprogramming is a major feature of plant immunity and is governed by transcription factors (TFs) and co-regulatory proteins associated within discrete transcriptional complexes (Moore et al., 2011). It involves major changes in gene expression to favour defense over other cellular processes, such as growth and development. In Arabidopsis, about a thousand genes are upregulated minutes after PAMP treatment, including genes encoding PRRs and other genes involved in PAMP perception and signalling (Zipfel et al., 2004, 2006; Gust et al., 2007; Wan et al., 2008). There is an extensive overlap among the gene expression profiles elicited by most PAMPs (Boller and Felix, 2009), suggesting that the 21

42 Introduction signalling pathways triggered by different PAMPs converge. Certain families of TFs appear to be particularly dedicated to regulating plant immune responses, including the AP2/ERF, bhlh, bzip, MYB and WRKY families (Tsuda and Somssich, 2015). Multiple TFs are regulated through phosphorylation by MAPKs, highlighting the involvement of MAPKs in the transcriptional reprogramming occurring during defense (Bigeard et al., 2015). MPK3 and MPK6 phosphorylate WRKY33, which is essential for ET and camalexin biosynthesis upon pathogen infection (Qiu et al., 2008a; Han et al., 2010; Mao et al., 2011). WRKY33 can bind its own promoter, suggesting that a positive feedback regulatory loop occurs in the regulation of WRKY33 expression (Mao et al., 2011). MPK3 and MPK6 also indirectly modulate WRKY33 activity through phosphorylation of MPK3/6-targeted VQ-motif-containing proteins (MVQs; Pecher et al., 2014). In addition, WRKY33 forms a complex with MPK4 and MKS1 (MPK4 substrate 1) and phosphorylation of MKS1 by MPK4 upon flg22 or bacterial perception releases WRKY33 from the complex, further activating camalexin biosynthesis (Andreasson et al., 2005; Qiu et al., 2008a). Phosphorylation of ERF6 by MPK3 and MPK6 increases its stability, leading to enhanced expression of several defensin genes, including PDF1.1 and PDF1.2a, and resistance to B. cinerea (Meng et al., 2013). ERF104 forms a complex with and is phosphorylated by MPK6 upon flg22 treatment, inducing its release from the complex and activation of ET responses (Bethke et al., 2009). MPK3 phosphorylates VIP1 (VirE2 interacting protein1), resulting in repositioning of VIP1 to the nucleus and regulation of its target genes, including MYB44, that directly regulates expression of WRKY70 and therefore, SA and JA-mediated transcription (Li et al., 2004; Pitzschke et al., 2009; Shim et al., 2013). Ca 2+ signalling also influences transcriptional reprogramming upon pathogen perception through Ca 2+ sensor proteins. CaM interacts with a diverse array of TFs (Poovaiah et al., 2013). For instance, the interaction of CaM with CAMTA3 (CaM-binding transcription activator3), which has been involved in P. syringae and B. cinerea resistance (Galon et al., 2008), leads to the suppression of genes involved in SA biosynthesis and signalling, indicating that Ca 2+ /CaM signalling modules are critical modulators of SA biosynthesis and SA-mediated transcriptional reprogramming (Tsuda and Somssich, 2015). In addition, the CDPKs also play a role in rapid transcriptional reprogramming. CPK4, 5, 6 and 11 activate subsets of defense genes that differ as well as overlap with MAPK signalling dependent genes (Figure 1.3; Boudsocq et al., 2010). For instance, these CDPKs can phosphorylate WRKY8, 28 and 48, and it has been shown that WRKY48, in turn, regulates the expression of WRKY46 and other defenserelated genes (Gao et al., 2013). 22

43 Introduction 1.6. Effector-triggered immunity (ETI) In most cases, PTI is sufficient to impede pathogen colonization and suppress disease development. Successful, virulent pathogens, however, evade PTI-based surveillance by delivering effector molecules in the apoplast or directly into host cells, which collectively promote pathogen virulence (Figure 1.1; Dodds and Rathjen, 2010; Spoel and Dong, 2012). During plant-pathogen coevolution, plants have developed intracellular immune receptors known as resistance (R) proteins, which can directly or indirectly recognize the presence of certain effectors and activate the so-called effector-triggered immunity (ETI; Figure 1.1). Effectors that are recognized by corresponding R proteins are called avirulence (Avr) proteins, and pathogens carrying Avr proteins are known as avirulent pathogens. ETI is an accelerated and amplified PTI response, resulting in disease resistance and, usually, a hypersensitive response (HR) (Jones and Dangl, 2006; Wu et al., 2014). This response occurs locally to isolate and prevent pathogen growth, and is typically associated with the programmed cell death of the infected cells and the production of antimicrobial molecules. An avirulent pathogen can also induce the production of the plant hormone salicylic acid (SA) and other mobile immune signals, which are transported to distal tissues to protect the rest of the plant from future infections (Durrant and Dong, 2004). Numerous R proteins have been identified, and they typically consist of a variable N- terminus followed by a nucleotide binding site (NBS) domain and an LRR domain at the C- terminus. These proteins are classified based on their variable N-terminal domain into coiledcoil (CC)-NBS-LRR or Toll/Interleukin 1 receptor-like (TIR)-NBS-LRR protein families. Plants use R proteins predominantly to monitor the perturbation of self-molecules by pathogen effectors. This strategy enables plants to specifically recognize groups of pathogens that use similar infection strategies. Despite the numerous different effectors that pathogens inject into plant cells to promote virulence, they might target relatively few conserved hubs of the plant signalling networks (Spoel and Dong, 2012). One of these hubs is the Arabidopsis protein RPM1-INTERACTING PROTEIN 4 (RIN4), that is a plasma membrane anchored protein with an important role in plant defense, since it is involved in the recognition of several distinct pathogen effectors from P. syringae by the R proteins RPM1 and RPS2 (Mackey et al., 2002; 2003). Another example of hub protein is EDS1 (ENHANCED DISEASE SUSCEPTIBILITY1), which is considered as a central regulator of basal resistance and of ETI mediated by several TIR-NBS- LRR proteins (Wiermer et al., 2005; Heidrich et al., 2012). EDS1 was shown to be a target for AvrRps4 and HopA1 effectors, and forms complexes with the R proteins RPS4, RPS6 and SNC1 (Bhattacharjee et al., 2011; Heidrich et al., 2011). 23

44 Introduction Plant pathogenic bacteria, fungi and oomycetes possess an extensive repertoire of effector molecules that are able to disrupt and suppress PTI at different levels. Well-studied examples of effectors are AvrPto and AvrPtoB from P. syringae. In Arabidopsis, AvrPto interacts with the kinase domain of different PRRs, including FLS2 and EFR, inhibiting PAMP signalling (Xiang et al., 2008). AvrPtoB is a modular effector that exhibits an N-terminal region able to interact with FLS2, BAK1 and CERK1, while its C-terminal domain has structural homology to U-box E3 ubiquitin ligase proteins and targets FLS2, EFR and CERK1 for proteasomal degradation (Göhre et al., 2008; Gimenez-Ibanez et al., 2009). Other known effectors blocking early signalling components of Arabidopsis PTI are P. syringae AvrB, AvrRpm1, AvrRpt2, HopF2, the four of them targeting RIN4; AvrPphB, that targets PBS1 and PBL kinases, including BIK1 and PBL1; and Xanthomonas XopAC/AvrAC, that interacts with several RLCKs, including BIK1, PBL2 and RIPK (RPM1-induced protein kinase), an RLCK that phosphorylates RIN4 in response to bacterial effectors (Deslandes and Rivas, 2012; Guy et al., 2013). Effectors can also target different components of MAPK cascades, such as MKK5, MPK3, MPK4 or MPK6, as well as components of vesicle trafficking, TFs, RNA-binding proteins and plant promoters (Deslandes and Rivas, 2012) Additional mechanisms of defense contributing to plant resistance to pathogens The role of secondary metabolites in basal and induced resistance Plants synthesize a large variety of metabolites and peptides with antimicrobial activity against pathogens, although they can also be produced as part of normal plant growth and development (Bednarek and Osbourn, 2009). Plant antimicrobial peptides are short (10 to 90 amino acids in length), generally positively charged and cysteine-rich molecules, which are widespread throughout the plant kingdom and include several families, such as defensins, thionins, lipid-transfer proteins and snakins among others (Broekaert et al., 1995; García- Olmedo et al., 1998; Sels et al., 2008; Nawrot et al., 2014). Due to their amphipathic nature, these peptides are able to permeabilize the membranes of a broad range of pathogens by both specific and non-specific electrostatic and hydrophobic interactions with cell surface groups (Thevissen et al., 2003; Aerts et al., 2008; Nawrot et al., 2014). Plant secondary metabolites constitute an unusually large group of structurally diversified compounds that can be produced in planta constitutively or in response to different 24

45 Introduction environmental stimuli (Piasecka et al., 2015). These secondary metabolites are classified based on their mode of biosynthesis and accumulation in two main groups: i) phytoanticipins, that are preformed or become released from constitutively stored precursors following attempts of microbial invasion; and ii) phytoalexins, that are synthesized de novo and accumulate after pathogen challenge (VanEtten et al., 1994). In Arabidopsis, the most thoroughly studied secondary metabolites with defensive functions are tryptophan (Trp)-derived metabolites, such as indol glucosinolates (IG) and camalexin, which are derived from indole-3-acetaldoxime (IAOx) synthesized by the redundant activity of CYP79B2 and CYP79B3 enzymes (Figure 1.5; Zhao et al., 2002; Bednarek et al., 2009). Camalexin, which is produced upon pathogen challenge, has been involved in defense responses against necrotrophic fungal pathogens, including Alternaria brassicicola and some B. cinerea isolates (Thomma et al., 1999; Ferrari et al., 2003; Kliebenstein et al., 2005). Arabidopsis plants constitutively accumulate four main types of Trp-derived IGs: indol-3- ylmethyl glucosinolate (I3G), 1-methoxy-I3G, 4-hydroxy-I3G and 4-methoxy-I3G (Reichelt et al., 2002). Pathogen inoculation or PAMP treatment of Arabidopsis and other Brassicaceae plants have been shown to trigger the recruitment of the peroxisome-associated myrosinase PEN2 (Penetration2) to pathogen contact sites, where it hydrolyses IGs and releases antimicrobial compounds (Bednarek et al., 2009; Clay et al., 2009). Furthermore, the CYP81F2 P450 monooxygenase, which mediates conversion of I3G to 4MI3G, is also activated (Bednarek et al., 2009). The CYP81F2/PEN2 metabolic pathway mediates broad-spectrum immunity against many fungal and oomycete pathogens, as these enzymes are components of the plant immune system that restricts entry of non-adapted and adapted powdery mildews into epidermal cells of Arabidopsis (Lipka et al., 2005; Bednarek et al., 2009). They are also critical for Arabidopsis immunity to adapted and non-adapted strains of Plectosphaerella cucumerina (Bednarek et al., 2009; Sanchez-Vallet et al., 2010; Buxdorf et al., 2013). The function of the CYP81F2/PEN2 pathway in Arabidopsis immunity is dependent on the plasma membrane ATP-binding cassette-type (ABC) transporter PEN3, which is hypothesized to translocate the IG end products to the apoplast, therefore participating in resistance to pathogens such as powdery mildews and P. cucumerina (Figure 1.5; Stein et al., 2006; Bednarek et al., 2009; Sanchez-Vallet et al., 2010). Blockage of other steps of Trp-derived IG biosynthesis also results in enhanced susceptibility to adapted and non-adapted powdery mildews and P. cucumerina isolates (Bednarek et al., 2009; Sanchez-Vallet et al., 2010). 25

46 Introduction Plant cell wall and resistance to pathogens The plant cell wall is a highly sophisticated and rigid, yet dynamically organized network that confers shape and structure to the cells. Plant cell walls can be classified as primary and secondary walls. Primary cell wall is present in all the plant cells that are in developmental expansion. This primary wall is under a constant remodelling, and mainly consist of a network of cellulose cross-linked with hemicelluloses, embedded in a matrix of pectic polysaccharides (Scheller and Ulvskov, 2010; Pauly et al., 2013; Malinovsky et al., 2014). By contrast, secondary cell wall is generated under the primary wall in those cells that have completed their cellular expansion and need to reinforce their structure for functional reasons (e.g. to form vessels or fiber cells). In this case, pectin is less abundant but walls are reinforced with lignin (Endler and Persson, 2011; Miedes et al., 2014). Cellulose is the main polysaccharide and is present as tightly packed micro-fibrils composed of hydrogen-bonded chains of β-1,4-glucose. These micro-fibrils are synthesized at the plasma membrane by large multimeric complexes containing six cellulose synthase catalytic subunits (CESAs; Figure 1.5; Endler and Persson, 2011). Arabidopsis has two CESA subfamilies, one responsible for the formation of cellulose in primary walls (CESAs 1, 3 and 6) and a second family that synthesize cellulose in secondary walls (CESAs 4, 7 and 8) (Endler and Persson, 2011). Hemicelluloses are a diverse group of polysaccharides containing backbones of neutral sugars, mainly mannose, glucose or xylose, that fortify the cell wall by interacting with cellulose fibrils (Scheller and Ulvskov, 2010; Endler and Persson, 2011). Pectins form the structurally most complex family of polysaccharides in nature (Wolf et al., 2009). The most abundant classes of pectinaceous polysaccharides are homogalacturonan (65% of total pectin) and rhamnogalacturonan (Wolf et al., 2009). Besides having multiple essential functions during plant development, plant cell walls also play important roles in preventing pathogen invasion (Miedes et al., 2014). The cell wall, sometimes covered with a cuticle, is usually the first obstacle encountered by pathogens, and its breakdown is required for the progression of pathogen infection (Figure 1.5; Hématy et al., 2009; Nühse, 2012). In addition, the cell wall is a reservoir of antimicrobial compounds, which are released during cell wall degradation (Figure 1.5; Schulze-Lefert, 2004; Vorwerk et al., 2004). Furthermore, the cell wall is under the control of a dedicated cell wall integrity maintenance mechanism (Hamann, 2012; Engelsdorf and Hamann, 2014). Disturbance of the cell wall integrity by pathogen attack results in the release of DAMPs, which act as signalling molecules and are recognized by PRRs. This recognition is an important trigger for defense 26

47 Introduction mechanisms, activating protein kinase cascades and leading, among others, to cell wall reinforcement (Ferrari et al., 2013; Engelsdorf and Hamann, 2014). Genetic evidence demonstrates that alterations in cell wall structure and composition have a great impact on plant immunity. For instance, mutants defective in CESA subunits required for primary cell wall, such as the CESA3 defective isoxaben resistant (ixr1)/constitutive expression of VSP1 (cev1) mutant, are more resistant to B. cinerea, P. syringae and Erysiphe cichoracearum than wild-type plants (Ellis et al., 2002; Hernández-Blanco et al., 2007). Additionally, mutants impaired in the secondary wall CESAs 4, 7 and 8 (irregular xylem mutants irx5, irx3 and irx1, respectively) display enhanced resistance to several pathogens, including P. cucumerina, B. cinerea, R. solanacearum and P. syringae (Hernández-Blanco et al., 2007). In these mutants, ABA signalling pathway was constitutively active and antimicrobial peptides and Trp-derived metabolites accumulated to a higher extent than in wild-type plants (Hernández-Blanco et al., 2007; Sanchez-Vallet et al., 2010). Mutants with alterations in pectin content and composition, such as pmr5 and pmr6, were found to be highly resistant to powdery mildew infection (Vogel et al., 2002; 2004). Modifications in the content of wall xylose also impacts resistance to pathogens in Arabidopsis. Plants with enhanced levels of xylose (e.g. det3 and irx6 mutants) or with alterations in the structure of xyloglucans (e.g. xyl1-2 mutant) show an enhanced resistance to the necrotrophic fungus P. cucumerina (Delgado-Cerezo et al., 2012), whereas a reduced content of xylose, as it occurs in mutants impaired in ERECTA (ER) LRR-RLK, was found to correlate with a higher susceptibility to this fungus (Llorente et al., 2005). In addition, Arabidopsis mutants in the β and γ subunits of the heterotrimeric G protein (agb1 and agg1 agg2 mutants, respectively) also have a reduced content of xylose and are hypersusceptible to several pathogens, including P. cucumerina, A. brassicicola, P. syringae and F. oxysporum (Llorente et al., 2005; Trusov et al., 2007; Delgado-Cerezo et al., 2012; Liu et al., 2013; Torres et al., 2013). Cell wall reinforcement is initiated after pathogen perturbation of cell wall integrity, but also after PAMP treatment (Boller and Felix, 2009). Special structures called papillae are assembled at pathogen penetration sites to impede infections (Underwood, 2012). Callose, antimicrobial peptides, secondary metabolites and ROS accumulate in these papillae and contribute to plant resistance (Bednarek et al., 2009; Daudi et al., 2012). Callose, as the most abundant constituent of papillae, is a β-1,3-glucan synthesized by callose synthases, such as PMR4, the predominant synthase responsible for pathogen and PAMP-induced callose 27

48 Introduction deposition (Nishimura et al., 2003; Chen and Kim, 2009; Luna et al., 2011). Mutations in this PMR4 synthase enhance SA-dependent resistance responses to the powdery mildew fungi E. cruciferarum and G. orontii (Nishimura et al., 2003; Huibers et al., 2013). By contrast, overexpression of PMR4 in Arabidopsis results in enlarged callose deposits, which prevents the haustoria formation and further penetration by both adapted and non-adapted powdery mildew strains (Ellinger et al., 2013; Naumann et al., 2013) Hormonal regulation of innate immunity Plant hormones are small signalling molecules that are essential for the regulation of plant growth, development, reproduction, and survival to a wide variety of biotic and abiotic stresses. Upon pathogen attack, plants synthesize a complex blend of hormones which varies considerably in quantity, composition and timing among plant species and depends greatly on the lifestyle and infection strategy of the invading organism (De Vos et al., 2005). In Arabidopsis, salicylic acid (SA), jasmonic acid (JA), and ethylene (ET), are considered to be the key players in the regulation of plant immune responses. Although there are exceptions, SA is usually effective in mediating resistance against biotrophic pathogens that feed on living plant tissues, whereas JA and ET pathways are commonly required for immunity against necrotrophic pathogens, that degrade plant tissue during infection, and herbivorous insects (Glazebrook, 2005; Bari and Jones, 2009). However, the hormones abscisic acid (ABA), gibberellins (GAs), auxins, cytokinins (CKs), and brassinosteroids (BRs) function as modulators of the plant immune signalling network as well, and have been shown to differentially affect Arabidopsis resistance against biotrophs and necrotrophs by feeding into the SA-JA-ET cascades (Figure 1.5; Robert-Seilaniantz et al., 2011). Antagonistic and synergistic interactions between all these hormone signal transduction pathways, the so-called hormone crosstalk, enable plants to finely regulate their immune response to the invader encountered and to use their resources in a cost-efficient manner (Pieterse et al., 2012). SA is a phenolic compound that acts as a regulator of plant resistance to biotrophic and hemibiotrophic pathogens, such as Hyaloperonospora arabidopsidis and P. syringae, and it is also involved in the onset of the systemic acquired resistance (SAR) (Glazebrook, 2005). SA is synthesized from chorismate via the isochorismate synthase (ICS1/SID2) upon pathogen infection and after recognition of PAMPs or pathogen effectors (Tsuda et al, 2008; Vlot et al., 2009). In Arabidopsis, EDS1 (Enhanced Disease Susceptibility 1) and PAD4 (Phytoalexin Deficient 4) are required for the onset of SA biosynthesis during PTI, whereas NPR1 28

49 Introduction (Nonexpressor of PR genes 1) is a key regulator of the SA signalling pathway and suppresses programmed cell death during ETI (Yan and Dong, 2014). SA accumulation upon pathogen recognition leads to the translocation to the nucleus of NPR1, which interacts with TGA TFs, regulating the expression of SA-responsive genes, such as PR (Pathogenesis Related) genes, and other genes encoding WRKY TFs and components required for the secretion of PR proteins (Dong, 2004; Wang et al., 2006; Tada et al., 2008). PR genes are a diverse group, but several encode proteins with antimicrobial activity (Van Loon et al, 2006). The NPR1 homologues NPR3 and NPR4 have been recently described as SA receptors and as adaptors for NPR1 degradation (Fu et al., 2012; Wu et al., 2012). In infected tissues, the high concentration of SA facilitates NPR3-NPR1 interaction and NPR1 degradation, allowing cell death and ETI to occur. However, in the surrounding tissues, the lower SA level disrupts NPR4-NPR1 interaction but it is not high enough to mediate NPR3-NPR1 interaction, enabling NPR1 to accumulate, promoting cell survival and SA-mediated resistance (Fu et al., 2012; Yan and Dong, 2014). Jasmonates are lipid-derived compounds originating from polyunsaturated fatty acids, such as α-linolenic acid released from the chloroplast membranes, via the oxylipin biosynthesis pathway (Wasternack and Kombrink, 2009). JA-isoleucine (JA-Ile) is the molecularly active form of the hormone (Fonseca et al., 2009), and is perceived by a receptor complex consisting of the F-box protein COI1 (Coronatine-Insensitive 1) and the JAZ (Jasmonate ZIM-domain) family of transcription repressors (Sheard et al., 2010). JAZ proteins repress JA signalling by binding to the TFs MYC2, MYC3 and MYC4, key activators of JA-responsive genes (Lorenzo et al., 2004; Chini et al., 2009; Fernández-Calvo et al., 2011; Niu et al., 2011). The repressor complex associated with MYC2 at JA-responsive gene promoters include the adaptor protein NINJA (Novel Interactor of JAZ) and the co-repressor TOPLESS (TPL), which prevent untimely activation of the JA pathway (Pauwels et al., 2010; Shyu et al., 2012). Perception of JA-Ile promotes COI1-mediated degradation of JAZ proteins by enhancing the physical interaction between COI1 and JAZ proteins, liberating MYC2 and enabling the initiation of JA-mediated transcription (Chini et al., 2007; Thines et al., 2007; Pauwels et al., 2010; Sheard et al., 2010). SA and JA are considered the two major defense hormones, and plant immunity strongly relies on their mutually antagonistic interplay (Pieterse et al., 2012). For instance, SA signalling suppresses JA-mediated gene expression in Arabidopsis, including the induction of PDF1.2 and ORA59 (Octadecanoid-Reponsive Arabidopsis 59) through TGA TFs (Ndamukong et al., 2007; Van der Does et al., 2013; Zander et al., 2014). NPR1 also regulates several SAdependent TFs required for suppression of JA-mediated gene expression such as TGAs and WRKYs (Robert-Seilaniantz et al., 2011). In contrast, MPK4 acts as a negative regulator of SA 29

50 Introduction signalling and positive regulator of JA signalling, as EDS1 and PAD4 have been identified as MPK4 targets and phosphorylation of MKS1 leads to repression of SA signalling (Petersen et al., 2000; Andreasson et al., 2005; Brodersen et al., 2006). The gaseous hormone ET functions as an important modulator of plant immunity (Broekaert et al., 2006). ET is perceived by a family of receptors composed of ETR1/ETR2 (Ethylene Response 1 and 2), ERS1/ERS2 (Ethylene Response Sensor 1 and 2) and EIN4 (Ethylene Insensitive 4), located in the endoplasmic reticulum (Hua and Meyerowitz, 1998; Ju et al., 2012). In the absence of ET, the receptors activate the protein kinase CTR1 (Constitutive Triple Response 1), which directly phosphorylates EIN2 (Ethylene Insensitive 2), preventing the activation of downstream components of the pathway (Ju et al., 2012). ET binding to the receptors inactivates them and thus relieves CTR1 suppression of EIN2. The C-terminal end of EIN2 is cleaved and translocates to the nucleus to stabilize EIN3 and EIL1 (EIN3-like 1) TFs, which dimerize and activate the expression of ET target genes, such as ERF1 (Ethylene Response Factor 1) and ORA59 (Merchante et al., 2013). EIN3 and EIL1 also bind the SID2 promoter to repress its expression, resulting in reduced accumulation of SA and suppression of SA signalling (Chen et al., 2009). In addition, an ET-JA crosstalk exists, and expression of ERF1 and ORA59 requires both COI1 and EIN2 (Lorenzo et al., 2003; Pré et al., 2008). Moreover, JAZ proteins directly inhibit EIN3 and EIL1 transcriptional activity, repressing ERF1, PDF1.2 and ORA59 (Zhu et al., 2011). However, ET and JA signalling can also act antagonistically. For instance, MYC2 interacts with EIN3 to inhibit its DNA binding activity and conversely, EIN3 represses MYC2 function (Song et al., 2014; Zhang et al., 2014). Other plant hormones, such as ABA, auxins, GAs, CKs and BRs, modulate the SA-JA-ET backbone of the plant immune signalling network. ABA can function as a positive or a negative regulator of plant defense depending on the plant-pathogen interaction analysed (Denancé et al., 2013). Indeed, mutants impaired in ABA biosynthesis or signalling were shown to overexpress defensive-signalling pathways, leading to enhanced resistance to different pathogens, such as B. cinerea, P. syringae or P. cucumerina, while rendering plants susceptible to A. brassicicola or R. solanacearum (Denancé et al., 2013). It has been shown that ABA signalling antagonizes plant immunity by suppressing SA-dependent defenses (Yasuda et al., 2008; de Torres-Zabala et al., 2009; Jiang et al., 2010; Xu et al., 2013). In addition, exogenous application of ABA suppresses JA-ET responsive defense genes, such as PDF1.2 and PR4 (Anderson et al., 2004). 30

51 Introduction Fungal spore ROS PAMPs enzymes DAMPs CESAs Ca 2+ channels RBOHD Ca 2+ α γ β Heterotrimeric G Protein PRRs Co-PRRs PEN3 Indol glucosinolates PEN2 CYP81F2 CDPKs MAP3K MKKs MPKs ABA SA JA ET Aux, GA, CK, BR Secondary metabolites Non-host resistance RESISTANCE Figure 1.5. The complex plant resistance to necrotrophic pathogens. The most important molecular components regulating plant resistance to necrotrophic fungi are depicted. Cell Wall Integrity (CWI) is regulated either by CESAs/wall-associated enzymes or by fungal degradation, which results in DAMPs release, activating several differential defensive responses. DAMPs are recognized by PRRs triggering PTI and defensive gene regulation. Heterotrimeric G protein, secondary metabolites and non-host resistance are essential immunity components. The function of different signalling pathways mediated by hormones and the impact of hormones crosstalk in resistance to necrotrophic fungi have been shown. Auxins regulate many fundamental aspects of plant growth and development, but they are also involved in the attenuation of Arabidopsis resistance to (hemi)biotrophs, and in the enhancement of plant defenses towards necrotrophic pathogens (Fu and Wang, 2011). Accordingly, Arabidopsis auxin signalling mutants exhibit increased susceptibility to the necrotrophic fungi P. cucumerina and B. cinerea (Llorente et al., 2008). Auxins negatively impact plant defense by interfering with SA signalling, and certain biotrophic pathogens exploit auxin-mediated suppression of SA to promote disease (Chen et al., 2007). The induction of the 31

52 Introduction SA signalling pathway, however, causes global repression of auxin-related genes, including those encoding auxin receptors, resulting in inhibition of auxin responses (Wang et al., 2007). Interestingly, auxins can also promote growth of P. syringae pv. tomato and disease in Arabidopsis via a mechanism independent of suppression of SA pathway (Mutka et al., 2013). Gibberellins (GAs) control plant growth by inducing the degradation of a class of nuclear proteins, called DELLA proteins. This degradation was shown to promote susceptibility to necrotrophs and resistance to biotrophs through modulation of SA and JA signalling (Navarro et al., 2008). Remarkably, DELLA proteins compete with MYC2 for binding to JAZ proteins, releasing free MYC2 to activate JA-responsive gene expression. GA-mediated degradation of DELLA proteins, however, leads to JAZ-mediated inhibition of MYC2 and disruption of JA signalling, resulting in enhanced SA signalling and biotroph resistance (Hou et al., 2010; Wild et al., 2012; Yang et al., 2012). Cytokinins (CKs) have recently emerged as modulators of plant immunity. Many fungal and bacterial pathogens can produce CKs themselves or use the host CK machinery to disrupt plant defenses (Naseem et al., 2014). However, CKs also mediate plant resistance against infection by modulating SA signalling. The CK-activated TF ARR2 binds to the SA response TF TGA3, resulting in increased expression of SA-dependent defense genes and enhanced resistance to P. syringae (Choi et al., 2010). CK crosstalks with other hormones, such as JA and auxins, in response to biotic stresses have also been described (O Brien and Benková, 2013). Brassinosteroids (BRs) are a unique group of plant steroidal hormones that can act both antagonistically and synergistically with PTI responses (Albrecht et al., 2012; Belkhadir et al., 2012; Lozano-Durán et al., 2013; Shi et al., 2013). Following stress perception, BRs have been found to interact with a range of other hormones, including SA, JA, ABA, auxins and GAs (De Bruyne et al., 2014). In addition, BRs can influence the production of ROS and modulate secondary metabolite production (Xia et al., 2010; Guo et al., 2013; Baxter et al., 2014) The function of RLKs/RLPs in the regulation of plant development As the main plant receptors for extracellular signals, RLKs include several receptors that can perceive endogenous developmental signals such as the brassinosteroid hormones or different types of signalling peptides. The LRR-RLKs CLAVATA1 (CLV1) and CORYNE (CRN), and the RLP CLV2 perceive the CLV3 peptide in the shoot meristem to restrict the expression of the stem cell-promoting TF WUSCHEL, thereby achieving homeostasis of the stem cell population (Clark 32

53 Introduction et al., 1997; Brand et al., 2000; Schoof et al., 2000; Müller et al., 2008; Nimchuk et al., 2011; Yadav et al., 2011). In addition, CLV1 acts synergistically with the receptor kinase ARABIDOPSIS CRINKLY4 (ACR4), which controls epidermal cell layer integrity and formative cell divisions in lateral roots (Gifford et al., 2003; De Smet et al., 2008), to regulate root meristem maintenance in response to the CLE40 signalling peptide (Stahl et al., 2013). The LRR-RLK BRI1 (Brassinosteroid Insensitive1), which directly binds BRs, is involved in several physiological and developmental processes, and forms hetero-oligomers with its co-receptor BAK1 and other BAK1 homologues upon BR perception (Li and Chory, 1997; He et al., 2000; Li et al., 2002; Nam and Li, 2002; Hothorn et al., 2011; Kim et al., 2013). The LRR-RLKs HAESA (HAE) and HAESA- LIKE2 (HSL2) are involved in floral organ abscission and in emergence of lateral root primordia in Arabidopsis by perception of the signalling peptide INFLORESCENCE DEFICIENT IN ABSCISSION (IDA; Butenko et al., 2003; Stenvik et al., 2008; Kumpf et al., 2013). The RLK FERONIA (FER) mediates the interaction between the male and female gametophytes during fertilization, cell elongation, root hair development and ROS production by the female gametophyte to induce rupture of the pollen tube (Huck et al., 2003; Escobar-Restrepo et al., 2007; Guo et al., 2009; Duan et al., 2010, 2014). The RLK THESEUS1 (THE1) is a member of FER family of receptors and was shown to play a role in the control of cell expansion, ROSmediated growth inhibition and cell wall integrity (Hématy and Höfte, 2008; Guo et al., 2009; Denness et al., 2011). ERECTA (ER) LRR-RLK performs multiple functions in Arabidopsis development processes and in immunity. For instance, ER regulates several developmental processes such as stomatal patterning, inflorescence architecture, lateral organ shape, ovule development and transpiration efficiency, through its genetic interaction with two closely related LRR-RLK paralogs (ERL1 and ERL2) and the RLP TOO MANY MOUTHS (TMM), (Figure 1.6; Torii et al., 1996; Shpak et al., 2003, 2004, 2005; Masle et al., 2005; Hara et al., 2007). Remarkably, ER is also required for Arabidopsis immune response and resistance to different pathogens, including the necrotrophic fungus P. cucumerina, the vascular bacterium R. solancearum, the oomycete Pythium irregulare, and the vascular fungus Verticillium longisporum, since er null mutant alleles (e.g., er-1 and er105) are more susceptible to these pathogens than wild-type plants (Figure 1.6; Godiard et al., 2003; Llorente et al., 2005; Adie et al., 2007; Häffner et al., 2014). However, the exact mode of action of ER in plant immunity has not been elucidated. A role of ER in regulating cell wall-mediated disease resistance has been suggested, since a positive correlation was found between changes in the cell wall composition of er mutant and its resistance to P. cucumerina (Sánchez-Rodríguez et al., 2009). Two mutations, ser1 and ser2, 33

54 Introduction restored to wild-type levels the cell wall alterations and the enhanced susceptibility to P. cucumerina of er-1. However, these mutations failed to suppress er-associated developmental phenotypes, suggesting that the ER signalling pathways controlling immunity and development were not identical (Sánchez-Rodriguez et al., 2009). In the leaf epidermis, a MAPK signalling module, consisting of YODA (YDA) MAP3K, MKK4/MKK5, and MPK3/MPK6, acts as a negative regulator of stomata development (Figure 1.5 and 1.6; Lau and Bergmann, 2012). It controls the entry division that initiates stomata development by MPK3/MPK6-dependent phosphorylation of the bhlh transcription factor SPCH (SPEECHLESS) (Lampard et al., 2008). Genetic evidence places this MAPK module downstream the ER family of receptors (ERf) and TMM, which perceive extracellular small cysteine-rich peptides of the EPF-like family (Bergmann et al., 2004; Wang et al., 2007; Richardson and Torii, 2013). Stomatal development through the YDA signalling module is also negatively regulated by components of BR signalling pathway. The GSK3-like kinase BIN2 (Brassinosteroid-Insensitive2) was found to interact with, phosphorylate and inhibit YDA, MKK4 and MKK5, but upon BR perception, BIN2 is inactivated, thereby de-repressing YDA and its downstream signalling cascade (Figure 1.6; Kim et al., 2012; Khan et al., 2013). YDA plays multifaceted roles in plant development. For instance, YDA regulates zygote polarity for proper specification of suspensor cell fate and promotes above-ground organ growth (Lukowitz et al., 2004). In loss-of-function yda mutants, which display embryo-lethality, elongation of the zygote is suppressed, and the cells of the basal lineage are incorporated into the embryo instead of differentiating into the extra-embryonic suspensor. By contrast, the constitutive activation of YDA (CA-YDA) causes exaggerated growth of the suspensor and suppression of embryo development (Lukowitz et al., 2004). In addition, YDA signalling cascade has been suggested to function downstream ER in regulating inflorescence architecture, since loss-of-function mutants of MPK3/MPK6 and MKK4/MKK5 showed an er phenotype, whereas the gain-of-function MKK4 and MKK5 transgenes can rescue the er and yda mutants at both morphological and cellular levels (Figure 1.6; Meng et al., 2012). Furthermore, it has been proposed that ERf and YDA act in overlapping pathways in flower development, as yda and er erl1 erl2 mutants share a phenotypic resemblance in floral patterning and organ identity (Bemis et al., 2013). These examples suggest that, despite the extensive repertoire of MAP kinases existing in plants and the large number of putative MAPK cascades that can be formed, the ER-YDA signalling pathway might play a key role in the regulation of several other biological processes. 34

55 Introduction Leaf epidermis Inflorescence Embryo Immunity EPFs BR EPFL4/6 PAMPs TMM ER ERL1 ERL2 BRI1 BAK1 ER ERL1 ERL2 ER Apoplast BSK1 SSP? YDA BSU1 BSLs YDA YDA MKKK MKK4/5 MPK3/6 BIN2 MKK4/5 MPK3/6 MKK4/5 MPK3/6 MKK MPK Cytoplasm Nucleus SPCH?? GRD? Stomata patterning Inflorescence architecture Suspensor development Resistance to pathogens Figure 1.6. Schematic drawing of ER and YDA signalling pathways involved in different developmental processes and plant immunity. In the leaf epidermis, ER, ERL1 and ERL2 (ER family, ERfs) form complexes with TMM and perceive EPFs. Once activated, ERfs hypothetically transmit the signal through brassinosteroid-signalling kinases (BSKs), BSU phosphatases and BIN2 to the YDA MAPK cascade, which inhibits SPEECHLESS (SPCH) and stomatal development. BIN2 inactivates YDA and MKK4/5 in the absence of stimuli, increasing stomatal production. BR perception by BRI1 inactivates BIN2, leading to activation of YDA and downstream MAP kinases, and suppression of stomatal development. In the inflorescence, the perception of EPF-like peptides (EPFL4/6) by ERfs activates YDA MAPK cascade and promotes tissue-specific cell proliferation, thereby regulating pedicel, petiole and inflorescence elongation. In the embryo, the membrane-associated RLCK SSP (SHORT SUSPENSOR) and the YDA signalling cascade activate unknown transcription factors, which lead to suspensor development. The transcription factor GROUNDED (GRD) seems to act downstream of YDA, but it is not a direct target of YDA MAPK cascade. In immunity, ER has been shown to play a role in resistance to different pathogens, but the signalling cascade downstream ER has not been elucidated. Adapted from Musielak and Bayer,

56 Introduction Arabidopsis thaliana - Plectosphaerella cucumerina pathosystem Plant resistance to necrotrophic pathogens, such as B. cinerea and P. cucumerina, is multigenic and genetically complex (Llorente et al., 2005; Rowe and Kliebenstein, 2008), and depends on the precise regulation of different signalling pathways. Genetic evidence indicates that the SA, JA, ET, ABA and auxin signalling pathways are required for Arabidopsis resistance to these fungal pathogens, as mutants impaired in any of these pathways are more susceptible than wild-type plants (Thomma et al., 1998; Berrocal-Lobo et al., 2002; Ferrari et al., 2003; Llorente et al., 2008; Sánchez-Vallet et al., 2012). To study the molecular mechanisms of plant basal resistance to necrotrophic pathogens, we employed the model pathosystem Arabidopsis thaliana - P. cucumerina (Figure 1.7A). The necrotrophic fungus P. cucumerina is a filamentous ascomycete commonly found in the rhizosphere and in decaying tissues of a broad range of plants, such as cucurbits and legumes (Figure 1.7B; Ramos et al., 2013). Arabidopsis is a natural host for several isolates of this fungal pathogen, such as the PcBMM one that was identified and selected on naturally infected Ler plants (Tierens et al., 2001). The PcBMM adapted isolate is virulent on a wide range of Arabidopsis ecotypes (Llorente et al., 2005), and PcBMM-inoculated plants develop small chlorotic spots on the leaves, which turn necrotic 2-3 days after infection and quickly lead to full necrosis of the leaves and spreading through the petioles and vascular system, causing the complete decay of highly susceptible Arabidopsis accessions 5-7 days after inoculation (Figure 1.7A; Llorente et al., 2005). The analysis of Arabidopsis - P. cucumerina pathosystem has contributed to the identification of novel components of plant defense, such as the tryptophan (Trp)-derived secondary metabolites, as mutants defective in their biosynthesis (cyp79b2, cyp79b3, pen2) or delivery to pathogen contact sites (pen3) show enhanced susceptibility to adapted and nonadapted isolates of P. cucumerina (Bednarek et al., 2009, Sanchez-Vallet et al., 2010). Arabidopsis cell wall has emerged as a key regulatory element of plant innate immunity and resistance to necrotrophic pathogens, including P. cucumerina (Miedes et al., 2014). For example, irregular xylem 1 (irx1) mutant, impaired in secondary cell wall cellulose synthase (CESA) subunits, shows enhanced resistance to this pathogen (Hernández-Blanco et al., 2007). 36

57 Introduction A B WT er 25 µm Figure 1.7. Macroscopic symptoms derived from the interaction between the necrotrophic fungus P. cucumerina and different host plants. (A) Necrotic lesions and trypan blue staining of infected leaves from plants of Arabidopsis wild-type or er genotypes infected with P. cucumerina. (B) Lesions in pumpkin (Cucurbita maxima) and zucchini (Cucurbita pepo) caused by the fungus. Similarly, ER PRR was found to be required for Arabidopsis resistance to P. cucumerina, as er mutant alleles were more susceptible than wild-type plants to PcBMM. Remarkably, three mutants with the same developmental phenotype (the erecta-like mutants elk2, elk4/agb1 and elk5) were also found to be more susceptible to this pathogen than wild-type plants (Llorente et al., 2005). elk4 mutant was impaired in the β-subunit of the heterotrimeric G-protein that controls several developmental processes, including stomata aperture (Wang et al., 2001), rosette leaf, flower and silique development (Lease et al., 2001; Ullah et al., 2003), ABA sensitivity during seed germination (Ullah et al., 2002; Pandey et al., 2006), and auxin signalling in roots (Trusov et al., 2007) among others. Plant heterotrimeric G-proteins also regulate stress responses, such as ROS production and cell death progression upon ozone exposure (Joo et al., 2005), and resistance to different types of pathogens, including P. cucumerina (Llorente et al., 2005; Trusov et al., 2006; Delgado-Cerezo et al., 2012; Liu et al., 2013; Torres et al., 2013). The genetic characterization of elk2 mutants have not been completed, despite ELK2 seems to be a master regulator of plant resistance to fungi (Llorente et al., 2005). In this Thesis we have focused on the genetic and molecular characterization of this mutant and to reach this main goal we have followed the objectives indicated below. 37

58

59 2. OBJECTIVES

60

61 Objectives 2. OBJECTIVES The aim of the current PhD Thesis is the genetic and molecular characterization of the MAP3K YODA and its contribution to the innate immunity of the model organism Arabidopsis thaliana. To this end, the following objectives have been undertaken: 1. Identification and characterization of the elk2/yda11 mutation. 2. Determination of the genetic interaction of YDA with potential regulators of Arabidopsis innate immunity and ERECTA-associated developmental processes. 3. Characterization of the molecular basis of YDA-mediated immunity and resistance to pathogens. 41

62

63 3. MATERIALS AND METHODS

64

65 Materials and Methods 3. MATERIALS AND METHODS 3.1. Plant material Arabidopsis accessions used in this study were Col-0, La-0 and Ler. The following mutants in Col-0 background were used: yda11/elk2 (Lease et al., 2001), er105 (Torii et al., 1996), fls2 (Zipfel et al., 2004), cerk1-2 (Miya et al., 2007), agb1-2 (Ullah et al., 2003), irx1-6 (Hernández- Blanco et al., 2007), mpk3-dg (Miles et al., 2005), mpk6-2 (Alonso et al., 2003), ap2c1, AP2C1- OE1 (#640.1), AP2C1-OE2 (#640.2) (Schweighofer et al., 2007), coi1-1 (Feys et al., 1994), sid2-1 (Nawrath and Métraux, 1999), ein2-1 (Guzmán and Ecker, 1990), eds1-2 (Bartsch et al., 2006), mlo2/6/12 (Consonni et al., 2006), cpr5 (Bowling et al., 1997), NahG (Lawton et al., 1995) and 35S::RbohD (Torres et al., 2005). The yda1 mutant and the CA-YDA line (Lukowitz et al., 2004) were in Landsberg erecta (Ler or er-1) background Arabidopsis growth conditions Arabidopsis seeds were grown on a hydrated and sterilized soil-vermiculite 3:1 mixture under a 10 hours day/14 hours night (short day) photoperiod, with a daytime temperature of 21ºC and a night temperature of 20ºC, under a light intensity of approximately 120 µe/m 2 s and a relative humidity of 65%. For developmental parameters measurements, plants were grown on a 16 hours day/8 hours night (long day) photoperiod, with the same temperature, light intensity and humidity conditions. For in vitro plant growth, seeds were surface-sterilized under laminar flow cabinet in an ethanol-bleach 1:1 mixture for 7 minutes, then washed for 7 minutes in 80% ethanol and 7 minutes in absolute ethanol, and finally dried over a sterile filter paper. Sterilized seeds were then transferred to 24-well plates containing 2 ml of 0.5X Murashige and Skoog (MS) basal salt medium (Duchefa, Holland) supplemented with 0.25% sucrose and 1mM MES (ph 5.7), or sown on Petri dishes containing MS medium. Seeds were stratified 3 days at 4ºC in the dark and then grown under a 16 hours day/8 hours night photoperiod at a constant temperature of 22ºC. The coi1-1 and ein2-1 mutants were grown on plates containing 50µM of jasmonic acid (JA; Sigma, USA) or 10µM of aminocyclopropane carboxylic acid (ACPC; Sigma, USA), respectively, and then, plants that were not accumulating anthocyanins (coi1-1) or ACPCinsensitive plants (ein2-1) were transferred to soil for further analyses. 45

66 Materials and Methods 3.3. Pathogens and growth conditions The necrotrophic fungus Plectosphaerella cucumerina isolate BMM (PcBMM) was kindly provided by Dr. B. Mauch-Mani (University of Neuchâtel, Neuchâtel, Switzerland; Tierens et al, 2001; Ton and Mauch-Mani, 2004). Fungal spores were grown on potato-dextrose agar plates (Difco, USA) at 28ºC for 21 days. Subsequently, fungal spores were harvested in sterile water, quantified and stored in 20% glycerol at -80ºC as described (Berrocal-Lobo and Molina, 2004). The oomycete Hyaloperonospora arabidopsidis isolates Noco2 and Cala2 were kindly provided by Dr. J. Parker (Max Planck Institute for Plant Breeding Research, Köln, Germany). They were propagated by weekly culturing on a genetically susceptible Arabidopsis accession, inoculating plants with a conidiospore suspension and growing them under a 10 hours day/14 hours night photoperiod (19ºC day/17ºc night, 75-80% of relative humidity). At 7 days postinoculation (dpi), leaves containing conidiophores were collected and washed with sterile water, and conidiospores were counted with a haemocytometer. Golovinomyces orontii was propagated on four-week-old eds1-2 plants and conidia were used at dpi. Inoculations were performed in a 80 cm high cardboard settling tower whose opening was covered with a 80 µm nylon mesh. A fine paint brush was used to harvest conidia from four heavily infected leaves and to separate the conidia by brushing them through the nylon mesh. Newly inoculated plants were then returned to the growth chamber (Wessling and Panstruga, 2012). Erysiphe cruciferarum was propagated on agb1-2 plants. Inoculations were performed on 16-day-old plants using a fine paint brush. Pseudomonas syringae pv tomato DC3000 was obtained from Novartis Corporation collection (Novartis Crop Protection Inc., Research Triangle Park, USA). It was grown on King s B (KB) medium supplemented with rifampicin (Rf) and kanamycin (Km) for selection, and incubated at 28ºC for 2 days. Pseudomonas stocks were kept in 20% glycerol KB (Rf, Km) liquid medium at -80ºC Pathogenicity assays For PcBMM pathogenicity assays, 18 or 21-day-old plants growing on soil were sprayed with a spore suspension (4x10 6 spores/ml) of the fungus. After inoculation, plants were put in a tray and covered with a plastic foil to maintain high humidity. Trays were kept in a growing 46

67 Materials and Methods chamber under short day conditions with a daytime temperature of 24ºC and a night temperature of 22ºC. At least 20 plants per genotype were inoculated in each experiment, and water-treated plants were included as control (mock inoculation). The progress of PcBMM infection was estimated at different dpi as average disease rating (DR) from 0 to 5: 0, no symptoms; 1, plant with some necrotic spots; 2, one or two necrotic leaves; 3, three or more leaves showing necrosis; 4, more than half of the plant showing profuse necrosis; 5, decayed/dead plant. Fungal biomass quantifications were also performed (Section 3.5). For H. arabidopsidis assays, 12-day-old plants were sprayed with a conidiospore suspension (2x10 4 spores/ml) of either isolates Noco2 or Cala2. After inoculation, plants were placed in a tray and covered with a plastic foil to maintain high humidity. Inoculated plants were incubated under short day conditions for 7 days (see section 3.3). Afterwards, the aerial parts of all plants from the same line were harvested into 50-ml sterile tubes and fresh weight was determined. Samples were vortexed briefly in 5 ml of dh 2 O and, after removal of plant material by filtration through Miracloth (Calbiochem, Millipore), released conidiospores were counted using an haemocytometer (Neubauer Improved chamber) on a light microscope. Spore counts were normalized to the initial fresh weight. P. syringae pv tomato DC3000 spray inoculations were performed as described (Zipfel et al., 2004) with some modifications. Bacteria were washed from a fresh plate with 10mM MgCl 2 and diluted to OD (approximately 5x10 8 cfu/ml). 18-day-old plants were sprayed with the bacterial suspension containing 0.035% Silwet L-77 (Lehle Seeds). Trays containing inoculated plants were sealed with a plastic foil to maintain high humidity and incubated under short day conditions. Mock inoculations were performed with 10mM MgCl 2 containing an identical amount of Silwet L-77. At 2 and 4 dpi, four leaves from three individual plants of the same genotype were harvested and surface sterilized (30 seconds in 70% ethanol, followed by 30 seconds in sterile dh 2 O). Leaf discs were cut with a 5 mm-diameter cork borer and put into individual tubes, and then ground in 10mM MgCl 2 with a sterile plastic pestle. Afterwards, samples were thoroughly vortexed, diluted 1:10 serially and plated on KB plates supplemented with Rf and Km. Plates were placed at 28ºC for 36 hours, after which the colony forming units were counted. G. orontii inoculations were performed as described in section 3.3, at a density of approximately 750 spores/cm 2. At 6 dpi, three samples of approximately 200 mg of plants were harvested per genotype. 3 ml of sterile dh 2 O were added and spores liberated by thoroughly vortexing for 30 seconds. The spore solution was filtered through Miracloth 47

68 Materials and Methods (Calbiochem, Millipore) to remove debris and spores were 4-fold concentrated by centrifugation (5 min, 4000g). For each sample, spores were counted in eight 1 mm 2 fields of a Neubauer Improved haemocytometer, and results were averaged. Finally, spore counts were normalized to the initial fresh weight (Wessling and Panstruga, 2012). E. cruciferarum inoculations were performed by harvesting conidia from four heavily infected plants with a fine paint brush. The conidia were then brushed through a nylon mesh placed on top of the plants from the genotypes under study. Trypan blue staining was performed at 24 hpi to visualize conidia germination PcBMM fungal genomic biomass quantification Quantification of fungal DNA relative to total plant genomic DNA was performed by quantitative PCR (qpcr; 7300 Real Time PCR System, Applied Biosystems) using as template genomic DNA extracted from PcBMM infected plants (3 to 5 plants per genotype) at different dpi. The expression of the constitutive gene β-tubulin from the fungus was normalized to that of the Ubiquitin UBC21 (At5g25760) constitutive gene from Arabidopsis, as described (Sanchez-Vallet et al., 2010; Delgado-Cerezo et al., 2012), and then represented as the n-fold expression relative to the wild-type plants. Oligonucleotides used to amplify PcBMM β-tubulin gene and Arabidopsis UBC21 are listed in Table Trypan blue stainings Fungal growth and cell death caused by fungal infection was visualized with a solution of lactophenol-trypan blue (TB) containing 10 mg TB (Sigma), 10 ml lactic acid, 10 ml phenol, 10 ml glycerol and 10 ml dh 2 O. Stock solution was diluted with 100% ethanol (1:1). Leaves from E. cruciferarum and H. arabidopsidis Cala2 inoculated plants were harvested at 24 hours postinoculation (hpi) and 7 dpi, respectively, soaked and boiled in the diluted TB solution for 1-2 minutes. Destaining and fixation was done with 2.5 g ml -1 chloral hydrate overnight. Leaves were transferred to 50% glycerol solution and mounted on slides to check in the microscope. 48

69 Materials and Methods 3.7. Callose deposition For callose staining, three-week-old plants were drop inoculated with 6 µl of a suspension of PcBMM spores (5x10 5 spores/ml). Two drops of spore suspension were added per leaf and 10 leaves were inoculated per genotype. Inoculated leaves were collected at 24 hpi and destained for at least 24 hours in 95% ethanol until all tissues were transparent. Subsequently, leaves were washed in 0.07M phosphate buffer (ph 9) for 30 minutes, and were incubated overnight in 0.07M phosphate buffer containing 0.5% aniline blue (Sigma). Leaves were mounted on slides on fresh 0.07M phosphate buffer containing 0.05% aniline blue and inmediately checked in an epifluorescence microscope with UV filter (Luna et al., 2011) Aequorin luminescence measurements Transgenic Col-0 and cerk1-2 plants expressing cytosolic 35S::Apoaequorin were used (Col-0 AEQ and cerk1-2 AEQ ; Knight et al., 1991; Ranf et al., 2015). Aequorin lines were generated by crossing yda11, er105 and agb1-2 with Col-0 AEQ plants, and homozygous yda11 AEQ, er105 AEQ and agb1-2 AEQ plants were selected by measuring the luminescence emitted after the addition of 2M CaCl 2 to leaf discs from three-week-old plants and by allele-specific PCR amplification to confirm the yda11, er105 and agb1-2 backgrounds. Eight-day-old liquid-grown seedlings were placed individually in white 96-well plates (Greiner GmbH) containing 10 µm coelenterazine in dh 2 O (native coelenterazine or CTZ-n, P.J.K., Germany), and incubated in the dark overnight. Luminescence was recorded by scanning each row in 6 seconds intervals using a Varioskan Flash Multimode Reader (Thermo Scientific), as previously described (Ranf et al., 2011). The remaining aequorin was discharged by addition of CaCl 2 (final concentration 1M, 20% ethanol) and Ca 2+ concentrations were calculated according to Rentel and Knight (2004), using the following equation: [Ca 2+ ] cyt = ( - log (L/L max )) where L/L max is the luminescence counts per second divided by total luminescence counts remaining. The calibration equation was determined empirically assuming that all aequorin is discharged from all cells and all emitted light is detected (Rentel and Knight, 2004). 49

70 Materials and Methods 3.9. MAPK phosphorylation detection Seedlings were surface sterilized, stratified and grown in 24-well plates (10 seedlings per well) containing MS medium as described in section 3.2. At 10 days, the medium was discarded and replaced with fresh MS medium. At 12 days, seedlings were treated with an extract of PcBMM spores (approximately 2x10 6 spores/ml per well) or with 1 µm flg22. Then, seedlings were harvested in 2 ml tubes containing ceramic beads at 0, 10, 20, and 30 minutes and frozen in liquid nitrogen. Total protein was extracted by adding µl of extraction buffer [25mM Tris-HCl ph 7.8; 75mM NaCl; 15mM EGTA; 10mM MgCl 2 ; 15mM β-glycerophosphate; 15mM 4- nitrophenylphosphate bis; 1mM DTT; 1mM NaF; 0.5mM activated Na 3 VO 4 ; 0.5mM PMSF; 1% (v/v) protease inhibitor cocktail P9599 (Sigma); 0.1% (v/v) Tween-20] and grinding at 6200 rpm for 18 seconds in a MagNA Lyser (Roche Applied Science, USA) homogenizer. Samples were then centrifuged for 20 minutes at 4ºC. The supernatant containing the total protein was collected. Protein concentrations were determined with the Bradford assay (Bradford, 1976) µg of total protein extracts were loaded on 10% SDS-PAGE gel and transferred to nitrocellulose membranes (Protran Supported 0.45 NC, Amersham Biosciences). Membranes were incubated 1 hour in Pierce Protein-Free T20 (TBS) Blocking Buffer (Thermo Scientific) at room temperature (RT), followed by an overnight incubation at 4ºC with a 1:1000 dilution of the anti-p44/p42 (Anti-Erk1-Erk2; Thr202-Tyr204) MAPK rabbit primary antibody (Cell Signalling). Subsequent incubation with a 1:5000 dilution of the anti-rabbit IgG-HRP secondary antibody (Fisher Scientific) was performed, and the Pierce ECL Western Blotting Substrate (Thermo Scientific) was used to develop the membranes. Equal protein loading was checked by amido black (Merck Millipore) staining of the membranes ROS burst assays ROS detection was performed as described by Roux and collaborators (2011) with some modifications. Twelve leaf discs from six 4-week-old plants were sampled using a cork borer of 4 mm diameter, placed in white 96-well plates (Greiner GmbH) with water and incubated at RT overnight in the dark. The following day water was replaced with a solution of 100µM luminol (Sigma) and 10 µg ml -1 horseradish peroxidase (Sigma) containing 100nM flg22 or an extract of PcBMM spores (approximately 4x10 6 spores/ml). Luminescence was measured over a period of 40 minutes using a TECAN GENios Pro Multiplate reader (Tecan, Switzerland), and expressed as relative light units (RLU). 50

71 Materials and Methods Quantification of Trp derivatives PcBMM inoculated and non-inoculated plants were collected at 1 and 3 dpi and frozen in liquid nitrogen. Extraction and HPLC analysis of tryptophan (Trp) derivatives was performed as previously described (Bednarek et al., 2009). Briefly, after addition of DMSO, the tissues were homogenized and centrifuged for 15 minutes at 20,000g. The supernatants were collected and subjected to HPLC on an Agilent 1100 HPLC system. Fractions corresponding to camalexin, indol-3-ylmethylamine (I3A), indol-3-ylmethyl glucosinolate (I3G) and 4-methoxyindol-3- ylmethyl glucosinolate (4MI3G) were collected. The concentrations of the metabolites of interest were quantified on the basis of the comparison of their peak areas with those obtained during HPLC analyses of known amounts of the respective compounds purified from plant tissue (I3G, 4MI3G) or synthetic (I3A, camalexin) standards. Each line was tested in at least three independent experiments giving similar results for all analysed compounds Morphometric and stomatal analyses Forty five-day-old plants grown under long day conditions were used for morphometric analyses. The length of the main inflorescence of at least 15 plants of each genotype was measured, and the average value obtained was designated as plant height. Ten siliques, with their respective pedicels, from the basal part of the main inflorescence of five individual plants (total of 50 siliques and 50 pedicels per genotype) were measured before desiccation (Torii et al., 1996). Average values were calculated and designated as silique and pedicel length. For stomata counting, fully expanded leaves of the second pair were collected from 25-day-old plants grown under short day conditions. Leaves were destained in 95% ethanol until all tissues were transparent. Subsequently, leaves were transferred to 50% glycerol. The stomatal index and stomata density were obtained after counting stomata and epidermal cells in the abaxial side of destained leaves under the optical microscope Arabidopsis DNA extraction Genomic DNA extractions for genotyping and quantitative PCR amplification were performed by homogenization of plant tissues in a CTAB-containing extraction buffer [100mM Tris-HCl ph 8; 20mM EDTA; 1.4M NaCl; 2% (v/v) CTAB]. Homogenized tissues were incubated at 60ºC for 30 minutes before adding 1 volume of chloroform-isoamyl alcohol (24:1). Samples were 51

72 Materials and Methods centrifuged at 13,000 rpm for 10 minutes. Supernatants were collected and precipitated with 1 volume of isopropanol for at least 10 minutes at RT. Samples were centrifuged for 10 minutes at 10,000 rpm and pellets were washed with 70% ethanol, air dried and resuspended in 50 µl of sterile dh 2 O. DNA samples were then quantified spectrophotometrically using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc.; Wilmington, USA) Arabidopsis RNA extraction and cdna synthesis For total RNA extraction, Arabidopsis tissues were frozen in liquid nitrogen. Frozen samples were ground with mortar and pestle to fine powder and homogenized with 400 µl of extraction buffer [0.2M Tris-HCl; 0.4M LiCl, 0.5M EDTA, 1% (v/v) SDS]. Homogenized tissues were mixed by vortexing and treated twice with phenol (addition of 1 volume of phenol and centrifugation at 13,000 rpm for 3 minutes), followed by 1 chloroform treatment (addition of 1 volume of chloroform and centrifugation at 13,000 rpm for 3 minutes). The supernatant was mixed with 1/3 volumes of 8M LiCl and incubated on ice for at least 2 hours. Samples were then centrifuged at 13,000 rpm for 30 minutes at 4ºC, supernatants were discarded and pellets were resuspended in 300 µl of sterile dh 2 O. After addition of 30 µl of 3M sodium acetate and 600 µl 100% ethanol, RNA precipitation was carried out overnight at -20ºC. Subsequently, samples were centrifuged at 13,000 rpm for 20 minutes at 4ºC, supernatants were discarded and pellets were washed with 80% ethanol, air dried and resuspended in 30 µl sterile dh 2 O. RNA samples were quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc.; Wilmington, USA) and quality was checked in a 2% agarose gel. For cdna synthesis, 2 µg of total RNA was treated with DNase (TURBO DNA-free TM Kit, Ambion, Life Technologies) to eliminate genomic DNA contaminants, and then reversetranscribed for 60 minutes at 50ºC in a 20 µl reaction volume using the Transcriptor First Strand cdna Synthesis Kit (Roche Applied Science, USA) and oligo-dt oligonucleotides Generation and characterization of Arabidopsis double mutants. The mutant alleles used for the generation of double mutants with elk2/yda11 (Lease et al., 2001) were yda1, CA-YDA (Lukowitz et al., 2004), er105 (Torii et al., 1996), mpk3-dg (Miles et al., 2005), mpk6-2 (Alonso et al., 2003), fls2 (Zipfel et al., 2004), cerk1-2 (Miya et al., 2007), ap2c1 (Schweighofer et al., 2007) and Col-0 AEQ (Knight et al., 1991). Double mutants were 52

73 Materials and Methods generated by standard genetic crosses, following the mutations in the F2 progeny with allelespecific PCRs. Table 3.1 shows a list of the oligonucleotides used for the identification of the mutants analysed in this work. For yda1 and elk2/yda11 identification, restriction enzyme digestions of the amplified DNA fragments were performed (Table 3.2). The yda11 coi1-1, yda11 ein2-1 and yda11 sid2-1 double mutants were generated in a previous work (Clara Sánchez-Rodríguez, PhD Thesis, 2007). The coi1-1 and ein2-1 mutants and the corresponding yda11 coi1-1 and yda11 ein2-1 double mutants were selected in JA- and ACPC-containing plates respectively. Table 3.1. Oligonucleotides used to genotype double mutant lines generated in this study. Sequences of forward and reverse oligonucleotides are showed. T-DNA insertional lines are indicated in brackets. Mutant Forward oligonucleotide Reverse oligonucleotide yda1 GGTGGATCCTCATGGACGAG TCAGGCAATCAGAAGCATAGAG elk2/yda11 GGTGGATCCTCATGGACGAG TCAGGCAATCAGAAGCATAGAG CA-YDA ATGCCTTGGTGGAGTAAATCAAAAGATG CTGAGGAAGAAAACATAACCGATCAAAA er105 AAGAAGTCATTCAAAGATGTGA AGCTGACTATACCCGATACTGA mpk3-dg TCATCAAATGCGCTTATTGACA CTAACCGTATGTTGGATTGAG mpk6-2 (SALK) TCATCTTCATCTCCCAAATGC TTATCCGAAGAACATTGCCAG fls2 (SAIL) ACATGTCCGGTACTATCGCAG TCCATCAAGACAGCTAATGAGC cerk1-2 (GABI) AGAATATATCCACGAGCACACGGTTCCAG GACGAAAAGAGAGTGGATAAAGCAACCAC ap2c1 (SALK) CTTGCTCCGTCGCCGTATGTAATTCTCCGG CATCAGACGAGCCTCGTGAAGCAGATAAATCG Col-0 AEQ ATGAAATATGGTGTGGAAACTGATT GTTGTCTTGTCATCTCATCAACATC LBa1 (SALK) TGGTTCACGTAGTGGGCCATCG LB3 (SAIL) TAGCATCTGAATTTCATAACCAATCTCGATACAC LB (GABI-kat) CCCATTTGGACGTGAATGTAGACAC Table 3.2. Restriction enzymes used to genotype elk2/yda11 and yda1 mutants. Expected fragment sizes in base pairs (bp) for both wild-type (WT) and mutant plants are indicated. Mutant Enzyme Fragment size WT (bp) Fragment size mutants (bp) yda1 MseI yda11/elk2 XbaI

74 Materials and Methods Gene expression analyses Quantitative real-time PCR amplification (qrt-pcr) and detection was carried out in a 7300 Real-Time PCR System (Applied Biosystems, USA). Reactions were done in a final volume of 20 µl with 10 µl of 2xSYBR Green Master Mix (Roche Applied Science, USA), 1 µm of each oligonucleotide and 100 ng of genomic DNA or 10 ng of cdna. PCR conditions were as follows: 95ºC for 10 minutes, and then 45 cycles of 95ºC for 15 seconds and 60ºC for 1 minute. At the end of each experiment, a dissociation stage (95ºC for 15 seconds, 60ºC for 30 seconds and 95ºC for 15 seconds) was carried out to ensure that only single products were formed. Data analysis was performed using the Sequence Detector Software (Applied Biosystems, USA). Ubiquitin UBC21 (At5g25760) expression was used to normalize the transcript level in each sample. All the oligonucleotides used for qrt-pcr (Table 3.3) were designed with the program Primer Express 2.0 (Applied Biosystems, section 3.22) with the following criteria: base pairs, 45-55% G+C, 58-62ºC Tm, amplicon length of base pairs. Table 3.3. Oligonucleotides used in qrt-pcr amplifications for gene expression analyses. Gene AGI code Forward oligonucleotide Reverse oligonucleotide CYP79B2 AT4G39950 GCCGACCCACTTTGCTTTAAA TTTAAAGCAAAGTGGGTCGGC CYP81F2 AT5G57220 TATTGTCCGCATGGTCACAGG CCACTGTTGTCATTGATGTCCG FRK1 AT2G19190 ATCTTCGCTTGGAGCTTCTC TGCAGCGCAAGGACTAGAG LOX2 AT3G45140 ATCAACAAGCCCCAATGGAA CGGCGTCATGAGAGATAGCAT NCED3 AT3G14440 ACATCTTTACGGCGATAACCG TTCCATGTCTTCTCGTCGTGA NHL10 AT2G35980 TTCCTGTCCGTAACCCAAAC CCCTCGTAGTAGGCATGAGC PAD3 AT4G31500 CAACAACTCCACTCTTGCTCCC AACGTTTATGCGATGGGTCG Pcβ-tubulin - CAAGTATGTTCCCCGAGCCGT GGTCCCTTCGGTCAGCTCTTC PDF1.2 AT5G44420 TTCTCTTTGCTGCTTTCGACG GCATGCATTACTGTTTCCGCA PHI-1 AT1G35140 TTGGTTTAGACGGGATGGTG ACTCCAGTACAAGCCGATCC PR1 AT2G14610 CGTCTTTGTAGCTCTTGTAGGTGC TGCCTGGTTGTGAACCCTTAG PR4 AT3G04720 AGCTTCTTGCGGCAAGTGTTT TGCTACATCCAAATCCAAGCCT RETOX AT1G26380 CGAACCCTAACAACAAAAAC GACGACACGTAAGAAAGTCC UBC21 gdna AT5G25760 AAAGGACCTTCGGAGACTCCTTACG GGTCAAGAATCGAACTTGAGGAGGTT UBC21 cdna AT5G25760 GCTCTTATCAAAGGACCTTCGG CGAACTTGAGGAGGTTGCAAAG WRKY33 AT2G38470 ACGGCCAGAAAGTCGTTAAGG CATGTCGTGTGATGCTCTCTCC 54

75 Materials and Methods Expression profiling For yda11 transcriptomic experiment, approximately 25 rosettes from 21-day-old noninoculated, mock-treated (1 dpi) or PcBMM-inoculated Col-0 and yda11 plants (1 and 3 dpi) were collected (four biological replicates). Total plant RNA was extracted as described in Section 3.14, and further purified using the RNeasy Kit (Qiagen; Germany). RNA quality was tested by using a Bioanalyzer 2100 (Agilent Technologies, US). Three of the four biological replicates were independently hybridized for each transcriptomic comparison. Biotinylated complementary RNA (20 μg) was prepared and the resulting complementary RNA was used to hybridize ATH1 Arabidopsis GeneChips (Affymetrix) using the manufacturer s protocols at the Genomic Unit of the CNB-CSIC (Madrid, Spain). Array images were analysed with GenePix 400B scanner (Molecular Devices) at 10-mm resolution. The images were quantified with GenePixPro 5.1. Gene expression levels were analysed with GeneSpring 7.2 software (Silicon Genetics) and the chip-to-chip signal variation was minimized by normalizing signal intensities to the averaged intensity values of wild-type plants using the expression levels of the top 20th percentile of probesets. Differentially expressed genes in untreated mutants relative to wild type samples or in PcBMM-inoculated relative to the mock-treated samples were identified using two-way analysis of variance and a Benjamini and Hochberg multiple testing correction (GeneSpring 7.2), as described previously (Stein et al., 2006). Genes were considered differentially expressed at p Up- and down-regulated genes were selected using normalized values (n-fold) higher than or lower than relative to control plants. For CA-YDA transcriptomic analyses, eighteen-day-old wild-type and CA-YDA plants, mock-treated or PcBMM-inoculated, were collected at 1 dpi. Each sample represented a pool of 25 rosettes from plants grown under the short day conditions and inoculated as reported on Section 3.4. Four biological replicates were obtained. Total RNA was extracted and purified as mentioned above. RNA quality was tested using a Bioanalyzer 2100 (Agilent Technologies, USA). The expression levels of PR1, PDF1.2 and PAD3 were determined by qrt-pcr to confirm the appropriate disease progression in all the replicates. Three of the four biological replicates were independently hybridized for each transcriptomic comparison. Fluorophore-marked (Cy3 and Cy5) complementary RNA was prepared and the resulting complementary RNA was used to hybridize Arabidopsis Oligonucleotide Microarrays (Qiagen-Operon Arabidopsis Genome Array Ready Oligo Set Version 3.0.; Arizona University, USA) at the Genomic Unit of CNB-CSIC (Madrid). After hybridization, the array was scanned and the intensities were used to generate the array images. These images were used to correct and normalize the data. The expression levels of the genes were visualized with FIESTA Viewer (Oliveros, 2007). The expression of 55

76 Materials and Methods some genes identified in the transcriptome analysis was validated by qrt-pcr amplification using the oligonucleotides listed in Table 3.4. Table 3.4. Oligonucleotides used in qrt-pcr amplification for CA-YDA microarray validation. Gene AGI code Forward oligonucleotide Reverse oligonucleotide THI2.2 AT5G36910 GCCTTGACCACTCTCCAAAA GTAGATCCTCCGGTGCAGAC MC2 AT4G25110 GGGAGATTCCCTCGTCTTTC GGCCGTACGATTGTAGCATT FUT6 AT1G14080 GGACAAAGTCCCTTGGTTGA GATTCGTCGGGTGAAAAAGA FUT8 AT1G14100 GTCCCTTGGTTGGTCTTCAA TGCCCCAAACTTGGTTAGTC MKK9 AT1G73500 CTTATATGAGTCCGGAGAGGT CAAGCATCATCAATCCGAAAC Phosphoproteomic analyses Details to total protein and phosphoprotein enrichment via the Prefractionation-Assisted Phosphoprotein Enrichment (PAPE) procedure can be found in Lassowskat et al. (2013). Data Analysis and Evaluation: mass spectrometry raw data were analysed with the Progenesis LC-MS software (Nonlinear Dynamics Limited). After alignment and feature detection, normalization was applied automatically to all features as recommended by the Progenesis LC-MS software manual. Resulting features were filtered for an ANOVA p-value of <0.01 and a fold-change of >2.0. Data were subsequently searched with an in-house Mascot server (Version 2.2/3, Matrix Science, London, UK) against an Arabidopsis protein database based on TAIR10 ( Biochemical characterization of plant cell walls Biological material of 25-day-old plants was homogenized in 96% ethanol. The pellet was suspended in 96% ethanol, boiled during 1 hour and washed with ethanol overnight at 4ºC. The suspension was centrifuged, and the pellet was washed twice with acetone, followed by methanol/chloroform 1:1 (v/v), and finally air dried to a constant dry weight. This fraction is referred to as AIR (alcohol-insoluble residue). 56

77 Materials and Methods The cell wall AIR was hydrolyzed with 2M trifluoroacetic acid. The total sugars were determined in the soluble AIR fraction (n = 4) by phenol-sulphuric method, using glucose equivalents as standard (Dubois et al., 1956). Uronic acids were quantified in the same soluble fraction (n = 4) using galacturonic acid as standard (Blumenkrantz and Asboe-Hansen, 1973). The insoluble AIR fraction was hydrolyzed with sulphuric acid and the cellulose was determined in this fraction (n = 4) by phenol-sulphuric method Glycome Profiling Fractionation for Glycome Profiling: cell walls (AIR) were subjected to sequential extraction with increasingly harsh reagents in order to isolate fractions enriched in various cell wall components as described by Miedes and Lorences (2004, 2006). The residue was extracted with 0.05M trans-1,2-diaminocyclohexane-n,n,n,n -tetraacetic acid (ph 6.5) for 24 hours and centrifuged at 30,000g for 10 min. The sediment was then re-extracted for another 24 hour period under the same conditions. The remaining residue was then extracted twice for 24 hours with 0.05M Na 2 CO 3 (ph 10.8) containing 20mM NaBH 4 under a nitrogen atmosphere. These two pectic fractions are referred to as PC1 and PC2, respectively. The de-pectinated cell-wall material was used for the subsequent extraction of hemicellulosic polysaccharides. The residue was extracted with 0.7M KOH containing 20mM NaBH 4 under a nitrogen atmosphere for 24 hours and centrifuged at 30,000g for 10 min. The sediment was then reextracted for another 24 hour period under the same conditions. The remaining residue was then extracted twice for 24 hours with 4.7M KOH containing 20mM NaBH 4, under a nitrogen atmosphere. These two hemicellulosic fractions are referred to as HC1 and HC2, respectively. In all fractions, the two extracts were combined, neutralized with acetic acid, extensively dialyzed against distilled water, and then lyophilized. ELISA for Glycome Profiling: total sugar determinations of all cell wall fractions were done using the phenol-sulphuric acid method (Dubois et al., 1956). Glycome profiling of the cell wall fractions was carried out by ELISAs using a toolkit of plant cell wall-directed monoclonal antibodies as previously described (Pattathil et al., 2010; Zhu et al., 2010). The R language for statistical computing was used for the heat map (R Development Core Team, 2006). Monoclonal Antibodies: these antibodies are annotated in the database accessible on the Internet ( and the antibodies (hybridoma cell culture 57

78 Materials and Methods supernatants) are available to the cell wall research community from CarboSource ( for the CCRC, MH, PN, JIM, and MAC series of antibodies and from PlantProbes ( for LM and JIM antibodies Phylogenetic analyses Evolutionary analyses were conducted in MEGA5 (Tamura et al., 2011) and inferred using the Neighbor-Joining method based on the full length protein sequence of Arabidopsis thaliana AtYODA (At1g63700) and putative orthologues from Solanum lycopersicum SlYODA1 (Solyc08g ), SlYODA2 (Solyc03g ), SlYODA3 (Solyc06g ), Vitis vinifera VvYODA1 (XP ), VvYODA2 (XP ), Populus trichocarpa PtYODA1 (XP ), PtYODA2 (XP ), Oryza sativa Japonica OsYODA1 (NP ), Glycine max GmYODA1 (XP ), GmYODA2 (XP ), Cucumis melo subsp. melo CmYODA1 (ADN ) and Hordeum vulgare subsp. vulgare HvYODA1 (BAJ ). Two members of the A2 clade of MAP3K proteins in Arabidopsis, At1g53570 and At5g66850, where YODA belongs (Ichimura et al., 2002), were included in the analysis. Sequences were obtained from the NCBI and Solgenomics databases. The resulting tree was drawn to scale, with branch lengths expressed in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and were expressed in the units of the number of amino acid substitutions per site. The analysis involved 15 amino acid sequences. All positions containing gaps and missing data were eliminated Informatics resources and bioinformatics tools The statistical analysis of all the quantitative data was performed with Statgraphics Centurion XVI (StatPoint Technologies, Inc. Warrenton, USA) using an ANOVA (p 0.05) corrected with a Bonferroni test or a two-tailed Student s t-test (p < 0.05). Literature search: PubMed from the National Center for Biotechnology Information (NCBI; ISI Web of Knowledge ( Google Scholar ( 58

79 Materials and Methods Mutants search: SIGnAL T-DNA Express: Arabidopsis Gene Mapping Tools ( NASC: The European Arabidopsis Stock Centre ( TAIR - The Arabidopsis Information Resource ( GABI-Kat ( Oligonucleotides design: Primer Express Software v2.0 (Applied Biosystems, USA) SIGnAL T-DNA Primer Design ( Primer3Plus ( DNASTAR Lasergene (DNASTAR, Inc.; Madison, Wisconsin, USA) Functional classifications: BAR Classification SuperViewer tool (University of Toronto, Canada; Provart and Zhu, 2003) TAIR Gene Ontology ( Berardini et al., 2004) Sequences analysis: Chromas Lite (Technelysium Pty Ltd, Australia) DNASTAR Lasergene (DNASTAR, Inc.; Madison, Wisconsin, USA) TAIR BLAST ( Phosphorylation sites prediction: NetPhosK 1.0 Server ( Beta Musite.net ( Microarray data visualization: GeneSpring 7.2 software (Agilent Technologies, Inc., USA) FIESTA Viewer ( Oliveros JC, 2007) Hierarchical clustering and heat maps: MeV (Multiexperiment Viewer) (TM4 Microarray Software Suite; Saeed et al., 2003). 59

80

81 4. RESULTS

82

83 Results 4. RESULTS 4.1. Map-based cloning and characterization of ELK2/YDA gene In a screening performed to identify mutants defective in Arabidopsis immune responses against fungal pathogens, we found out that the elk2 mutant line, previously described as an erecta like (elk) mutant (Lease et al., 2001), was impaired in its resistance to fungi with different lifestyles, including the necrotrophs Plectosphaerella cucumerina and Botrytis cinerea, and the vascular pathogen Fusarium oxysporum (Llorente et al., 2005). These data suggested that ELK2 played a relevant function in the regulation of Arabidopsis immune responses to fungal pathogens and therefore a map-based cloning of ELK2 gene was performed. The elk2 mutation, that was initially mapped into a genomic interval of chromosome I flanked by nga128 and NF5I14 markers (Lease et al., 2001), was fine mapped using described genetic Col-0/La-0 markers (TAIR; as well as new ones developed for the corresponding BACs comprising the elk2 mapping region (Clara Sánchez- Rodríguez, PhD Thesis, 2007). This fine mapping localized the elk2 mutation between BACs F16M19 and T12P18, and between the genetic markers F16M19-1 and T12P18-1 (Figure 4.1A). The genomic sequences of putative genes comprising this region (BACs F2K11, F24D27 and T12P18) were sequenced and one mutation (a C to T transition) was found in the coding region of the At1g63700 gene encoding the YDA MAP3K (Figure 4.1; Clara Sánchez-Rodríguez, PhD Thesis, 2007). The elk2 mutation, renamed as yda11, resulted in the transition to leucine of a highly conserved proline (P619L) located in the kinase domain of the YDA protein (Figure 4.1B). The P619L transition in yda11 plants resulted in a hypomorphic and viable mutation of YDA gene, which allowed us to further characterize the function of YDA in Arabidopsis innate immunity and in other developmental processes. The yda11 phenotype contrasted with that of the yda1-yda9 alleles, which have severe impairments in plant development or are embryolethal (Lukowitz et al., 2004), and that of the yda10 allele, which has been also described as a hypomorphic allele (Meng et al., 2012), but did not show a clear erecta-like phenotype under our plant growth conditions. 63

84 Results A 500kb nga128 (18) NF5I14 (5) nga128 NF19K23 F16P17-1 Cer Cer Cer F16M19-1 T12P18-1 Cer NF5I F16M19 (100.5kb) F9N12 (67.7kb) F2K11 (110.8kb) F24D7 (87.6kb) T12P18 (79.5kb) YDA B yda1 (Q553*) elk2/yda11 (P619L) CA-YDA ( ) N-terminal Domain Kinase Domain C-terminal Domain Figure 4.1. Map-based cloning of elk2/yda11 mutation and structure of YDA gene. (A) The elk2/yda11 mutation was mapped in the bottom of chromosome I between markers nga128 and NF5I14. Fine mapping using additional markers delimited the elk2/yda11 mutation between F16M19-1 and T12P18-1 markers (in F16M19 and T12P18 BACs, respectively). The number of heterozygous plants found for each genetic marker is indicated. (B) Structure of the YDA gene. The boxes correspond to the exons, and the gaps to introns. The YDA regulatory N-terminal, protein kinase and C-terminal domains encoded by the exons are showed. The amino acids mutated in the yda1 and yda11 alleles, or deleted in the N-terminal domain of CA-YDA plants are indicated. 64

85 Results To prove that yda11 was a new mutant allele of YDA we generated the hemizygous yda1 +/- yda11 -/+ plants, carrying one copy of each parental allele. We crossed the heterozygous, viable yda1 +/- plants (in La-0 background; Lukowitz et al., 2004) with yda11 +/+ plants (in Col-0 background), and the resulting progeny was genotyped by PCR amplification, using the oligonucleotides described in Table 3.1 (Materials and Methods), followed by restriction enzyme digestion of the amplified DNA sequences (Table 3.2, Materials and Methods). The identified hemizygous plants were then backcrossed six consecutive times with the yda11 plants (in Col-0 background) to remove the majority of the DNA background from the parental La-0 ecotype of yda1 allele. The yda1 +/- yda11 -/+ plants, the parental mutant yda11, the Col-0 wild-type plants, the hypersusceptible agb1-2 mutant and the resistant irx1-6 plants were challenged with a spore suspension (4x10 6 spores/ml) of the virulent, necrotrophic fungus PcBMM, and the level of infection was measured at different days post inoculation (dpi) by establishing the Disease Rating (DR) and by determining fungal biomass by quantitative PCR (qpcr). As shown in Figure 4.2, the hemizygous yda1 +/- yda11 -/+ plants were found to be highly susceptible to PcBMM, since fungal biomass in these plants at 5 dpi was higher than that determined in the wild-type and yda11 plants (Figure 4.2A). However, the fungal biomass detected in yda1 +/- yda11 -/+ plants was lower than that of agb1-2 mutant, included as hypersusceptible control (Figure 4.2A). The determination of the DR at latter dpi also showed that yda1 +/- yda11 -/+ plants were more susceptible to the fungus than the wild-type plants (Figure 4.2B), further corroborating that yda11 was a novel mutant allele of YDA. As it has been described that mutations in YDA alter stomatal patterning (Bergmann et al., 2004), the stomatal density and index were characterized in yda11 and yda1 +/- yda11 -/+ plants and compared with those of wild-type plants. The stomatal density and index of the hemizygous plants were higher than those of wild-type plants and very similar to those determined in yda11 mutant (Figure 4.2C, D). Also, we found that the yda1 +/- yda11 -/+ plants showed an erecta-like phenotype similar to that of the yda11 parental line, but this phenotype was more severe, resulting in smaller plants with significantly reduced pedicel and silique lengths in comparison to wild-type plants (Figure 4.2E, F, G). All these data confirmed that elk2/yda11 corresponded to an hypomorphic mutant allele of YDA gene. 65

86 Results A C Stomatal density PcBMM β-tubulin (n-fold WT) dpi e d c b a Col-0 yda11 yda1+/- yda11-/+ agb1-2 irx1-6 a b c B D Disease rating Stomatal index (%) d 8 dpi cd c b a Col-0 yda11 yda1 +/- yda11 -/+ agb1-2 irx1-6 a b b E Plant height (cm) c b a F Pedicel lenght (mm) c b a G Silique lenght (mm) c Col-0 b yda11 a yda1 +/- yda11 -/+ Col-0 yda11 yda1 +/- yda11 -/+ Figure 4.2. elk2/yda11 is a new allele of YDA. (A-B) Resistance of the yda11 and yda1 +/- yda11 -/+ mutants to the necrotrophic fungus PcBMM. (A) PcBMM quantification by qpcr at 5 dpi. Values are represented as the average (± standard error, SE) of the n-fold increased expression compared with wild-type plants. (B) Average disease ratings (DR ± SE) of the indicated genotypes at 8 dpi. DR varies between 0 (no symptoms) and 5 (dead plant). (C-D) Stomatal density and index of fully expanded leaves from wild-type, yda11 and yda1 +/- yda11 -/+ plants. (E) Morphometric analysis of the indicated genotypes. (F) Phenotype of six-week-old plants and (G) mature siliques and attached pedicels of the indicated genotypes. Letters represent values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test). Data are from one out of three independent experiments, which gave similar results. 66

87 Results 4.2. Expression of the constitutively active YDA protein (CA-YDA) confers enhanced resistance to PcBMM The deletion of amino acids 184 to 322 of the N-terminal region of YDA has been shown to constitutively activate YDA MAP3K function (CA-YDA protein, Figure 4.1B; Bergmann et al., 2004; Lukowitz et al., 2004). Moreover, constitutive expression of CA-YDA in yda mutant background has been demonstrated to suppress the yda developmental-associated phenotypes and to result in plants with developmental features that are opposite to those of yda mutants (Bergmann et al., 2004; Lukowitz et al., 2004). To further characterize the function of YDA in Arabidopsis resistance to PcBMM and immunity, we generated the CA-YDA and CA-YDA yda11 lines in Col-0 background by crossing five consecutive times the previously described CA-YDA plants (in La-0 background) with Col-0 and yda11 plants. All the CA-YDA plants generated shared a number of specific phenotypes with the previously described CA- YDA lines in La-0 background (Bergmann et al., 2004; Lukowitz et al., 2004), such as round and curly rosette leaves, increased height of the main stem, long and spindly inflorescence axis, elongated pedicels and curved siliques (Figure 4.3). Notably, the yda11 developmental phenotype was suppressed in the CA-YDA yda11 line, as previously described for some developmental features in the CA-YDA yda1 line (Bergmann et al., 2004). To determine whether the constitutive activation of YDA had an effect on Arabidopsis innate immunity and resistance to PcBMM, wild-type plants (from the Col-0 and La-0 genotypes), the yda11 mutant, the CA-YDA expressing lines in Col-0, La-0, yda11 and er-1 (La- 0) backgrounds (CA-YDA, CA-YDA yda11, and CA-YDA er-1, respectively), as well as the hypersusceptible agb1-2 and resistant irx1-6 mutants, included as controls, were grown on soil for eighteen days and then sprayed with either water (mock) or a spore suspension of the fungus (4x10 6 spores/ml). Fungal biomass was determined at 5 dpi by qpcr of PcBMM β- tubulin DNA. Remarkably, all the inoculated CA-YDA lines were found to be significantly more resistant to the fungus than the corresponding wild-type plants and mutants, as fungal biomass was lower than that of the corresponding control genotype (Figure 4.4A). Moreover, the expression of CA-YDA in yda11 and er-1 mutants restored their hypersusceptible phenotypes to the resistance level observed in wild-type plants (Col-0 and La-0, respectively; Figure 4.4A, B). These data indicated that YDA plays an essential role in the resistance of Arabidopsis to PcBMM and that its constitutive activation resulted in an enhanced resistance to this fungus. 67

88 Results A B C D WT CA-YDA yda11 CA-YDA yda11 WT CA-YDA er-1 CA-YDA er-1 Col-0 La-0 Figure 4.3. Developmental phenotypes of lines expressing CA-YDA in Col-0, La-0 and er-1 backgrounds. Rosettes of four-week-old plants (A), inflorescence apex (B) of 45-day-old plants (C) and mature siliques with attached pedicels (D) from the indicated genotypes are showed. 68

89 Results A PcBMM β-tubulin (n-fold WT) d c b a ab ab WT yda11 CA-YDA CA-YDA yda11 agb1-2 irx1-6 5 dpi c ab b a WT CA-YDA er-1 CA-YDA er-1 B Disease rating d 5 8 dpi cd 4 c 3 b b 2 a a a a 1 a 0 WT yda11 CA-YDA CA-YDA yda11 agb1-2 irx1-6 WT CA-YDA er-1 CA-YDA er-1 Col-0 La-0 Col-0 La-0 C Col-0 CA-YDA yda11 CA-YDA yda11 agb1-2 irx1-6 La-0 CA-YDA er-1 CA-YDA er-1 PcBMM Mock 8 dpi Figure 4.4. Resistance of CA-YDA plants to the necrotrophic fungus PcBMM. (A) PcBMM quantification by qpcr at 5 dpi. Values are represented as the average (± SE) of the n-fold increased expression compared with wild-type plants (Col-0 or La-0). Letters indicate values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test). (B) Average disease ratings (DR ± SE) of the indicated genotypes at 8 dpi. DR varies between 0 (no symptoms) and 5 (dead plant). (C) Disease symptoms of the indicated genotypes at 8 dpi. Data (A-C) are from one out of three independent experiments, which gave similar results Expression of CA-YDA confers broad-spectrum resistance to pathogens With the aim of further ascertaining the specificity of YDA in the regulation of Arabidopsis defensive responses to pathogens, we tested the resistance of CA-YDA lines and yda11 plants to a broader range of pathogens with different mechanisms of colonization, including: i) the biotrophic fungal pathogens Golovinomyces orontii and Erysiphe cruciferarum, causal agents of powdery mildew disease; ii) two different isolates (Noco2 and Cala2) of the biotrophic oomycete Hyaloperonospora arabidopsidis, causing the downy mildew disease; and iii) the hemibiotrophic bacterium Pseudomonas syringae pv. tomato DC

90 Results Resistance of CA-YDA plants to powdery mildew disease Eighteen-day-old plants of the wild-type (Col-0 and La-0), yda11, CA-YDA, CA-YDA yda11, er-1 and CA-YDA er-1 genotypes, and of the eds1-2 and sid2-2 mutants included as susceptible controls (Aarts et al., 1998; Wildermuth et al., 2001) were inoculated with a conidia suspension of G. orontii, at a density of about 750 spores/cm 2. Tissues from each genotype were harvested at 6 dpi, and the spores of the fungus were extracted, concentrated and counted. As shown in Figure 4.5A, all the CA-YDA lines showed a significant reduction in the number of spores per milligram of fresh weight relative to those observed in wild-type genotypes or in er-1 mutant, while the amount of spores in yda11 plants was higher than that in the Col-0 wild-type plants and similar to that of the susceptible sid2-2 mutant. These data indicated that YDA was required for resistance to G. orontii and that the constitutive activation of YDA confers enhanced resistance to this biotrophic fungus. The same lines were also examined for successful fungal host cell entry at 24 hours post-inoculation (hpi), which is considered as a measurement of the capacity of the plant to avoid fungal penetration and haustorium formation. CA-YDA (Col-0) and CA-YDA er-1 revealed wild-type-like fungal entry rates, whereas CA-YDA yda11 and CA-YDA (La-0) showed significantly reduced penetration rates (Figure 4.5B). Remarkably, the penetration rate of yda11 mutant was enhanced compared to that of wild-type plants and was very similar to that of the eds1-2 mutant, that is defective in mounting the defensive response to control fungal penetration (Dewdney et al., 2000; Bartsch et al., 2006), suggesting a role of YDA in this defensive response. To further confirm the relevance of YDA in Arabidopsis resistance to powdery mildew, the above indicated genotypes, and the agb1-2 and mlo2/6/12 mutants, included as susceptible and resistant controls respectively (Consonni et al., 2006; Lorek et al., 2013), were inoculated with a different isolate, E. cruciferarum, which colonize Arabidopsis plants growing in CBGP greenhouses. Leaf tissues of the inoculated plants were harvested at 24 hpi and trypan blue staining was carried out to visualize the initial steps of the infection process. CA- YDA lines were found to be more resistant to fungal colonization than the mlo2/6/12 plants, a triple mutant that is highly resistant to powdery mildew infection (Consonni et al., 2006), as in CA-YDA leaves fungal spores germinated, but they did not form appressorium or haustorium, whereas in mlo2/6/12 the appressorium and haustorium were formed upon spore germination, but hyphae growth was inhibited (Figure 4.5C). The progression of the infection in these inoculated plants was followed during ten days and we did not find any fungal colony 70

91 Results in the leaves of CA-YDA plants (Col-0, La-0 and er-1 background) or in those of mlo2/6/12 plants, whereas fungal sporulation was observed in wild-type, yda11 and er-1 plants (data not shown). These data confirmed that the expression of CA-YDA in Arabidopsis confers resistance to powdery mildew disease and that the mechanism of resistance mediated by YDA might be different from those previously described for MLO genes. A Conidiospores (x10 5 )/mg FW * * * * * * * * C Col-0 La-0 yda11 CA-YDA B Penetration rate (%) * * * er-1 CA-YDA er-1 50 WT yda11 CA-YDA CA-YDA yda11 Col-0 eds1-1 sid2-2 WT CA-YDA er-1 La-0 CA-YDA er-1 24 hpi agb1-2 mlo2/6/12 Figure 4.5. Analysis of the resistance of CA-YDA plants to powdery mildew infection. (A) Spore count per mg of fresh weight and (B) penetration rates of fungal spores at 6 dpi and 24 hpi, respectively, in the indicated genotypes inoculated with G. orontii. Bars represent the mean ± standard deviation (SD) of three samples (200 mg of seedlings each) from one experiment counting eight fields per sample. Asterisks indicate statistically significant differences from wild-type, from yda11 and from er-1 plants based on Student s t-test (p < 0.05). (C) Trypan blue staining of leaves of the indicated genotypes at 24 hpi with the isolate E. cruciferarum CBGP1. Scale bars represent 50 µm. 71

92 Results Resistance of CA-YDA plants to Hyaloperonospora arabidopsidis To evaluate the response of CA-YDA lines to the biotrophic oomycete H. arabidopsidis (Hpa), the causal agent of downy mildew, we carried out inoculations of plants with two different isolates of the pathogen: i) the Noco2 isolate, which is virulent on Arabidopsis ecotype Col-0, as it lacks the RPP5 gene conferring resistance to this isolate, present in La-0 ecotype (Parker et al., 1993); and ii) the Cala2 isolate, which is virulent on La-0, as it lacks the RPP2 gene present in Col-0 ecotype (Holub et al., 1994; Sinapidou et al., 2004). Two-week-old plants from the Col-0, La-0, yda11, er-1 and CA-YDA genotypes were inoculated with a conidia suspension (2x10 4 spores/ml) of the corresponding Noco2 and Cala2 isolates. The NahG transgenic plants and cpr5 mutant, with alterations in salicylic acid (SA) pathway, were included as susceptible and resistant controls, respectively, in the Noco2 assays (Lawton et al., 1995; Bowling et al., 1997), while the eds1-2 mutant and Col-0 plants were included in the Cala2 assays as susceptible and resistant controls, respectively (Aarts et al., 1998). Colonization of inoculated plants by Hpa was evaluated at 7 dpi by harvesting plants from the different genotypes and counting the number of conidiospores per gram of fresh weight (FW). We found out that in yda11 mutant the value of conidiospores/gram of FW was higher than that in Col-0 wild-type plants, and that this susceptibility phenotype was restored to wild-type levels by expression of CA-YDA protein in yda11 background, since these plants were as susceptible as Col-0 (Figure 4.6A). However, the expression of CA-YDA in Col-0 background did not result in a significant enhanced resistance to Hpa, since the number of conidiospores/gram of FW was similar in CA- YDA and Col-0 plants (Figure 4.6A). Cala2 inoculations revealed an enhanced value of conidiospores/gram of FW in er-1 mutant line, but this value was not significantly different from that of wild-type La-0 plants (Figure 4.6B). In contrast, a reduction of pathogen sporulation on CA-YDA (La-0 background) was evident, and this reduction was stronger on CA- YDA er-1 plants (Figure 4.6B). Trypan blue staining of infected leaves was carried out in Cala2 inoculated plants to visualize pathogen growth, and we found trailing necrosis staining in the leaves of the CA-YDA and CA-YDA er-1 plants, which further indicated that the oomycete hyphae were unable to expand through the leaves, corroborating the enhanced resistance of these plants to Hpa colonization (Figure 4.6C). Of note, the yda11 mutant was not affected in gene for gene resistance, and it was able to mount an HR similar to that of the parental, resistant Col-0 plants (Figure 4.6B, C). Together these data indicate that the constitutive activation of YDA reduces the susceptibility of Arabidopsis to Hpa infection. 72

93 Results A 6 Noco2 d B 4.0 Cala2 e Spores (x10 2 )/g FW b ab c b a Spores (x10 6 )/g FW bc ab c a a a Col-0 CA-YDA yda11 CA-YDA yda11 NahG cpr5 WT CA-YDA er-1 La-0 CA-YDA er-1 WT yda11 eds1-2 Col-0 C WT er-1 WT h HR h CA-YDA CA-YDA er-1 yda11 TN TN HR La-0 Col-0 Figure 4.6. CA-YDA plants show an enhanced resistance to the oomycete H. arabidopsidis (Hpa). (A) Infection assay with virulent Noco2 isolate. Numbers of conidiospores per gram (g) of leaf fresh weight (FW) were measured at 7 dpi. (B) Growth of Hpa Cala2 on the indicated genotypes. Conidiospore count was performed at 7 dpi. Letters indicate genotypes with significant differences in their level of resistance (ANOVA p < 0.05, Bonferroni Test). (C) Trypan blue staining of Cala2 inoculated leaves at 7 dpi. Bar represents 200 µm. HR, hypersensitive response; h, hyphae; TN, trailing necrosis. 73

94 Results Resistance of CA-YDA plants to P. syringae pv. tomato DC3000 To test whether increased resistance of the CA-YDA lines extended to hemibiotrophic pathogens, we infected plants with a virulent strain (DC3000) of the bacterial pathogen P. syringae pv. tomato (Pto). Eighteen-day-old plants from the wild-type (Col-0 and La-0), yda11, CA-YDA (in Col-0 and La-0 backgrounds), CA-YDA yda11, er-1 and CA-YDA er-1 genotypes were spray-inoculated with a bacterial suspension of Pto DC3000 (OD ). Plants from fls2 and cpr5 mutants were included as susceptible and resistant controls, respectively, and were inoculated with the bacterium. Leaf samples of the inoculated genotypes were collected at 2 and 4 dpi, and colony forming units per cm 2 of infected leaf were determined. As shown in Figure 4.7, CA-YDA lines were more resistant than their corresponding wild-type plants (Col-0 and La-0) or mutants (yda11 and er-1), as they supported lower cfu/cm 2. Bacterial growth in the yda11 mutant was quite similar to that of Col-0 wild-type plants, indicating that yda11 is not defective in resistance to this pathogen (Figure 4.7A). Macroscopic disease symptoms in inoculated CA-YDA and CA-YDA er-1 plants (La-0 background) were found to be reduced in comparison to those of La-0 and er-1 plants, although bacterial growth in CA-YDA plants was found to be just slightly reduced compared with those determined in La-0 and er-1 (Figure 4.7A, 4.7B). These results indicate that expression of CA-YDA protein in wild-type, yda11 and er-1 plants confers enhanced resistance to the virulent bacterium Pto DC3000. All together, the results obtained in the analyses of resistance of CA-YDA plants to all the pathogens tested support the conclusion that constitutive activation of YDA confers broadspectrum resistance to different pathogens with distinct colonization styles, and therefore that YDA is a master regulator of Arabidopsis innate immunity and resistance to pathogens. 74

95 Results A dpi 4 dpi Log cfu/cm * * * * WT CA-YDA yda11 CA-YDA yda11 fls2 cpr5 WT CA-YDA er-1 CA-YDA er-1 Col-0 La-0 B Col-0 yda11 fls2 La-0 er-1 CA-YDA CA-YDA yda11 cpr5 CA-YDA CA-YDA er-1 Figure 4.7. Constitutive activation of YDA confers resistance to the hemibiotrophic bacterium P. syringae pv. tomato DC3000 (Pto DC3000). (A) Quantification of bacterial growth on plants from the indicated genotypes after spray inoculation with the virulent bacterial strain Pto DC3000. Bacterial colony forming units (cfu) per cm 2 of leaf were determined at 2 and 4 dpi. Values are means ± SE. Asterisks indicate significant differences compared to wild-type plants at p < 0.05 (Student s t-test). indicates significant differences compared to yda11 plants, and indicates significant differences compared to er-1 plants (p < 0.05, Student s t-test). (B) Disease symptoms of Pto DC3000-inoculated plants at 7 dpi. Data are from one out of three independent experiments, which gave similar results. 75

96 Results 4.4. YDA and ER RLK define a novel immune pathway YDA has been described as a downstream component of the signalling pathway mediated by ER and its paralogs ERL1 and ERL2 (the ER family, ERf; Shpak, 2013), which is in line with the erecta-like phenotype of yda mutants. However, genetic and biochemical validation of this hypothesis has not been fully contrasted, since er yda double mutants have not been generated so far. Moreover, the yda11 mutant is altered in its resistance to different pathogens (including PcBMM and Hpa), and this phenotype further supports the hypothesis that YDA is a component of the defensive signalling pathway mediated by ER, since this RLK is required for resistance to these pathogens (Figures 4.4 and 4.6; Llorente et al., 2005) as well as the bacterium R. solanacearum, the fungus V. longisporum and the oomycete P. irregulare (Godiard et al., 2003; Adie et al., 2007; Häffner et al., 2014). To test whether ER and YDA are components of the same immune pathway, we first generated the yda11 er105 double mutant by crossing yda11 allele with the loss of function er105 mutant (in Col-0 background), and selecting the double mutant plants in the F2 progeny by allele-specific PCR amplifications and enzymatic digestion of the amplified DNA fragments (Section 3.15, Materials and Methods). Then, the susceptibility to PcBMM of the selected yda11 er105 plants was analysed: Col-0, yda11, er105 and yda11 er105 plants were grown on soil for eighteen days and then sprayed with a spore suspension of the fungus (4x10 6 spores/ml), and fungal biomass and DR were determined at different time points. The agb1-2 and irx1-6 mutants were included in the experiments as hypersusceptible and resistant controls, respectively. As shown in Figure 4.8A, fungal biomass quantification revealed that the susceptibility of the double mutant yda11 er105 to PcBMM was comparable to that of the parental line yda11, and slightly higher than that of the susceptible er105 plants. Determination of DR at different dpi further corroborated that there was no statistical difference between the resistance to PcBMM of yda11 er105, yda11 and er105 plants (Figure 4.8B, C). These results indicate that there is an epistatic, genetic interaction between ER and YDA in the control of Arabidopsis resistance response to PcBMM, and therefore that ER and YDA are components of the same immune pathway, as previously suggested for developmental signalling (Wang et al., 2007; Meng et al., 2012; Bemis et al., 2013). 76

97 Results A PcBMM β-tubulin (n-fold WT) dpi b d c d e a B Disease rating dpi b c c c d a Col-0 yda11 er105 yda11 er105 agb1-2 irx1-6 Col-0 yda11 er105 yda11 er105 agb1-2 irx1-6 C Col-0 yda11 er105 yda11 er105 agb1-2 irx1-6 Mock PcBMM 10 dpi Figure 4.8. ER and YDA are components of the same immune pathway required for resistance to the necrotrophic fungus PcBMM. (A) PcBMM quantification by qpcr at 5 dpi. Values are represented as the average (± SE) of the n-fold increased expression compared with wild-type plants. Letters indicate values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test). (B) Average disease ratings (DR ± SE) of the indicated genotypes at 7 dpi. DR varies between 0 (no symptoms) and 5 (dead plant). (C) Disease symptoms of the indicated genotypes at 8 dpi. Data are from one out of three independent experiments, which gave similar results. 77

98 Results 4.5. ER-YDA pathway regulates ER-associated developmental processes ER regulates organ shape and inflorescence architecture, and thus loss-of-function er mutants show a compact inflorescence with short internodes and clustered flower buds, short pedicels, round flowers, and short, blunt siliques (Bowman, 1994; Torii et al., 1996; Shpak et al., 2003). Recent studies have suggested that YDA function in a MAPK cascade downstream of the ER receptor in regulating cell proliferation within the pedicel cortex and thereby determining inflorescence architecture (Meng et al., 2012). Moreover, it has been shown that mutations in ER and YDA disrupt stomatal patterning and result in the formation of clustered stomata (Bergmann et al., 2004; Shpak et al., 2005; Wang et al., 2007), and that ER, together with ERf members, act as negative regulators of stomatal development (Shpak et al., 2005). However, the extremely dwarfed phenotypes or the embryo lethality of the previously described yda alleles have hindered the possibility to perform more detailed studies to determine the implication of YDA in the ER-regulated developmental parameters. We took advantage of the viability of yda11 mutant and the yda11 er105 double mutant generated to study the interaction between YDA and ER in plant development. We performed morphometric analyses and stomatal patterning, plant height, pedicel and silique length, and inflorescence architecture were analysed in Col-0, yda11, er105 and yda11 er105 plants. We found that YDA and ER genetically interact in the control of stomatal pattern development as stomatal index and density were similar in yda11 er105 double mutant and in single mutants (Figure 4.9A). The epidermal patterning of fully expanded leaves from er105 plants confirmed the existence of characteristic patches of two or three small stomatal-lineage ground cells that failed to differentiate into stomata, which were surrounded by larger pavement cells, as previously described (Figure 4.9B; Shpak et al., 2005). Of note, stomatal cluster formation occurred in both yda11 and yda11 er105 mutants, which further support the role of YDA in the regulation of this developmental process (Figure 4.9B). In other developmental-associated patterns such as inflorescence morphology, silique length and plant height, we found an additive rather than epistatic effect between yda11 and er105 mutations, as double mutant plants were significantly smaller and had shorter siliques and pedicels than the parental single mutants (Figure 4.9C, D). Consistent with this additive effect of yda11 and er105 mutations, yda11 er105 plants exhibited a more severely clustered flower phenotype (Figure 4.9E). These results indicate that ER and YDA genetically interact in the regulation of stomatal development whereas their interaction in the control of other developmental processes is additive, and more complex than previously anticipated. 78

99 Results A Stomatal density Stomatal index (%) a a Col-0 b c yda11 b b er105 b c yda11 er105 C D E Plant height (cm) d c b a Silique length (cm) B d Col-0 er105 b c a yda11 yda11 er105 Col-0 yda11 Col-0 yda11 er105 yda11 er105 Col-0 yda11 er105 yda11 er105 er105 yda11 er105 Figure 4.9. YDA and ER genetically interact in the regulation of plant development. (A) Stomatal density and index in rosette leaves of wild-type plants, yda11, er105 and yda11 er105 mutants. (B) Epidermal patterning in the abaxial surface of 25-day-old rosette leaves from the indicated genotypes. Scale bar = 50 µm (C) Plant height determined in 45-day-old plants, (D) silique length and morphology, and (E) inflorescence apices from wild-type, yda11, er105 and yda11 er105 plants. Letters in A, C and D indicate values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test) YDA is not a molecular component of the immune pathways mediated by CERK1 and FLS2 PRRs FLS2 and CERK1 are well-characterized Arabidopsis PRRs that regulate immune responses through the recognition of bacterial flg22 and fungal chitin PAMPs, respectively. The fls2 and cerk1 mutants are defective in the perception of these specific PAMPs, do not show activation of PTI responses upon PAMP treatment, and display an enhanced susceptibility phenotype to 79

100 Results bacterial and fungal infection, respectively (Zipfel et al., 2004; Wan et al., 2008). Some molecular components functioning downstream FLS2 and CERK1 have been characterized, however the identity of the MAP3K(s) that might function upstream the MAPK module MKK4/MKK5-MPK3/MPK6 in the immune pathways regulated by FLS2 and CERK1 is still unclear (Figure 1.4; Bigeard et al., 2015). As the yda11 plants showed an enhanced susceptibility to fungi and bacteria, we hypothesized that YDA might be a component of the immune pathways mediated by CERK1 and FLS2, and therefore we generated the yda11 fls2 and yda11 cerk1-2 double mutants to test genetically this hypothesis. The susceptibility of the yda11 cerk1-2 double mutant to PcBMM was analysed by inoculating eighteen-day-old plants of the Col-0, yda11, cerk1-2, yda11 cerk1-2, agb1-2 and irx1-6 genotypes with a spore suspension (4x10 6 spores/ml) of the fungus. Fungal biomass was determined at 5 dpi by qpcr and DRs were macroscopically evaluated at different time points. The cerk1-2 mutant was found to be as susceptible to PcBMM as Col-0 plants, which contrasts with its previously described enhanced susceptibility to other fungal pathogens (Miya et al., 2007; Wan et al., 2008), whereas the yda11 cerk1-2 double mutant was more susceptible than yda11 plants, but less susceptible than the hypersusceptible agb1-2 plants (Figure 4.10A). These data indicated an additive effect of CERK1 and YDA on the resistance to PcBMM, further suggesting that YDA and CERK1 probably do not form part of the same immune pathway. Similarly, we analysed the genetic interaction between YDA and FLS2 by generating the yda11 fls2 double mutant and determining its susceptibility to the hemibiotrophic bacterium Pto DC3000. Eighteen-day-old plants of the wild-type, yda11, fls2, and yda11 fls2 genotypes and of the resistant cpr5 mutant, included as control, were spray-inoculated with a bacterial suspension (OD ), and the cfu/cm 2 in infected leaves were determined at 2 and 4 dpi. The yda11 fls2 double mutant displayed an increased susceptibility compared to that of the wildtype plants and the susceptible yda11 single mutant, as indicated by its enhanced bacterial growth at both time points (Figure 4.10B). However, bacterial growth in the double mutant was just slightly, but not significantly, higher than that determined in the susceptible fls2 plants (Figure 4.10B). These results suggested that YDA and FLS2 might act independently in basal defense against P. syringae. 80

101 Results A PcBMM β-tubulin (n-fold WT) dpi 7 dpi 2 dpi d 4 dpi d c b b 5.5 c a 2 a 5.0 b 4.5 a a a Disease rating Col-0 yda11 cerk1-2 yda11 cerk1-2 agb1-2 irx1-6 Col-0 yda11 cerk1-2 yda11 cerk1-2 agb1-2 irx1-6 Col-0 yda11 fls2 yda11 fls2 cpr5 B Log cfu (Pto DC3000)/cm 2 * * Figure YDA does not form part of the immunity pathways activated by the receptors CERK1 and FLS2. (A) Fungal biomass quantification at 5 dpi (left) and average DR (± SE) at 7 dpi (right) in wild-type plants and yda11, cerk1-2 and yda11 cerk1-2 mutants inoculated with PcBMM. The agb1-2 and irx1-6 mutants were included for comparison. Letters indicate genotypes with statistically different resistance to the fungus (ANOVA p < 0.05, Bonferroni Test). (B) Quantification of bacterial growth in wild-type plants and in the yda11, fls2 and yda11 fls2 mutants. The resistant cpr5 mutant was included for comparison. Asterisks indicate statistically significant differences compared to wild-type plants, while indicates significant differences compared to yda11 plants (p < 0.05, Student s t-test) yda11 is not impaired in PAMP perception and activation of PTI responses Recognition of PAMPs by PRRs leads to the activation of a number of PTI responses (Dodds and Rathjen, 2010), which include changes in ion fluxes across the plasma membrane, increase in cytoplasmic Ca 2+ concentration, ROS burst and activation of MAPKs and CDPKs, followed by massive transcriptional reprogramming, de novo synthesis of hormones, callose deposition and biosynthesis of antimicrobial compounds (Boller and Felix, 2009; Monaghan and Zipfel, 2012). The enhanced susceptibility of yda11 mutant to different pathogens led us to consider whether this phenotype could be explained by a deficient activation of some of the responses triggered by PAMPs from bacteria, fungi and oomycetes. To check this possibility, we performed a series of comparative analyses of PTI responses in wild-type and yda11 plants and took advantage of the yda11 cerk1-2, yda11 fls2 and yda11 er105 double mutants generated. 81

102 Results [Ca 2+ ] cyt after PAMP treatment is similar in yda11 and wild-type plants We first determined the changes in Ca 2+ concentration ([Ca 2+ ]) in wild-type, yda11 and er105 plants upon PAMP treatment and compared them with those of the hypersusceptible agb1-2 mutant, that shows an erecta-like phenotype and is impaired in PTI response (Ullah et al., 2003; Liu et al., 2013). [Ca 2+ ] can be monitored in vivo with the bioluminescent Ca 2+ -binding protein aequorin (Knight et al., 1991), which is composed of an apoprotein (apoaequorin) and a prosthetic group, the luminophore coelenterazine (Mithöfer and Mazars, 2002), that in the presence of Ca 2+ is converted into coelenteramide followed by light emission (Mithöfer and Mazars, 2002). The previously described transgenic line Col-0 AEQ (35S::Apoaequorin; Knight et al., 1991) expressing the apoaequorin protein in the cytosol, was crossed with yda11, er105 and agb1-2 plants, and the homozygous yda11 AEQ, er105 AEQ and agb1-2 AEQ plants were selected by measuring the luminescence emitted after applying 2M CaCl 2 to leaf discs from three-weekold plants and by allele-specific PCR amplification to confirm the yda11, er105 and agb1-2 backgrounds. Eight-day-old seedlings from Col-0 AEQ, yda11 AEQ, er105 AEQ and agb1-2 AEQ lines grown on liquid MS medium were incubated with coelenterazine over night in 96-well plates, and then the seedlings were treated with the PAMPs flg22, chitin, elf18 or Pep1, or with a ground extract of spores or mycelium from PcBMM. The cerk1-2 AEQ line was included as a negative control in those treatments of seedlings with chitin and PcBMM extracts (Ranf et al., 2015). Luminescence was recorded for 30 minutes after PAMP treatment, and then all remaining aequorin was discharged and [Ca 2+ ] was calculated (Section 3.8, Materials and Methods). Treatment of yda11 AEQ, er105 AEQ, agb1-2 AEQ and Col-0 AEQ lines with the spore extract of PcBMM did not result in significant differences between the [Ca 2+ ] cyt in the mutants and the wild-type plants (Figure 4.11A). Of note, the cerk1-2 AEQ line that was included as control was almost insensitive to this treatment, revealing that the main PAMP component of the PcBMM spore extract could be chitin. Similarly, all the lines displayed wild-type-like [Ca 2+ ] cyt elevations upon treatment with the mycelium extract, including cerk1-2 AEQ (Figure 4.11B). Upon treatment with 1 µm flg22, the yda11 AEQ and er105 AEQ plants showed an elevation in [Ca 2+ ] cyt that was similar to that of the Col-0 AEQ plants, with two Ca 2+ peaks at approximately 3 and 5 minutes after treatment (Figure 4.11D). Remarkably, the response of yda11 AEQ and er105 AEQ lines upon chitin, elf18 or Pep1 treatment did not differ from that of the Col-0 AEQ plants (Figure 4.11C, E, F), indicating that the perception of all the tested PAMPs is not impaired in these mutants. Interestingly, [Ca 2+ ] cyt elevations induced by flg22, elf18, Pep1 or chitin were partially reduced 82

103 Results in the agb1-2 AEQ plants (Figure 4.11C, D, E, F), suggesting a relevant role for AGB1 in the perception of these PAMPs or in the regulation of calcium channels. A [Ca 2+ ] cyt (µm) PcBMM spore extract WT yda11 er105 agb1-2 cerk1-2 B [Ca 2+ ] cyt (µm) PcBMM soluble mycelial extract WT yda11 er105 agb1-2 cerk1-2 C [Ca 2+ ] cyt (µm) E [Ca 2+ ] cyt (µm) Time (min) 60 ng µl -1 chitin WT yda11 er105 agb1-2 cerk Time (min) 1 µm elf18 WT yda11 er105 agb1-2 D [Ca 2+ ] cyt (µm) F [Ca 2+ ] cyt (µm) Time (min) µm flg22 WT yda11 er105 agb Time (min) µm Pep1 WT yda11 er105 agb Time (min) Time (min) Figure yda11 and er105 mutants are not impaired in the perception of PAMPs and DAMPs. Elevations of [Ca 2+ ] cyt in yda11 AEQ, er105 AEQ, agb1-2 AEQ and Col-0 AEQ seedlings upon treatment with crude extracts of PcBMM spores (A) or mycelium (B), or with the indicated PAMPs or DAMPs (C-F). Black arrows mark the time point of extract or PAMP/DAMP application. Data represent the mean ± SD of three independent experiments (n 24). The cerk1-2 AEQ line (Ranf et al., 2015) was included in A, B and C for comparison. 83

104 Results Phosphorylation of MPKs is not impaired in yda11 upon PAMP treatment Different PAMP- and DAMP-induced responses converge, at very early stages, in the activation of MAPK cascades and CDPKs, which play central roles in downstream PTI signalling transduction of signals from PRRs to intracellular components (Meng and Zhang, 2013). The phosphorylation of regulatory or catalytic proteins and transcription factors by MAPKs and CDPKs can control several processes, such as hormone signalling and transcriptional gene regulation (Meng and Zhang, 2013). In PTI, MPK3, MPK4, MPK6 and MPK11, which are the best characterized components of MAPK cascades, have been shown to be phosphorylated upon PAMP/DAMP treatment and plant infection by pathogens (Figure 1.4; Asai et al., 2002; Bethke et al., 2009, 2012). Given the results obtained with the [Ca 2+ ] cyt assays, we tested whether the activation of MPKs was altered in the yda11, er105 and yda11 er105 mutants upon PcBMM recognition. Twelve-day-old seedlings from the wild-type and the yda11, er105 and yda11 er105 mutants were grown on liquid MS medium, treated with a crude extract of PcBMM spores, and plant samples were harvested at different time points (0, 10, 20 and 30 minutes) after treatment. The phosphorylation status of MPK6, MPK3 and MPK4/11 at these time points was determined by Western blot using the anti-ptepy antibody, which specifically recognizes phosphorylation on Thr202 and Tyr204 residues of these MPKs (Section 3.9, Materials and Methods). The Western blot revealed a reduced phosphorylation of these MPKs in er105 mutant compared to wild-type seedlings (Figure 4.12A), whereas the phosphorylation in yda11 mutant did not differ from that of wild-type plants, and that of yda11 er105 seedlings showed a slight reduction compared to wild-type plants phosphorylation (Figure 4.12A). Taken together, these results suggested that yda11 is not impaired in MPKs phosphorylation upon PcBMM recognition whereas ER shows a partial reduction of MPKs phosphorylation, suggesting that ER might be required for the perception of PAMP(s) derived from PcBMM, which is in line with the proposed role of ER as PRR receptor or co-receptor of PcBMM PAMP(s) (Llorente et al., 2005; Sánchez-Rodríguez et al., 2009). Similarly, seedlings from the wild-type and the yda11, cerk1-2 and yda11 cerk1-2 mutants were treated with the PcBMM spore extract, and we found that the phosphorylation of MPK3, MPK6 and MPK4/11 in cerk1-2 and yda11 cerk1-2 mutants, compared with that of wild-type plants, was delayed and severely impaired, but not completely disrupted, indicating that the most abundant PAMP of PcBMM spore extract might be chitin (Figure 4.12B), as suggested by the data obtained with the cerk1-2 AEQ plants (Figure 4.11). 84

105 Results We next analysed MPKs phosphorylation in yda11 mutant upon flg22 treatment, and twelve-day-old seedlings grown in vitro from the wild-type plants and the yda11, fls2, and yda11 fls2 mutants were treated with 1 µm flg22 and samples were harvested at different time points (0, 10, 20 and 30 minutes after elicitation) to determine the phosphorylation of MPKs by Western blot. We found that MPKs phosphorylation in yda11 mutant was comparable to that of the wild-type seedlings, whereas phosphorylation was abolished in fls2 mutant, as expected, and in the yda11 fls2 double mutant (Figure 4.12C), further confirming that yda11 mutant is not impaired in flg22 perception and flg22-triggered immunity. A PcBMM spores B PcBMM spores C flg22 (1 µm) Col-0 yda11 er105 yda11 er Col-0 yda11 cerk1-2 yda11 cerk Col-0 yda11 fls2 yda11 fls min MPK6 MPK3 MPK4/11 Amido black min MPK6 MPK3 MPK4/11 Amido black min MPK6 MPK3 MPK4/11 Amido black Figure yda11 mutant is not impaired in MAPK activation upon PAMP treatment. (A-B) Immunoblot analysis of phosphorylated MAPKs (MPK6, MPK3, MPK4/11) after treatment with a crude extract of PcBMM spores in wild-type, yda11, er105 and yda11 er105 seedlings (A), or in wild-type, yda11, cerk1-2 and yda11 cerk1-2 seedlings (B). Phosphorylation was determined at the indicated time points by using the anti-ptepy antibody. (C) Immunoblot analysis of phosphorylated MAPKs after application of 1 µm flg22 in wild-type, yda11, fls2 and yda11 fls2 seedlings. Amido black-stained membranes show equal loading. For each combination, three independent experiments were performed that gave comparable results. 85

106 Results YDA and MPK3 genetically interact to regulate PTI and resistance to PcBMM The phosphorylation analyses demonstrated that upon PAMP treatment MPK3 and MPK6 were similarly phosphorylated in yda11 and wild-type plants. However, it has been proposed that in stomatal development and patterning YDA was part of a MAPK signalling module including the functionally redundant MKK4 and MKK5, and the MPKs MPK3 and MPK6 (Wang et al., 2007), and therefore it would be expected that MPK3/MPK6 phosphorylation might be impaired in yda11 plants (Figure 4.12). This MKK4/MKK5-MPK3/MPK6 module has also been involved in regulating defensive responses in Arabidopsis (Asai et al., 2002), but the MAP3K acting upstream these MKKs/MPKs has not been clearly assigned possibly due to functional redundancy and/or lethality observed in mpk3 mpk6 and mkk4 mkk5 double mutants (Wang et al., 2007). To determine whether YDA might function upstream of MKK4/MKK5-MPK3/MPK6 module in regulating innate immunity responses, we crossed yda11 and the knockout mpk3- DG (mpk3 thereafter) and mpk6-2 mutants to generate the yda11 mpk3 and yda11 mpk6-2 double mutants. The yda11 mpk3 plants were generated, whereas the yda11 mpk6-2 double homozygous plants resulted to be sterile and did not produce seeds, and therefore we could not perform any further analyses with these yda11 mpk6-2 plants. Twelve-day-old seedlings from wild-type plants and the yda11, mpk3 and yda11 mpk3 mutants were grown on liquid MS medium and treated with a crude extract of PcBMM spores. Seedlings samples were harvested at 0, 10, 20 and 30 minutes after treatment and the phosphorylation of MPKs was determined by Western blot. We found that the phosphorylation of MPK6 and MPK4/11 in yda11 mpk3 mutant was slightly higher than that of wild-type plants, but did not differ from the phosphorylation pattern observed in yda11 and mpk3 seedlings (Figure 4.13A). To further clarify the function of YDA in the regulation of the MAPK phosphorylation cascade, we tested the resistance to PcBMM of yda11 mpk3 plants. Eighteen-day-old plants from the wild-type, yda11, mpk3, and yda11 mpk3 genotypes, as well as agb1-2 and irx1-6 control mutants, were spray-inoculated with a spore suspension (4x10 6 spores/ml) of PcBMM, and fungal biomass and disease ratings were determined at different time points. As shown in Figure 4.13B, mpk3 plants were more susceptible to PcBMM than the wild-type plants, and remarkably, fungal quantification in yda11 mpk3 double mutant was similar to that of the yda11 parental line, but higher than that of the mpk3 mutant. However, at latter dpi, the disease rating of the double mutant tended to be slightly higher than that of the corresponding single mutants, although no statistical differences were found (Figure 4.13C, D). 86

107 Results A PcBMM spores Col-0 yda11 mpk3 yda11 mpk min MPK6 MPK3 MPK4/11 Amido black B PcBMM β-tubulin (n-fold WT) 30 4 dpi d c c 5 b a a 0 Col-0 yda11 mpk3 yda11 mpk3 agb1-2 irx1-6 C Disease rating dpi c b Col-0 yda11 c mpk3 d yda11 mpk3 e agb1-2 a irx1-6 D Col-0 yda11 mpk3 yda11 mpk3 agb1-2 irx1-6 PcBMM Mock 10 dpi Figure YDA-mediated MAPK cascade involves MPK3. (A) Immunoblot analysis of phosphorylated MPK6, MPK3 and MPK4/11 in wild-type, yda11, mpk3 and yda11 mpk3 seedlings at indicated time points after treatment with a spore extract of PcBMM. Amido black-stained membranes show equal loading. (B) Fungal biomass quantification by qpcr at 4 dpi of wild-type plants and yda11, mpk3 and yda11 mpk3 mutants inoculated with a spore suspension of PcBMM. Values are represented as the average (± SE) of the n-fold increased expression compared with wild-type plants. (C) Average disease ratings (DR ± SE) of the indicated genotypes at 10 dpi. DR varies between 0 (no symptoms) and 5 (dead plant). (D) Disease symptoms of the indicated genotypes at 10 dpi. Letters (B-C) indicate values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test). Data are from one out of three independent experiments, which gave similar results. 87

108 Results These results indicated that despite MPK3 phosphorylation does not seem to be impaired in yda11 mutant, MPK3 and YDA might form part of the same immune signalling pathway and suggested that the kinase module MKK4/MKK5-MPK3/MPK6 was common to innate immune and stomatal patterning pathways regulated by YDA Expression of PTI marker genes is not impaired in yda11 plants To determine the transcriptional modulation of PTI-regulated genes in yda11 mutant, we measured by qrt-pcr the expression levels of specific PAMP-induced genes at different time points after treatment with flg22 and chitin. Ten-day-old wild-type, yda11, fls2 and yda11 fls2 seedlings grown in vitro were treated with 2.5 µm flg22 and samples were harvested at 0 and 30 minutes after elicitation. The flg22-induced RLK FRK1, the cytochrome P450 monooxygenase CYP81F2, the phosphate induced gene PHI-1, the NDR1/HIN1-like gene NHL10, and the transcription factor WRKY33 were selected for the analysis (Li et al., 2009; Boudsocq et al., 2010). We found out that the expression of FRK1, CYP81F2 and NHL10 was similarly induced in yda11 and wild-type plants (Figure 4.14A), whereas the expression of PHI-1 was slightly higher in yda11 than in wild-type plants and the expression of WRKY33 was weakly diminished in yda11 compared to the wild-type plants. The induction of these five genes upon flg22 treatment was impaired in fls2 and yda11 fls2 mutants (Figure 4.14A). Similarly, ten-day-old wild-type, yda11, cerk1-2 and yda11 cerk1-2 seedlings grown in vitro were treated with 200 µg/ml of the fungal PAMP chitin, samples were harvested at 0 and 45 minutes and the expression of the above mentioned PTI genes was analysed. We found that the chitin-mediated induction of these five genes was not defective in yda11 plants and that the expression of FRK1 and WRKY33 was slightly higher in yda11 than in wild-type plants, whereas the expression of CYP81F2 and NHL10 was slightly lower in the mutant compared to the wild-type plants (Figure 4.14B). PHI-1 levels in yda11 were indistinguishable from those of the wild-type seedlings. The induction of these five genes upon chitin treatment was blocked in cerk1-2 mutant, which is defective in chitin perception (Miya et al., 2007; Wan et al., 2008), and also in the yda11 cerk1-2 double mutant (Figure 4.14B). All together these data further indicate that YDA is not a molecular component of the previously described immune pathways regulated by FLS2 and CERK1 PRRs. 88

109 Results A 5 FRK1 30 PHI-1 12 CYP81F2 NHL10 14 WRKY33 30 Relative expression (n-fold T0) B Relative expression (n-fold Mock) 0 Col-0 yda11 fls2 yda11 fls2 FRK Col-0 yda11 fls2 yda11 fls2 PHI Col-0 yda11 fls2 yda11 fls2 CYP81F Col-0 yda11 fls2 yda11 fls2 NHL Col-0 yda11 fls2 yda11 fls2 35 WRKY Col-0 yda11 cerk1-2 yda11 cerk1-2 0 Col-0 yda11 cerk1-2 yda11 cerk1-2 0 Col-0 yda11 cerk1-2 yda11 cerk1-2 0 Col-0 yda11 cerk1-2 yda11 cerk1-2 0 Col-0 yda11 cerk1-2 yda11 cerk1-2 Figure Expression of PAMP-induced genes is not impaired in yda11 mutant. Expression levels of the PAMP-inducible genes FRK1, CYP81F2, PHI-1, NHL10 and WRKY33 determined by qrt-pcr in seedlings from the indicated genotypes after treatment with flg22 (A) or chitin (B). Values are represented as n-fold-increased expression (± SE) compared to non-treated plants (t=0; A) or mocktreated plants (B). Data are from one out of three independent experiments, which gave similar results Hormone signalling and biosynthesis of Trp-derived metabolites are not impaired in yda11 mutant Previous studies have demonstrated that JA, SA and ET signalling are required for Arabidopsis resistance to PcBMM, since coi1-1, ein2-5 and sid2-1 mutants, impaired in JA, ET and SA pathways, respectively, show an enhanced susceptibility to this fungus, and double mutants in these pathways were more susceptible to PcBMM than the single mutants (Berrocal-Lobo et al., 2002; Stein et al., 2006; Sánchez-Vallet et al., 2012). To determine whether any of these 89

110 Results resistance pathways were altered in yda11 mutant upon PcBMM infection, we generated the yda11 coi1-1, yda11 ein2-1 and yda11 sid2-1 double mutants. Twenty one-day-old wild-type plants, the double mutants, the parental lines yda11, coi1-1, ein2-1 and sid2-1, and the hypersusceptible agb1-2 and resistant irx1-6 lines, were spray-inoculated with a spore suspension of PcBMM (2x10 6 spores/ml), and fungal biomass and disease ratings were determined at different dpi. We found that under this inoculation condition the yda11 mutant was more susceptible to PcBMM than the sid2-1 mutant, whereas the susceptibility of coi1-1 and ein2-1 plants was not significantly different from that of the wild-type plants (Figure 4.15A). Notably, the inactivation of SA, JA and ET pathways in yda11 mutant resulted in an increased susceptibility of the corresponding double mutants to the pathogen in comparison to the values observed in yda11 plants, as fungal biomass at 3 dpi was higher in the double mutants than in yda11 plants (Figure 4.15A). In agreement with the evaluation of fungal biomass, the disease rating at 12 dpi was also higher in the double mutants than in yda11 plants (Figure 4.15B). These data demonstrated that the enhanced susceptibility of yda11 plants cannot be explained by a defective activation of the SA, JA and ET signalling pathways. To further corroborate these results, we performed qrt-pcr expression analyses of some representative marker genes from SA, JA and ET immune response pathways in Col-0 and yda11 plants at different time points after PcBMM inoculation. We analysed the expression of PR-1 (pathogenesis-related gene 1), PDF1.2 (plant defensin 1.2) and PR-4 (pathogenesis-related 4), marker genes of the SA-, ET/JA- and ET-signalling pathways, respectively. These genes were strongly induced in response to PcBMM, and the induction was stronger in the yda11 mutant than in the wild-type plants (Figure 4.15C). These results confirmed that JA, ET and SA signalling pathways were not impaired in yda11 plants. The plant hormone ABA has been shown to negatively regulate PcBMM resistance mediated by SA, JA and ET signalling pathways (Sánchez-Vallet et al., 2012), but also it might have a positive function in the regulation of Arabidopsis PcBMM resistance as it has been demonstrated in the irx1-6 mutant (Hernández-Blanco et al., 2007). Since yda11 mutant displays no defects in the SA, ET and JA hormone signalling pathways that could explain its enhanced susceptibility to pathogens, we tested whether ABA-signalling was altered in yda11 mutant by determining the expression of NCED3 gene, encoding a key enzyme involved in the biosynthesis of ABA, in yda11 and wild-type plants after PcBMM inoculation. qrt-pcr of samples harvested at 3 dpi, showed that the relative expression of this gene in yda11 mutant was two-fold higher than in wild-type plants (Figure 4.15C), indicating that ABA-signalling was not impaired in the mutant. 90

111 Results A PcBMM β-tubulin (n-fold WT) dpi g f e e d c b b b a Col-0 yda11 coi1-1 yda11 coi1-1 ein2-1 yda11 ein2-1 sid2-1 yda11 sid2-1 agb1-2 irx1-6 B Disease rating dpi d d c c c b b b b a Col-0 yda11 coi1-1 yda11 coi1-1 ein2-1 yda11 ein2-1 sid2-1 yda11 sid2-1 agb1-2 irx1-6 C Relative expression (n-fold vs Mock) PR1 400 PDF PR NCED Col-0 yda11 0 Col-0 yda11 0 Col-0 yda Col-0 yda11 Figure The SA-, JA-, ET- and ABA-mediated defensive pathways are not impaired in the yda11 mutant. (A) Analysis of the defense response to PcBMM of yda11 double mutants with defects in JA (yda11 coi1-1), ET (yda11 ein2-1) and SA (yda11 sid2-1) signalling pathways. qpcr determination of fungal biomass 3 days after treatment with the pathogen. Values are represented as n-fold increased expression (± SE) compared to wild-type plants. (B) Average disease ratings (DR ± SE) of the indicated genotypes at 12 dpi. DR varies between 0 (no symptoms) and 5 (dead plant). Letters (A-B) indicate values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test). (C) Expression of SA, ET/JA, ET and ABA marker genes in wild-type and yda11 plants 3 days after PcBMM inoculation. Data (A- C) are from one out of three independent experiments, which gave similar results. 91

112 Results Trp-derived metabolites have also been involved in Arabidopsis resistance to fungal pathogens and found to be essential for Arabidopsis resistance to adapted and non-adapted isolates of P. cucumerina (Bednarek et al., 2009; Sanchez-Vallet et al., 2010). We tested whether Trp-derived metabolites pathways were altered in yda11 mutant through the analysis of the expression of PAD3 and CYP79B2 genes, encoding two cytochrome P450 enzymes involved in the biosynthesis of Trp-derived metabolites (Figure 4.16A). qrt-pcr of RNA samples of yda11 and wild-type plants harvested 3 days after PcBMM inoculation demonstrated that the relative expression of these genes in yda11 mutant was higher than in wild-type plants (Figure 4.16B), probably due to the enhanced growth of the fungus in yda11 plants in comparison to the progression of the infection in wild-type plants. To further demonstrate that the accumulation of Trp-derived metabolites, such as camalexin, indol-3- ylmethylamine (I3A), indol-3-ylmethyl glucosinolate (I3G) and 4-methoxyindol-3-ylmethyl glucosinolate (4MI3G), was not defective in yda11 mutant during PcBMM infection, we performed a comparative metabolite profiling of leaf extracts from wild-type and yda11 plants at 1 and 3 dpi. A significant increase in the accumulation of 4MI3G and camalexin occurred in PcBMM-inoculated Col-0 and yda11 plants compared to mock-treated plants (Figure 4.16C). In contrast, a depletion of I3G, the precursor of 4MI3G, was visible in the inoculated plants, which correlated with the increase of 4MI3G, although no significant differences were found between Col-0 and yda11 genotypes (Figure 4.16C). In line with the enhanced accumulation of 4MI3G and camalexin, higher levels of I3A were also detected in inoculated plants (Figure 4.16C). Together these data indicated that yda11 enhanced susceptibility to pathogens was not due to defects in the accumulation of Trp-derived metabolites. 92

113 Results A CYP79B2 CYP79B3 Tryptophan IAO x I3G CYP81F2 4MI3G PAD3 Camalexin I3A + RA 4MI3A + RA B Relative expression (n-fold vs Mock) 70 PAD Col-0 yda11 4 CYP79B Col-0 yda11 C nmol/g fresh weight I3G WT Mock 1dpi PcBMM 1dpi Mock 3dpi PcBMM 3dpi + yda11 nmol/g fresh weight MI3G * WT * * yda11 * nmol/g fresh weight I3A + WT * yda11 * nmol/g fresh weight Camalexin * * WT * yda11 * Figure yda11 is not defective in the biosynthesis of Trp-derived metabolites. (A) Biosynthesis of the tryptophan-derived metabolites required for Arabidopsis resistance to pathogens (adapted from Bednarek et al., 2009). The enzymes encoded by genes up-regulated in PTI are indicated. (B) Expression of Trp-derived metabolites marker genes in wild-type and yda11 plants after PcBMM inoculation. (C) Average relative content (nmol/g fresh weight ± SD) of indol-3-ylmethyl glucosinolate (I3G), 4- methoxyindol-3-ylmethyl glucosinolate (4MI3G), indol-3-ylmethylamine (I3A) and camalexin in mock or PcBMM-treated wild-type and yda11 plants at 1 and 3 dpi. Two-tailed Student s t-test for pairwise comparison of infected and non-infected plants (* p < 0.05; p < 0.1), and mutant and wild-type plants ( p < 0.05; p < 0.1), was performed. Data (B-C) are from one out of three independent experiments, which gave similar results. 93

114 Results 4.9. Comparative transcriptomic analysis revealed some set of defensive genes differentially regulated in yda11 plants To elucidate the molecular mechanisms that might be impaired in yda11 mutant and could explain its enhanced susceptibility to pathogens, we performed a global gene expression analysis using the Affymetrix ATH1 GeneChip comparing non-inoculated (water- or mocktreated) or PcBMM-inoculated (4x10 6 spores/ml) yda11 and wild-type (Col-0) plants at 0, 1 and 3 dpi, and out of the 22,810 probesets (genes) tested, we determined statistically significant values according to a two-way analysis of variance and a Benjamini and Hochberg multiple testing correction (p 0.01; GeneSpring 7.2 software). In non-inoculated yda11 plants (t=0) 23 genes were differentially regulated (17 up and 6 down) in comparison to wild-type plants (Table 4.1). Similarly, 23 and 13 genes were differentially regulated in yda11 plants at 1 and 3 days after mock treatment, respectively (Tables 4.2 and 4.3). Remarkably, among these three sets of genes only 3 genes were mis-regulated in yda11 compared to wild-type plants: At2g46070 (MPK12), which is preferentially expressed in guard cells and has been reported as a negative regulator of auxin signalling (Jammes et al., 2009; Lee et al., 2009), At4g24040 (TRE1), which encodes the Arabidopsis trehalase, recently involved in the regulation of stomatal closure in the drought stress response (Van Houtte et al., 2013), and At1g52040 (MBP1), encoding a myrosinase-binding protein that functions in plant defense response. In PcBMM-inoculated yda11 plants, 579 and 554 genes were differentially regulated at 1 and 3 dpi, respectively, compared to wild-type plants (Tables S1 and S2). We performed a functional classification of these genes by using the Classification SuperViewer tool of the Bio- Analytic Resource for Plant Biology (BAR; The classification revealed that some of the most overrepresented functional categories at 1 dpi were response to abiotic or biotic stimulus (p-value < ), signal transduction (p-value < 10-8 ), and response to stress (p-value < ), whereas at 3 dpi were receptor binding or activity (pvalue < 10-5 ), signal transduction (p-value < ), and response to stress (p-value < ) (Figure 4.17A, 4.17B). Interestingly, the cell wall cellular component category was also overrepresented at 1 dpi (p-value < 0.045) and 3 dpi (p-value < 0.023) (Figure 4.17A, 4.17B), suggesting a potential contribution of the cell wall composition and/or remodelling to the susceptibility of yda11 to pathogens. Among the genes that were differentially up-regulated in yda11 upon PcBMM inoculation, we found several examples of genes which have been involved in defense responses against necrotrophic fungi and in the regulation of immune responses, such as the receptor-like protein RLP52 (Ramonell et al., 2005), the mitogenactivated protein kinase MPK3 (Asai et al., 2002), the LRR-RLKs EFR and PEPR2 (Zipfel et al., 94

115 Results 2006; Yamaguchi et al., 2010), the PP2C-type phosphatase AP2C1 (Schweighofer et al., 2007), or several JA-wound responsive genes, such as MYC2, LOX2, LOX3 or VSP2 (Tables S1 and S2). We also checked the expression of more than 80 genes that have been reported to be involved in different defensive responses against pathogens, including additional marker genes of the ET, SA, JA and ABA pathways, as well as genes encoding key enzymes of the Trp-derived metabolites pathway (Figure 4.17C). We found that the expression of these genes was not impaired and was rather enhanced in yda11 plants in comparison to that observed in wild-type plants (Figure 4.17C), corroborating that these signalling pathways are not impaired in yda11 (Figures 4.15 and 4.16). The up-regulation of all these genes (Tables S1 and S2, Figure 4.17C) in yda11 mutant might be associated to the faster growth of the fungus in the mutant compared to that in wild-type plants. Table 4.1. Genes differentially regulated in non-inoculated yda11 plants compared to wild-type plants. AGI ID Fold change 1 Gene description AT5G ,173 LTP3, lipid transfer protein 3 AT4G ,846 ATTRE1, TRE1, trehalase 1 AT2G ,594 Protein of unknown function, DUF547 AT1G ,346 Plant invertase/pectin methylesterase inhibitor superfamily AT5G ,210 GDSL-like Lipase/Acylhydrolase superfamily protein AT1G ,077 Unknown protein AT3G ,042 Peroxidase family protein AT1G ,034 AMP-dependent synthetase and ligase family protein AT5G ,996 Protein of unknown function (DUF1677) AT1G ,994 ATLP-3, TLP-3, thaumatin-like protein 3 AT2G ,851 ATMPK12, MAPK12, MPK12, mitogen-activated protein kinase 12 AT2G ,841 ABCB4, ATPGP4, MDR4, PGP4, ATP binding cassette subfamily B4 AT5G ,836 ATEXO70A2, EXO70A2, exocyst subunit exo70 family protein A2 AT2G ,802 EPF1, epidermal patterning factor 1 AT1G ,788 GDSL-like Lipase/Acylhydrolase superfamily protein AT1G ,769 CSD1, copper/zinc superoxide dismutase 1 AT5G ,767 ABCG22, AtABCG22, ABC-2 type transporter family protein AT1G ,622 TRFL3, TRF-like 3 AT3G ,584 P-loop NTPs hydrolases superfamily protein with CH (Calponin Homology) domain AT2G ,544 ASG3, SNF2 domain-containing protein / helicase domain-containing protein AT3G ,478 Thioredoxin superfamily protein AT1G ,474 ATEGL3, ATMYC-2, EGL1, EGL3, enhancer of glabra 3 AT1G ,442 ATMBP, MBP1, myrosinase-binding protein 1 1 Relative expression yda11/col-0. Only genes with n-fold > or < are considered (ANOVA p < 0.01) 95

116 Results Table 4.2. Genes differentially regulated in yda11 mock-treated plants at 1 dpi compared to wild-type mock-treated plants. AGI ID Fold change 1 Gene description ATCG ,099 PSBC, photosystem II reaction center protein C ATCG ,721 RBCL, ribulose-bisphosphate carboxylases ATCG ,423 ATPH, ATP synthase subunit C family protein ATCG ,286 RPS12, RPS12B, ribosomal protein S12B ATCG ,814 ATPF, ATPase, F0 complex, subunit B/B', bacterial/chloroplast ATCG ,785 YCF10, CemA-like proton extrusion protein-related AT5G ,307 ATGER2, GER2, GLP2A, germin-like protein 2, germin-like protein 2A AT5G ,203 Unknown protein ATCG ,126 TIC214, translocon at the inner envelope membrane of chloroplasts 214, YCF1.2 AT4G ,056 Protein kinase superfamily protein ATCG ,030 RPL16, ribosomal protein L16 AT1G ,026 Unknown protein AT1G ,002 Unknown protein AT1G ,985 glycine-rich protein ATCG ,980 PETA, photosynthetic electron transfer A AT4G ,975 ATTRE1, TRE1, trehalase 1 AT3G ,956 Peroxidase family protein AT3G ,907 ATCHX20, CHX20, cation/h+ exchanger 20 AT2G ,808 ATMPK12, MAPK12, MPK12, mitogen-activated protein kinase 12 AT4G ,801 SKS9, SKU5 similar 9 ATCG ,756 YCF9, encodes PsbZ, which is a subunit of photosystem II ATCG ,756 PSAB, Photosystem I, PsaA/PsaB protein AT1G ,393 ATMBP, MBP1, myrosinase-binding protein 1 1 Relative expression yda11/col-0. Only genes with n-fold > or < are considered (ANOVA p < 0.01) Table 4.3. Genes differentially regulated in yda11 mock-treated plants at 3 dpi compared to wild-type mock-treated plants. AGI ID Fold change 1 Gene description AT2G ,911 Chitinase family protein AT1G ,908 ATEXT1, ATEXT4, EXT1, EXT4, ORG5, extensin 4 AT1G ,279 Protein kinase superfamily protein AT4G ,139 Protein kinase superfamily protein AT1G ,072 Unknown protein AT1G ,035 HT1, Protein kinase superfamily protein AT4G ,987 ATTRE1, TRE1, trehalase 1 AT3G ,871 Unknown protein AT1G ,801 Unknown protein AT2G ,761 ATMPK12, MAPK12, MPK12, mitogen-activated protein kinase 12 AT1G ,600 ATBG1, BGL1, BGLU18, beta glucosidase 18 AT1G ,578 ATXYN1, RXF12, Arabidopsis thaliana xylanase 1 AT1G ,357 ATMBP, MBP1, myrosinase-binding protein 1 1 Relative expression yda11/col-0. Only genes with n-fold > or < are considered (ANOVA p < 0.01) 96

117 Results A B Normalized frequency Normalized frequency dpi electron transp./energy path. plastid resp. to abiotic/biotic stim. signal transduction response to stress chloroplast transferase activity transport plasma membrane receptor binding or activity cell wall developmental processes transcription factor activity cell organization/biogenesis protein binding kinase activity transcription nucleotide binding 3 dpi receptor binding or activity signal transduction response to stress resp. to abiotic/biotic stim. kinase activity plasma membrane transport transferase activity ER transporter activity cell wall transcription factor activity developmental processes protein binding transcription nucleotide binding hydrolase activity cell organization/biogenesis C Col-0 P1/M1 yda11 P1/M1 Col-0 P3/M3 yda11 P3/M3 PAD3 FRK1 ORA59 PYL6/RCAR9 CYP81F2 JAZ1 WRKY33 MYB51 EDS5 EFR ICS1/SID2 JAZ6 PR5 PR4 WRKY54 WRKY70 CDPK3/CPK6 WRKY18 AXR1 CERK1 PEN3 AOS/CYP74A/DDE2 NDR1 SUR1 BAK1 ABA1/ZEP MKK1/MEK1 SUR2 MPK4 FLS2 MKK9 JAZ10/JAS1 JAZ5 JAZ8 PR3 PR1 PHI-1 PBS3 WRKY58 PAD4 CYP79B2 ATAF1 CYP79B3 MYC2 WRKY53 ERF1 PDF1.2 PAL1 OPR3/DDE1 EDS1 SDR1/ABA2 MPK3 BIK1 JAZ2 PEN2 NPR1 CDPK1/CPK10 JAZ3/JAI3 SAMT1 SGT1 EIN4 CTR1 CEV1/CESA3/IXR1 MPK6 CPR5/HYS1 NCED1 SnRK2.1 SnRK2.6 ATH2 ERECTA CDPK6/CPK3 EIN2 COI1 JAR1 Figure Comparative analysis of de-regulated genes in yda11 and wild-type plants upon PcBMM inoculation. Functional classification of the differentially expressed genes in yda11 plants 1 (A) and 3 (B) days after PcBMM inoculation. The normalized score value for each functional class is represented. Normalized score value > 1 indicates statistically significant overrepresented classes. The cell wall functional category is indicated in dark red, and those categories that might be associated to pathogen resistance in dark grey. (C) Hierarchical clustering of defense genes differentially expressed in yda11 and Col-0 plants at 1 day (P1/M1) and 3 days (P3/M3) after PcBMM inoculation. Genes (rows) and experiments (columns) were clustered with the Multiexperiment Viewer (MeV) software using Pearson uncentered distance and average linkage. The PP2C-type phosphatase AP2C1 was one of the genes that was up-regulated in yda11 mutant upon PcBMM infection. AP2C1 has been reported to be a negative regulator of Arabidopsis resistance to pathogens, such as the necrotrophic fungus B. cinerea, by interfering with JA signalling pathway (Schweighofer et al., 2007). To determine whether AP2C1 might form part of the YDA-mediated immune pathway, the genetic interaction between YDA and AP2C1 was analysed by crossing yda11 with the T-DNA insertional line ap2c1 (Schweighofer et 97

118 Results al., 2007) to generate the yda11 ap2c1 double mutant, and its susceptibility to PcBMM was examined. Eighteen-day-old plants of the wild-type, yda11, ap2c1 and yda11 ap2c1 genotypes, two transgenic AP2C1-overexpressing lines (#640.1 and #640.2, OE1 and OE2 respectively; Schweighofer et al., 2007), and the agb1-2 and irx1-6 control mutants were sprayed with a spore suspension of PcBMM and fungal biomass and DR were determined at 3 and 5 dpi, respectively. As previously reported for B. cinerea, ap2c1 mutant was more resistant to PcBMM than wild-type plants, whereas the AP2C1-overexpressing lines OE1 and OE2 displayed a slightly enhanced susceptibility to the fungus (Figure 4.18A). Fungal biomass at 3 dpi, DR at 5 dpi and macroscopic symptoms at 8 dpi in yda11 ap2c1 double mutant was quite similar to that in yda11 mutant (Figure 4.18A, B, C), indicating that the enhanced susceptibility of yda11 could not be suppressed by the mis-regulation of the AP2C1 phosphatase. A C PcBMM β-tubulin (n-fold WT) Col-0 3 dpi ab Col-0 cd yda11 a ap2c1 yda11 d yda11 ap2c1 bc OE1 bc OE2 ap2c1 e agb1-2 a irx1-6 B Disease rating dpi a Col-0 c yda11 ab ap2c1 c yda11 ap2c1 bc OE1 bc OE2 d agb1-2 yda11 ap2c1 OE1 OE2 agb1-2 irx1-6 a Mock irx1-6 PcBMM 8 dpi Figure The AP2C1 phosphatase might not be a component of YDA-mediated immune pathway. (A) PcBMM biomass quantification in the indicated genotypes at 3 dpi by qpcr. Values are represented as the average (± SE) of the n-fold fungal DNA levels compared to wild-type plants. (B) Average disease ratings (DR ± SE) of the indicated genotypes at 5 dpi. DR varies between 0 (no symptoms) and 5 (dead plant). (C) Disease symptoms of the indicated genotypes at 8 dpi. Letters (A-B) indicate values statistically different among genotypes (ANOVA p < 0.05, Bonferroni Test). Data are from one out of three independent experiments that gave similar results. 98

119 Results CA-YDA plants do not show enhanced PTI responses The broad-spectrum resistance to pathogens shown by CA-YDA lines prompted us to determine whether the expression of the constitutively active YDA protein up-regulates some PTI defensive responses. To check this hypothesis, we performed a series of comparative analyses of some PTI responses in wild-type and CA-YDA plants. We first analysed the level of phosphorylation of MPK3, MPK6, MPK4 and MPK11 in mock-treated and PcBMM-inoculated CA-YDA lines. Soil grown eighteen-day-old plants from the wild-type accessions Col-0 and La-0, the CA-YDA lines (Col-0 and La-0 backgrounds) and the yda11, CA-YDA yda11, er-1 and CA-YDA er-1 mutants were spray-inoculated with a spore suspension of PcBMM or mock treated. Tissues were harvested at different time points (0, 0.5, 1, 2 and 6 hpi) and the phosphorylation status of MPKs was determined by Western blot, using the anti-ptepy antibody. As shown in Figure 4.19A, the phosphorylation of these MPKs in mock-treated (t=0 hpi) CA-YDA plants was quite similar to that in the corresponding wild-type plants, indicating that the expression of CA-YDA did not confer a constitutive activation of the whole MAPK cascade. In contrast, in PcBMM-inoculated CA-YDA lines phosphorylation of MPK3 and MPK4/MPK11 was enhanced at 0.5 and 1 hpi in comparison to that in the corresponding wild-type plants (Figure 4.19A). Remarkably, the expression of CA-YDA protein in yda11 background restores the phosphorylation of MPKs to wild-type levels (Figure 4.19A). Accumulation of the β-glucan polymer callose takes place in cell wall appositions formed at the site of pathogen contact, but also in response to plant treatment with PAMPs (Gómez-Gómez et al., 1999; Clay et al., 2009). Callose deposition has emerged as a rapid and relatively simple method to quantify PTI activity (Luna et al., 2011), and therefore we determined callose deposition in CA-YDA plants. Leaves from three-week-old plants of the wild-type accessions Col-0 and La-0, and the CA-YDA (Col-0 and La-0 backgrounds), yda11, CA- YDA yda11, er-1 and CA-YDA er-1 mutants were inoculated with a spore suspension of PcBMM, and accumulation of callose was determined at 24 hpi by UV epifluorescence microscopy after staining the inoculated leaves with aniline blue. As it is illustrated in Figure 4.19B, the perception of PcBMM causes a similar response in CA-YDA lines and in their corresponding wild-type plants (Col-0 and La-0). Remarkably, callose deposition upon PcBMM inoculation was impaired in yda11 mutants, as it has been previously described for er-1 mutant (Figure 4.19B; Llorente et al., 2005). This defective callose deposition was not restored to wild-type levels by expression of CA-YDA protein in yda11 and er-1 backgrounds, further indicating that callose accumulation does not contribute to CA-YDA-mediated resistance to PcBMM. 99

120 Results A PcBMM spores PcBMM spores Col-0 CA-YDA yda11 CA-YDA yda La-0 CA-YDA er-1 CA-YDA er hpi MPK6 MPK3 MPK4/11 Amido black hpi MPK6 MPK3 MPK4/11 Amido black B Col-0 yda11 La-0 er-1 CA-YDA CA-YDA yda11 CA-YDA CA-YDA er-1 C Total RLU x a Col-0 a CA-YDA a yda11 a CA-YDA yda11 b 35S::RbohD a cerk1-2 D Total RLU x b Col-0 b CA-YDA b yda11 b CA-YDA yda11 c 35S::RbohD a fls2 Figure PTI responses are not altered in CA-YDA plants. (A) MAPK activation in CA-YDA lines upon application of a crude extract of PcBMM spores. The phosphorylation of MPK6, MPK3 and MPK4/11 was determined in the indicated genotypes at different hpi by Western blot using the anti-ptepy antibody. Amido black-stained membranes show equal loading. (B) Callose deposition in leaves of the indicated genotypes at 24 hpi with spores of PcBMM. Scale bars represent 50 µm. (C, D) Total ROS production over a period of 40 minutes, represented as relative light units (RLU), in leaf discs of four-week-old plants from the indicated genotypes after treatment with a crude extract of PcBMM spores (C) or flg nm (D). Values are average ± SE (n = 12). Letters indicate statistically significant differences among genotypes (ANOVA p < 0.05, Bonferroni Test). All the experiments were repeated at least three times and gave similar results. 100

121 Results The transient production of reactive oxygen species (ROS) by Arabidopsis RBOH NADPH oxidases is a characteristic defense response of plants after pathogen recognition and PAMP treatment (Boller and Felix, 2009). To test whether the constitutive activation of YDA has an effect in ROS accumulation, we monitored the production of hydrogen peroxide (H 2 O 2 ) in CA-YDA lines upon PcBMM perception using luminol assays. Leaf discs from CA-YDA plants treated with PcBMM spores exhibited a ROS burst comparable to that of the wild-type plants (Figure 4.19C). Similarly, the H 2 O 2 production in yda11 and CA-YDA yda11 mutants did not differ from that of the wild-type plants and the cerk1-2 mutant included as control (Figure 4.19C). We also monitored H 2 O 2 production in response to flg22 treatment (100 nm) and we found that the oxidative burst in yda11 mutant and CA-YDA lines (Col-0 and yda11 backgrounds) was not impaired, and it was similar to that of wild-type plants, which contrasted with the defective ROS production observed in fls2 mutant or the hyper accumulation of ROS in the transgenic line overexpressing the RbohD gene (35S::RbohD) which were included as controls in the experiments (Figure 4.19D). We next determined whether the constitutive activation of YDA in CA-YDA plants altered the expression levels of some representative marker genes from different immune response pathways. We analysed by qrt-pcr the expression in Col-0, yda11 and CA-YDA (Col-0 background) plants inoculated with PcBMM (3 dpi) of PR-1, LOX2 (lipoxygenase 2), PR-4, PDF1.2, NCED3, PAD3 and CYP79B2 (marker genes of SA, JA, ET, ET+JA, ABA, and Trp-derived metabolites pathways, respectively), and the PTI-inducible genes FRK1, PHI-1 and RETOX. The levels of expression of all the tested genes were significantly higher in yda11 mutant than in wild-type plants, with the exception of RETOX gene, whose expression was comparable to that of wild-type and CA-YDA plants (Figure 4.20). The expression levels of the majority of the tested genes were slightly higher in CA-YDA plants than in wild-type plants (Figure 4.20), suggesting that this enhanced expression might contribute to CA-YDA mediated resistance. 101

122 Results Relative expression 3dpi (n-fold Mock) 30 PR LOX2 30 PR PDF1.2 7 NCED Relative expression 3dpi (n-fold Mock) 50 PAD Col-0 yda11 CA-YDA CYP79B2 Col-0 yda11 CA-YDA FRK1 Col-0 yda11 CA-YDA PHI-1 Col-0 yda11 CA-YDA RETOX Col-0 yda11 CA-YDA Figure Expression of defensive genes in CA-YDA plants upon PcBMM infection. Expression of defensive marker genes of the SA, JA, ET, ABA and Trp-derived metabolites pathways, and PAMPinducible genes was tested in PcBMM-inoculated Col-0, yda11 and CA-YDA plants at 3 dpi. Expression was determined by qrt-pcr and the data are expressed as n-fold induction compared to mock-treated plants. These experiments were repeated at least three times and gave similar results Transcriptomic analysis of CA-YDA plants To better understand the genetic basis of CA-YDA mediated resistance, comparative transcriptomic analyses of non-inoculated and PcBMM-inoculated (1 dpi) wild-type and CA- YDA plants were performed. When we compared mock-treated CA-YDA and mock-treated wild-type plants, 296 genes were found to be differentially regulated in CA-YDA plants (178 upand 118 down-regulated; p < 0.01) (Table S3). Among these genes, we found several examples of defense-related genes, such as SNC1 (Suppressor of NPR1-1, Constitutive 1), NHL10 (NDR1/HIN1-like 10), BKK1 and BAK8, and genes encoding different MAP kinases (MPK8, MPK11, MKK9, MAPKKK4/YDA, MAPKKK10), antimicrobial peptides/proteins (THI2.2 and PR-5), PRR proteins (TIR-NBS-LRRs, RLKs, RLPs and CRKs), diverse B3 transcription factors and metacaspases (Table S3). In addition, among the genes encoding proteins of unknown function 102

123 Results we found several that encode low molecular weight polypeptides with putative extracellular localization. We performed a functional classification of these genes by using the Classification SuperViewer tool, which revealed an overrepresentation of cell wall related genes, as well as other Gene Ontology (GO) categories, such as receptor binding or activity, response to stress or response to abiotic or biotic stimulus (Figure 4.21A). Interestingly, several deregulated genes encode proteins involved in wall structure and remodelling, such as methyl and fucosyl transferases (FUT6 and FUT8), methyl esterases and arabinogalactan proteins (Table S3). A Normalized frequency CA-YDA mock vs WT mock receptor binding or activity response to stress structural molecule activity cell wall other enzyme activity ER resp. to abiotic/biotic stim. nucleotide binding kinase activity transferase activity signal transduction protein binding DNA or RNA metabolism extracellular nucleus B n-fold WT Mock n-fold WT Mock 180 FUT THI WT M WT Pc CA-YDA M CA-YDA Pc FUT MC2 WT M WT Pc CA-YDA M CA-YDA Pc 6 MKK WT M WT Pc CA-YDA M CA-YDA Pc Figure Functional classification of differentially expressed genes in CA-YDA plants compared to wild-type plants (p < 0.01). (A) The 296 genes differentially regulated in the mock-treated CA-YDA mutant compared with mock-treated wild-type plants were classified according to their GO annotation. The normalized score value for each functional class is represented. Only over-represented classes (normalized score value > 1) are shown. The cell wall functional category is indicated in dark red, and those categories that might be associated to pathogen resistance in dark grey. (B) qrt-pcr analysis of genes differentially regulated in mock-inoculated (M) or PcBMM infected (Pc) CA-YDA plants compared with wild-type (WT) plants. Values (± SE) are represented as n-fold increased expression compared to that of mock-treated wild-type (WT) plants. 103

124 Results In PcBMM-inoculated wild-type plants, 1196 genes (1071 up- and 125 down-regulated) displayed a significant differential expression compared to wild-type mock-treated plants. Among these genes there was a subset of well-known defensive genes: CDPKs, ERF1, LOX2, MLO6, MLO12, NPR1, PR-1, CYP79B2, CYP79B3, CYP81F2, BAK1, EDS1, SID2, ORA59, EFR, FRK1, PROPEP2 or PROPEP3 (Table S5). A functional classification of these genes was performed and we found that the most over-represented functional category included genes involved in signal transduction, followed by response to stress, response to abiotic or biotic stimulus and receptor binding or activity (Figure 4.22A). These data are in line with previously published transcriptomic analysis of wild-type plants inoculated with PcBMM (Delgado-Cerezo et al., 2012; Sánchez-Vallet et al., 2012). The comparison between CA-YDA PcBMM-inoculated and mock-treated plants revealed a lower number of genes (225) differentially regulated upon infection in comparison to that determined in wild-type plants (1196). Out of these 225 genes, 224 were up-regulated and just 1 was found to be down-regulated (Table S6). The majority of these genes (216 of 225), like NHL10, FRK1, PROPEP2, PROPEP3, CYP81F2, PAD3, CYP79B2 or WAK1 among others, showed a similar expression pattern in wild-type inoculated plants vs mock-treated plants (Figure 4.22C, Table S6). The functional classification of the CA-YDA differentially regulated genes upon PcBMM infection was performed using the Classification SuperViewer tool, and this analysis revealed an over-representation of receptor binding or activity, response to stress, response to abiotic or biotic stimulus and cell wall functional categories (Figure 4.22B). Only 9 genes were found to show a different pattern of expression in CA-YDA inoculated plants compared to wild-type inoculates plants (Figure 4.22C, Table 4.4), and the majority of them encoded proteins of unknown functions or proteins that might be involved in defensive processes: i) UDP-glucosyltransferases similar to UGT71C2 (At2g29740) have been involved in the glycosylation of secondary metabolites in response to oxidative stress (Lim et al., 2008), and related UGTs have been associated with ABA glycosilation in ABA homeostasis (Liu et al., 2015), or in the hypersensitive response to P. syringae (Langlois-Meurinne et al., 2005); ii) glutamate receptor-like proteins from GLR2.9 (At2g29100) family have been implicated in long-distance wounding signalling (Mousavi et al., 2013). 104

125 Results A Normalized frequency WT Pc vs WT mock B Normalized frequency CA-YDA Pc vs CA-YDA mock 0.0 signal transduction response to stress response to abiotic/biotic stim. receptor binding or activity other biological processes kinase activity transport cell wall plasma membrane transferase activity ER Golgi apparatus transporter activity nucleotide binding extracellular 0.0 receptor binding or activity response to stress other biological processes response to abiotic/biotic stim. cell wall signal transduction other molecular functions transport ER kinase activity transferase activity other enzyme activity plasma membrane transporter activity extracellular C WT Pc_M (1196) CA-YDA Pc_M (225) Figure Functional classification of genes differentially expressed in PcBMM inoculated (1dpi) wild-type and CA-YDA plants. (A) Functional classification of the 1196 genes differentially regulated in wild-type plants upon PcBMM inoculation (p < 0.01). (B) Functional classification of the 225 differentially expressed genes in CA-YDA mutant upon PcBMM inoculation (p < 0.01). The normalized score value for each functional class is represented, and the over-represented classes (normalized score value > 1) are shown. The cell wall functional category is indicated in dark red, and those categories that might be associated to pathogen resistance in dark grey. (C) Venn diagram showing the overlapping of genes deregulated in CA-YDA mutant line (Table S6; orange circle) and those deregulated in wild-type plants (Table S5; blue circle) upon PcBMM inoculation (Pc) compared with mock treatment (M). The number of differentially regulated genes is indicated. 105

126 Results Table 4.4. Genes differentially expressed in CA-YDA plants upon PcBMM inoculation whose expression is not altered in wild-type plants. AGI ID Fold change 1 Gene description AT2G ,59 UDP-GLUCOSYL TRANSFERASE 71C2, UGT71C2 AT5G ,19 CYTOCHROME P450, FAMILY 81, SUBFAMILY G, POLYPEPTIDE 1; CYP81G1 AT5G ,69 Plant protein of unknown function (DUF247) AT5G ,29 unknown protein AT1G ,76 unknown protein AT2G ,38 ATGLR2.9, GLR2.9, GLR2.9, glutamate receptor 2.9 AT5G ,07 HIPL2, HIPL2 PROTEIN PRECURSOR AT4G ,57 Glycosyltransferase of the GT77 family AT1G ,75 ATGSTU18, GSTU18, GST29, glutathione S-transferase tau 18 or 29 1 Relative expression CA-YDA PcBMM-inoculated plants versus mock-inoculated plants (ANOVA p < 0.01) In order to validate these transcriptomic data, expression levels in wild-type plants and in the CA-YDA mutant of some of the differentially regulated genes was analysed by qrt-pcr in an independent experiment. The analysed candidates included genes encoding two fucosyl transferases (At1g14080 and At1g14100; FUT6 and FUT8 respectively), a plant thionin (At5g36910; THI2.2), a type I metacaspase (At4g25110; MC2), and a MAP2K (At1g73500; MKK9). As shown in Figure 4.21B, differential up-regulation of these genes in the CA-YDA mock plants was confirmed, further indicating that the microarray data obtained were significant. Of note, some of these genes (FUT6, MC2 and MKK9) were up-regulated upon PcBMM infection in both wild-type and CA-YDA plants, further corroborating their function in Arabidopsis defensive response against necrotrophic pathogens Phosphoproteomic analysis of CA-YDA plants To investigate the impact of the constitutive activation of YDA MAP3K on the phosphoproteome of resting cells, we performed a comparative phosphoproteomic analysis of four-week-old soil grown wild-type and CA-YDA plants using a Prefractionation-Assisted Phosphoprotein Enrichment (PAPE) procedure (Lassowskat et al., 2013). After PAPE fractionation, the phosphoprotein-enriched samples were trypsin-digested and separated with a 300-min gradient for LC-MS measurements. Quantification of protein changes was performed with the Progenesis LC-MS software package and filtered for significant changes in protein abundance (> 2-fold, ANOVA p < 0.01). As listed in Tables S7 and S8, 432 proteins 106

127 Results showed differential phosphorylation in the CA-YDA plants in comparison with wild-type plants: 243 phosphoproteins were found to be preferentially phosphorylated in CA-YDA plants, whereas 189 were found to be more abundant in the wild-type phosphoproteome. Among the proteins preferentially phosphorylated in CA-YDA plants we found an over-representation of GO terms like cell wall, electron transport or energy pathways and response to abiotic or biotic stimulus (Figure 4.23B), whereas cell wall, receptor binding or activity, electron transport or energy pathways and cell organization and biogenesis were some of the overrepresented GO terms in the phosphoproteins down-represented in CA-YDA plants (Figure 4.23A). These data are in line with those obtained by comparative transcriptomic analyses and suggest that cell wall integrity might be altered in CA-YDA plants, as it has been previously reported in er-1 and agb1-2 mutants (Sánchez-Rodríguez et al., 2009; Delgado-Cerezo et al., 2012), and that cell wall remodelling could be a key defensive element explaining the broadspectrum resistance phenotype of CA-YDA plants. A 7 B 14 Normalized frequency Normalized frequency cytosol ER cell wall plastid structural molecule activity receptor binding or activity electron transport or energy pathways plasma membrane cell organization and biogenesis transport protein binding chloroplast response to abiotic or biotic stimulus transporter activity response to stress ribosome structural molecule activity plastid electron transport or energy pathways cytosol cell wall chloroplast response to abiotic or biotic stimulus cell organization and biogenesis response to stress nucleotide binding protein binding hydrolase activity transport extracellular Figure Comparative analysis of phosphoproteins over-represented in CA-YDA versus wild-type plants. (A) Functional classification of the putative phosphoproteins with decreased abundance in CA- YDA plants. (B) Functional classification of the putative phosphoproteins with higher abundance in CA- YDA plants. Annotation was done with the Classification SuperViewer tool (BAR). In both classifications, the normalized score value for each functional class is represented. Only over-represented classes (normalized score value > 1) are shown. The cell wall functional category is indicated in dark red, and those categories that might be associated to pathogen resistance in dark grey. 107

128 Results Characterization of cell wall composition of yda11 and CA-YDA plants revealed significant alterations in CA-YDA cell wall integrity Plant cell walls are considered one of the first barriers encountered by pathogens. Perturbations of the cell wall integrity (CWI) during biotic and abiotic stresses are constantly monitored by plant receptors, and this loss of CWI acts as an important trigger for defense mechanisms (Hématy et al., 2009; Engelsdorf and Hamann, 2014). Based on the overrepresentation of cell wall-related genes and phosphoproteins among those differentially regulated in CA-YDA and yda11 plants, we decided to characterize the cell wall composition of these plants and those of their corresponding background genotypes (Col-0, La-0 and er-1). First, we determined the cellulose and uronic acid contents of leaves from noninoculated three-week-old wild-type (Col-0 and La-0), yda11, CA-YDA (Col-0 and La-0 backgrounds), er-1 and CA-YDA er-1 plants, but no significant differences were observed, as the content of uronic acid and cellulose in the yda11 mutant and CA-YDA lines were similar to those obtained in the corresponding control plants (Figure 4.24A, B). We next determined the non-cellulosic neutral monosaccharide composition of the cell walls of all these genotypes and we found that the amount (% mol) of rhamnose and mannose were higher in yda11 samples than in the Col-0 wild-type plants, whereas the xylose content was reduced (Figure 4.24C). In CA-YDA plants a significant increase in glucose contents was detected in comparison to Col-0 plants, while the rest of the neutral sugars contents were similar to those of the Col-0 leaves (Figure 4.24C). The analysis of CA-YDA lines in La-0 background (CA-YDA and CA-YDA er-1) revealed that the amounts of rhamnose and fucose were lower than those of the La-0 walls, whereas the arabinose and xylose contents were higher in CA-YDA walls than in La-0. Notably, the cell walls of er-1 mutant were enriched in glucose and arabinose, while a reduction was observed for the rest of the neutral sugars tested (Figure 4.24C). Together these analyses revealed that mutations in or constitutive activation of YDA led to alterations in the cell wall composition and structure, suggesting a putative role of YDA in the regulation of cell wall integrity. These data also showed that the impact on cell wall structure and composition of the expression of CA-YDA protein was stronger in La-0 than in Col-0 background (Figure 4.24C). As previously described (Sánchez-Rodríguez et al., 2009), er-1 plants also showed alterations in cell wall composition compared to that of La-0, but these alterations were not restored to wild-type levels by constitutive expression of CA-YDA in the er-1 background (Figure 4.24C). All together these analyses indicated that some relevant alterations of cell wall integrity occur in CA-YDA and er-1 plants, which was in line with the 108

129 Results transcriptomic and phosphoproteomic data, and suggested a relevant contribution of CWI to YDA-mediated resistance to pathogens. A Uronic Acid (µg UA/mg air) a a a WT yda11 CA-YDA A A A A WT er-1 CA-YDA CA-YDA er-1 B α-cellulose (µg TS/mg air) a a a WT yda11 CA-YDA A A A A WT er-1 CA-YDA CA-YDA er-1 Col-0 La-0 Col-0 La-0 C % Neutral sugar WT yda11 CA-YDA WT er-1 CA-YDA CA-YDA er-1 Rhamnose Fucose Arabinose Xylose Mannose Galactose Glucose Figure Biochemical composition of yda11 and CA-YDA cell walls. (A) Total uronic acid content (µg per mg of dry weight) from the cell walls of yda11 and CA-YDA mutants and their corresponding background plants (Col-0, La-0 and er-1). (B) Cellulose content (µg per mg of dry weight) from the cell walls of the indicated genotypes. Data represent average values (± SE) of three independent replicates. Letters indicate values statistically different from those of the corresponding wild-type (ANOVA p < 0.05, Bonferroni Test). (C) Quantification of individual neutral sugars (% Mol) in the non-cellulosic carbohydrate fraction from the cell wall of the indicated genotypes. 109

130 Results To gain further insights into the relevance of the cell wall composition of yda11 and CA-YDA plants in their pattern of resistance to pathogens, we conducted a comparative glycomics approach using an ELISA-based technology with a collection of 155 glycan-directed monoclonal antibodies (mabs) that recognize specific cell wall structures (Pattathil et al., 2010). The cell walls of soil grown four-week-old plants from the Col-0 and La-0 wild-type genotypes, the yda11 and er-1 mutants, and the CA-YDA lines (in Col-0, La-0 and er-1 backgrounds) were fractionated by sequential extraction with increasing harsh chemical extractants (Section 3.20, Materials and Methods). Glycomics analyses were performed for each of the 5 sequential wall fractions generated: i) Protein and Neutral Sugars (PNS); ii) Pectins (PC1 and PC2); or iii) Hemicelluloses (HC1 and HC2). The analysis of these data corroborated that the alteration of YDA and ER functions significantly impact plant cell wall composition, as relevant changes in the abundance of some epitopes were observed among the yda11, CA-YDA and er-1 plants and their corresponding control genotypes (Tables S9-S13). For example, in PC1 fraction (or CDTA-extracted fraction) several differences were found between wild-type and yda11 plants as glycomics signal detected by mabs recognizing rhamnogalacturonan and arabinogalactan epitopes (RG-I/AG, AG-1, AG-2, AG-3, AG-4) was weaker in yda11 than in wild-type plants (Figure 4.25A). A detailed view of some of these mabs revealed significant changes in the accumulation of non-fucosylated and fucosylated xyloglucan-derived epitopes (e.g. CCRC-M58 and CCRC-M106) that were lower in yda11 mutant than in wild-type plants, whereas these epitopes were significantly more abundant in CA-YDA plants (Figure 4.25B). Remarkably, some of the differences observed in yda11 cell walls were also observed in er-1 walls (in La-0 background), further indicating that the walls of these mutants shared some similar features. Of note, the accumulation of non-fucosylated and fucosylated xyloglucan-derived epitopes in CA-YDA walls (Col-0, La-0 and er-1 backgrounds) was also higher than in the walls of their corresponding controls, further demonstrating a correlation between level of resistance to pathogens and wall composition in CA-YDA plants. 110

131 Results A Wall Antibodies (155) 0.0 WT yda11 CA-YDA WT er-1 CA-YDA CA-YDA er-1 Col-0 La B WT yda11 CA-YDA WT er-1 CA-YDA CA-YDA er Abs (nm) CCRC-M58 CCRC-M52 CCRC-M54 CCRC-M51 Non-fucosylated Xyloglucan 4 Non-fucosylated Xyloglucan 5 CCRC-M106 Fucosylated Xyloglucan Figure Glycomics analysis of yda11 and CA-YDA PC1 wall fraction. (A) PC1 (CDTA) extracts of cell walls from leaves of four-week-old plants from the indicated genotypes were analysed with cell wall glycan-directed mabs. The panel on the right lists the mabs used and groups them according to the principal glycan recognized by the antibodies (Section 3.20, Materials and Methods). The strengths of the ELISA signals are represented in a blue to red scale, with bright red depicting strongest binding and blue no binding. (B) Detailed analysis of some specific mabs that detect non-fucosylated and fucosylated xyloglucans from the PC1 (CDTA) fraction of the indicated genotypes. 111