The Transmembrane Receptor UNC-40 Directs Muscle Arm Extension in Caenorhabditis elegans

Transcription

1 The Transmembrane Receptor UNC-40 Directs Muscle Arm Extension in Caenorhabditis elegans by Kevin Ka Ming Chan A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto Copyright by Kevin Ka Ming Chan 2009

2 The Transmembrane Receptor UNC-40 Directs Muscle Arm Extension in Caenorhabditis elegans Kevin Ka Ming Chan Master of Science Graduate Department of Molecular Genetics University of Toronto 2009 ABSTRACT In Caenorhabditis elegans, body muscles extend muscle arms in a chemotropic fashion to the nearest nerve cord and serves as a model for the investigation of guided cell migration. I found that the transmembrane receptor UNC-40/DCC is required, and functions cell-autonomously to regulate muscle arm extension. Surprisingly, both the canonical ligand of UNC-40 (UNC-6/Netrin) and the extracellular domains of UNC-40 are dispensable, suggesting that UNC-40 relies on a co-receptor or other polarizing pathways to direct muscle arm extension. Furthermore, through double mutant analyses and the use of a neomorphic phenotype induced by UNC-40 over-expression, I define a distinct UNC-40 pathway in which UNC-73/Trio, the WAVE actin polymerization complex, and components of the dense body likely act downstream of UNC-40 to regulate muscle arm extension. Distinct modes of UNC-40 s function in muscle arm extension compared to its role in neurons provide a more complete understanding of how this conserved guidance receptor functions. ii

3 This work is dedicated to my parents, Steven and Mary Chan iii

4 ACKNOWLEDGEMENTS There are many people whom I must thank who have helped and supported me in the undertaking of this thesis work. First and foremost, I would like to thank my supervisor, Dr. Peter Roy, who convinced me of the beauty of C. elegans, and who gave me the opportunity to work on this project. I must also thank Dr. Andrew Spence and my supervisory committee members, Dr. Rudolf Winklbauer and Dr. Joseph Culotti for their helpful suggestions and guidance throughout my graduate studies. Special thanks go to Dr. Joseph Culotti and Hong Zheng for reagents and strains. Many thanks also go to past and present members of the Roy lab, especially those of us who worked on the muscle arm project. In particular, I am thankful for having Mariam Alexander as a friend and colleague, and thank her for all the meaningful discussions we had, as well as the work she contributed to my project. Also, thanks go to Alexandra Byrne for help in all aspects of my research, and also for her contributions to my project. This work would not have been possible without Mariam and Alexandra s guidance and friendship. Other members of the Roy lab that I must acknowledge include Guillermo Selman for help with molecular biology, Rachel Puckrin for technical assistance, and Jasmine Ono, as well as Eric Wong for their contributions. Also, I d like to thank Trevor Kwok, Genna Luciani and Serena D Souza for being great colleagues and friends. Thanks go to Andrew Burns for being such a swell guy, and also to the Ho-ness Cheuk Hei for being around all the time. Last but not least, I thank my parents who have provided me with unconditional support during my graduate training. iv

5 Table of Contents Abstract... ii Dedication... iii Acknowledgements... iv List of Tables... viii List of Figures... ix Chapter 1: General Introduction Introduction A General Introduction to Guided Cell Migration Guided Cell Migration and Directed Membrane Extension Types of Migrations of Motile Cells General Mechanisms of Guided Cell Migration Cue Interpretation: Cell-Surface Receptors of Extending Axons... 8 i) Combinatorial Expression and Hierarchical Ordering of Cell-Surface Receptors... 9 ii) Proteolytic Processing of Guidance Molecules and Receptors Receptor-Mediated Signal Transduction The UNC-40/DCC Guidance Pathway Muscle Arm Development in Caenorhabditis elegans Previously Described Genes Required for Muscle Arm Extension Forward Genetic Screen for Muscle Arm Development Defective Mutants Chapter 2: Materials and Methods Molecular Biology Expression Constructs Nematode Strains, Transgenics and Photomicroscopy Forward Genetic Screen, Molecular Mapping and Complementation Tests Quantification of Muscle Arms and Neuronal Guidance Temperature Sensitivity Experiments UNC-40 Over-expression v

6 8. Genetics RNAi Experiments Chapter 3: The Transmembrane Receptor UNC-40 Directs Muscle Arm Extension in Caenorhabditis elegans Introduction Results UNC-40/DCC is Required for Muscle Arm Extension in C. elegans i) madd-1 Represents Three New Alleles of unc ii) Temperature-Sensitivity Analysis of unc-40 Alleles iii) tr176 May Represent a Muscle Arm Specific Mutation of unc iv) unc-40, but not unc-6 is Required for Muscle Arm Extension v) UNC-40 Directs Muscle Arm Extension to Motor Axon Targets vi) UNC-40 is Expressed in the Body Wall Muscles vii) UNC-40 Acts Cell-Autonomously to Regulate Muscle Arm Extension Genes that Regulate Muscle Arm Extension in an UNC-40 Pathway i) Focal Adhesion Homologs are Required for Muscle Arm Extension ii) The C. elegans WAVE Complex Mediates Muscle Arm Extension in an UNC-40 Pathway iii) UNC-73 Acts in an UNC-40 Pathway to Direct Muscle Arm Extension Over-expression of UNC-40 Induces Ectopic Myopodial Extensions i) Ordering genes downstream of UNC ii) unc-6 May Play an Ancillary Role in Muscle Arm Extension iii) Other Genes Involved in Ectopic Myopodial Extensions Extracellular Domains of UNC-40 are Dispensable for Muscle Arm Extension i) Signal Transduction Through UNC-40 is Required for Proper Arm Extension ii) The Extracellular Domains of UNC-40 Induce a Dominant Negative Phenotype iii) The Cytoplasmic Domains of UNC-40 are Sufficient for Muscle Arm Extension In Search of a New Co-Receptor of UNC i) Candidate Co-receptors from UNC-40 Related Pathways ii) Fibroblast Growth Factor Pathway Candidate Co-receptors vi

7 iii) CAM-1 and DPY-19 as Candidate Co-receptors iv) PAT-2 is a Promising Candidate Co-Receptor Discussion i) Focal Adhesion Analogs are Required for Proper Muscle Arm Extension ii) Muscle Arm Extension as a Tool to Uncover Genes Required for Guided Migration iii) UNC-40 Relies on Other Signalling Pathways to Direct Muscle Arm Extension Chapter 4: General Discussion An UNC-40 Pathway Guides Muscle Arm Extension in Caenorhabditis elegans PAT-2 and UNC-40 May Function in a Complex to Mediate Muscle Arm Extension Membrane-based Yeast-2-Hybrid Approach to Identify Interactors of UNC Lipid Raft Associated UNC-40/PAT-2 Model for Muscle Arm Extension A Screen for Genes Involved in the Localization of UNC-40 at Muscle Arm Termini Real Time Analysis of Muscle Arm Extension Muscle Arms and Worm Behaviour Project Summary References vii

8 List of Tables 1.1 Key Molecules and Receptors Involved in Axon Guidance Mutants Isolated from a Forward Genetic Screen for Genes Required 50 for Muscle Arm Extension 3.2 Candidate Co-Receptors of Genes in Candidate Pathways 83 viii

9 List of Figures 1.1 Directed Growth of an Axonal Growth Cone Migration in Response to a Chemotropic Cue UNC-40/DCC Signalling Muscle Arm Extension in C. elegans madd-1 has Severe Muscle Arm Guidance Defects madd-1 Represents Alleles of unc Domain Organization of UNC UNC-6 is Not Required for Proper Muscle Arm Extension UNC-40 is Required to Direct Muscle Arm Extension to Motor Axon 60 Targets 3.6 UNC-40 Expression and Localization Pattern UNC-40 Acts Cell-Autonomously to Direct Muscle Arm Extension unc-40 Double Mutant Analysis for Muscle Arm Defects The WAVE Complex Acts in an UNC-40 Pathway Independent of 70 WASP 3.10 UNC-73 Functions Cell-Autonomously for Muscle Arm Extension 71 Downstream of UNC UNC-40 Over-Expression Induces Ectopic Myopodial Extensions The Cytoplasmic Domains of UNC-40 are Sufficient for Muscle Arm 79 Extension 3.13 Two Models for UNC-40 Function in Muscle Arm Extension Knockdown of PAT-2 Activity Suppresses MYR::UNC-40(Δecto) Dependent Muscle Arm Extension A Model of a Muscle Arm Signalling Pathway Cooperative Model Between UNC-40 and Integrin for Muscle Arm 104 Extension ix

10 Chapter 1: General Introduction 1

11 Chapter One 1. Introduction My thesis work describes an UNC-40 pathway that is required for the extension of muscle arms to motor axon targets in C. elegans. First, I found that unc-40, which encodes a well characterized guidance receptor that responds to UNC-6/Netrin (Chan et al., 1996), is required for muscle arm extension. Second, I demonstrate that UNC-40 functions cell-autonomously in muscles to direct muscle arm extension. Third, I discovered that UNC-40 is expressed in the body wall muscles, and that UNC-40, when specifically expressed in muscles, localizes to muscle arm termini. Fourth, I found that the extracellular domains of UNC-40 are dispensable in its role in directing muscle arm extension, suggesting the requirement of a co-receptor, or parallel polarizing pathways. Fifth, I discovered that over-expression of UNC-40 in muscles is sufficient to induce ectopic myopodia from the muscle membrane. Finally, I exploited the UNC-40 overexpression phenotype to show that dense-body components, the WAVE complex, and the RhoGEF UNC-73/Trio all likely function downstream of UNC-40. In this introductory chapter, I first describe the general mechanisms of guided cell migration. I then describe the role of the guidance receptor in interpreting extracellular cues, and how receptors can be modulated to mediate different cellular responses. I describe the UNC-40/DCC pathway in detail, and present examples of Netrin-independent functions of UNC-40. Lastly, I describe the use of muscle arm extension in C. elegans as a model system to study guided cell migration, and the Roy lab s efforts in identifying genes that are required for this relatively uncharacterized cell extension. 2

12 Chapter One 2. A General Introduction to Guided Cell Migration Guided cell migration and membrane extension is essential for the proper development and maintenance of animals. For example, the circumferential migration of neural crest cells in the embryo from the neural crest to the ventral midline, is essential for the development of many tissues at the ventral midline, including craniofacial tissue, tissues of the peripheral nervous system, and cardiac tissue (Sauka-Spengler and Bronner-Fraser, 2008; Trainor, 2005). During the life of the animal, cell migration is repeatedly employed in homeostatic processes such as wound healing and initiating an immune response (Horwitz and Webb, 2003). Perhaps because the signalling pathways that mediate guided cell migration are crucial to the health of the organism, they are strictly regulated, and have been the focus of much research. Many of the signalling pathways involved in guided cell migration are evolutionarily conserved. For example, much of what is known about vertebrate axon guidance was first discovered in simple model organisms. Slit and its receptor Robo were first identified for their role in mediating repulsive axon guidance in Drosophila (Brose et al., 1999; Kidd et al., 1999; Li et al., 1999), and UNC-6/Netrin and its receptors UNC-40/DCC and UNC-5/UNC5 were first identified in Caenorhabditis elegans for their roles in dorsoventral guidance (Chan et al., 1996; Hedgecock et al., 1990; Leung- Hagesteijn et al., 1992). Hence, genetically tractable organisms such as Drosophila and C. elegans have been instrumental to our understanding of guided cell migration. 3

13 Chapter One 3. Guided Cell Migration and Directed Membrane Extension A first step in guided cell migration is polarization, which leads to the formation of the leading and trailing edge of the cell. The leading edge is the site of rapid actin polymerization and active membrane protrusion. During migration, cell adhesions assemble at the leading edge and disassemble at the trailing edge. In a process called adhesion turnover, cell adhesions are disassembled, and components are recycled for the formation of new membrane adhesions at the nascent leading edge (Vicente-Manzanares et al., 2005; Webb et al., 2004). After membrane protrusion and subsequent stabilization of the leading edge occurs, the trailing edge is retracted, and this leads to whole-cell translocation towards higher concentrations of the stimulus. A well-studied example of directed membrane extension is the extension of neurons towards postsynaptic targets. The extension of an axon is led by a highly specialized and polarized structure at its leading edge called the growth cone (Figure 1.1). Instead of retracting the trailing edge, the growth cone leaves behind an axon tube. Another example of directed membrane extension is muscle arm extension towards motor axon targets in the development of C. elegans neuromuscular junctions. Muscle arm extension will be discussed in more detail later on in this chapter. In the past 15 years, many molecular mechanisms for guided cell migration and directed membrane extension have been characterized, and have been found to rely on similar principles. For example, the leading edge of cells and the growth cones of axons are both sites of rapid actin polymerization that lead to membrane protrusion. Indeed, 4

14 Chapter One EXTENDING FILOPODIA F-ACTIN BUNDLE ACTIN NETWORK RETRACTING FILOPODIA MICROTUBULES Figure 1.1 Directed Growth of an Axonal Growth Cone. Growth cones typically have both filopodia and lamellipodia, but with varying sizes and numbers of each. Differential shading in the background of the growth cone represents a graded distribution of a chemical stimulus (darker shades represent higher concentrations). Red lines represent F actin bundles within extending or retracting filopodia. These filopodia sample the environment via the specific proteins that are expressed on the cell membrane. Arrows next to the filopodia represent the direction of growth. Blue lines represent a two dimensional dense actin network of the lamellipodia. Lamellipodia provide the motor to drive extension. Green lines represent microtubules required for transport of material to and from the growth cone. 5

15 Chapter One many of the guidance pathways that regulate membrane protrusion in axon guidance are also involved in membrane protrusion during other types of guided cell migration. For example, besides guiding axons to their target destinations, the Netrin signalling pathway in vertebrates is also known to be involved in angiogenesis (Park et al., 2004). Because of the many parallels that exist between directed membrane extension and cell migration, unless otherwise stated, I will be referring to both types of cell migration collectively as guided cell migration for the remainder of this thesis. 4. Types of Migrations of Motile Cells Kinesis is the ability of a motile cell to migrate in response to a uniformly distributed stimulus. This is different from taxis, in which a motile cell elicits a directed response to a graded stimulus (Figure 1.2). Positive taxis occurs when a cell is attracted towards a stimulus, while negative taxis describes the repulsion of a cell from a stimulus. Several types of tactic responses have been identified, including thermotaxis (response to temperature), phototaxis (response to light), geotaxis (response to gravity) and barotaxis (response to pressure). Of most interest to guided cell biology is the ability of cells to undergo haptotaxis and chemotaxis. Haptotaxis is the migration of a cell up a gradient of cell adhesion sites or substrate bound chemoattractants, and chemotaxis is the directed migration of a cell in response to a chemical stimulus. Chemical stimuli can be in the form of gases, small molecules, peptides or proteins. In axon guidance, both haptotaxis and chemotaxis is observed when the growth cone extends up a gradient of cell adhesion sites, and protein ligands respectively. 6

16 Chapter One UNIFO RM A A A RANDOM MIGRATION RADED GR B B B DIRECTED MIGRATION GRADED C C C DIRECTED EXTENSION Figure 1.2 Migration in Response to a Chemotropic Cue. (A A ) Schematic of random cell migration in response to a uniform distribution of chemical stimulus. (B B ) Directed cell migration in response to a graded distribution of chemical stimulus (different shades of red; darker colours depict higher concentrations). (C C ) Directed cell extension in response to a graded distribution. In all cases, initial polarization of the cell occurs (differential shading of blue) (A, B, C ). Arrows depict the direction of whole cell migration or membrane extension. 7

17 Chapter One 5. General Mechanisms of Guided Cell Migration In guided cell migration, the dynamic nature of the leading edge of motile cells promotes actin-based extension towards target destinations (Dickson, 2002). These extensions include structures such as the filopodia and lamellipodia that help cells interpret their environment (Figure 1.1) (Hall, 1998; Svitkina and Borisy, 1999). Filopodia consist of F-actin bundles surrounded by membrane in which receptors and adhesion molecules important for guidance are embedded (Pollard and Borisy, 2003). Hence, filopodia sample the environment surrounding the cell. Upon detection of an attractive cue, filopodia and lamellipodia extend in a biased fashion towards higher concentrations of the cue. In contrast to the finger-like filopodial projections, lamellipodia consist of a two-dimensional dense actin network. This dense actin network is located in between individual filopodia and provides the motor to mediate movement across the substrate (Small et al., 2002). Growth cones and migrating cells extend both filopodia and lamellipodia, but typically have differing numbers of each. Differential adhesion, generation of mechanical force, and signal transduction at both the leading and trailing edges then serve to mediate extension up the concentration gradient of the cue (Cypher and Letourneau, 1992; Dickson, 2002). 6. Cue Interpretation: Cell-Surface Receptors of Extending Axons The precision of guided cell migration requires the combined effects of long- and short-range attractive and repulsive cues, and is mediated by the cell-surface receptors that are expressed (Guan and Rao, 2003; Tessier-Lavigne, 1994). In addition to single 8

18 Chapter One receptor-cue interactions, cell-surface receptors can homodimerize, heterodimerize, or undergo proteolytic processing to influence downstream responses to guidance cues. Although incomplete, a list of guidance cues and their receptors are provided in Table 1.1 below for key axon guidance molecules that have been extensively studied. Molecule C. elegans Drosophila Vertebrates Netrins UNC 6 Netrin A and B Netrin1 4 and β netrin Receptors UNC 40 Frazzled DCC, Neogenin UNC 5 Dunc5 UNC5A, B, C(RCM), and D Slits SLT 1 Slit Slit1 3 Receptors SAX 3 Robo1 3 Robo1, 2, 3(Rig), and 4 Semaphorins MAB 20, SMP 1, SMP2 Sema1 and 2 Sema subclasses 3 7 (and viral Sema) Receptors PLX 1, PLX 2 Plexin A and B Plexin A1 A4, B1 B3, C and D Neuropilin 1 and 2 Ephrins VAB 2, EFN 1 4, MAB 26 Ephrin EphrinA1 A6, B1 B3 Receptors VAB 1 Eph EphA1 A8, B1 B6 TGF β UNC 129 TGF β TGF β/bmp Receptors? 1 Babo, Wit, Punt BMP receptors UNC 40, UNC 5? 2? 2 Table 1.1 Key Molecules and Receptors Involved in Axon Guidance. This is an overview and a snapshot of five guidance molecules that have been extensively characterized for their involvement in axon guidance. 1 In C. elegans, UNC-129 functions in axonal guidance using novel signalling mechanisms, and has not been shown to interact with any BMP-like receptors. 2 UNC-129-UNC-40/UNC-5 interaction has not yet been shown in Drosophila or vertebrates. i) Combinatorial Expression and Hierarchical Ordering of Cell-Surface Receptors In axon guidance, depending on the combination of guidance receptors expressed, many guidance cues exert both long- and short-range attractive and repulsive pressures. For example, interaction of the secreted Slit molecule with Robo receptors lead to the precise longitudinal migration of ipsilateral axons to specific lateral positions in Drosophila melanogaster (Kidd et al., 1999). In the fly, Slit is expressed at the midline 9

19 Chapter One and functions as a chemorepellent to growth cones expressing a combination of three Roundabout (Robo) receptors (Brose et al., 1999; Kidd et al., 1999). Detailed genetic analyses have led to the proposal of a combinatorial Robo code in which specific combinations of Robo receptors lead to differential migratory destinations of axons (Simpson et al., 2000a). In the Drosophila central nervous system, medial axons closest to the midline express Robo, intermediate axons express both Robo and Robo3, and lateral axons furthest away from the midline express all three Robo receptors. It was found that lateral axons that are defective for the function of Robo3 extend along the intermediate axis, and disruption of both Robo2 and Robo3 causes mutant lateral axons to extend medially. This is further supported with the finding that ectopic expression of Robo3 causes axons to extend intermediately, and ectopic expression of both Robo2 and Robo3 causes axons to extend laterally (Simpson et al., 2000a; Simpson et al., 2000b). This suggests a mechanism in which expression of Robo2 and/or Robo3 in addition to Robo can amplify the repulsive effects of midline expressed Slit. Both attractive and repulsive guidance cues are located at the midline to guide axons towards it and repel others away from it. Commissural axons that cross the midline express receptors that respond to both attractive and repulsive cues and require dynamic resolution of these signals. Netrin (UNC-6 in C. elegans) is a chemoattractant expressed at the midline that guides commissural axons expressing the Deleted in Colorectal Cancer (DCC/UNC-40/Frazzled) guidance receptor towards the midline (Chan et al., 1996; Keino-Masu et al., 1996; Kolodziej et al., 1996). In Drosophila, midline-crossing commissures expressing Frazzled are first attracted to the midline by 10

20 Chapter One Netrin. After crossing the midline, commissures project along the midline and never recross it. This is explained by the finding that commissural growth cones initially do not express Robo, but once they cross the midline, Robo expression is up-regulated and mediates repulsion away from Slit (Kidd et al., 1999; Kidd et al., 1998b). It was initially thought that the ability of commissures to remain at the contralateral side is inherent in the specific gradients of attractive and repulsive cues. However, in Xenopus, it was later found that guidance receptors are hierarchically organized such that Slit mediated activation of Robo silences Netrin mediated attraction (Stein and Tessier-Lavigne, 2001). This silencing is achieved by the heterodimerization of activated Robo and DCC, and this is proposed to affect the complement of downstream adaptor proteins that DCC recruits. In C. elegans, motoneurons reside in the ventral nerve cord and extend axons circumferentially around the worm to the dorsal hypodermal ridge, where they fasciculate with pioneer axons and contribute to the dorsal nerve cord. UNC-6 is orthologous to vertebrate Netrin and is a secreted ligand that is enriched near the ventral midline (Ishii et al., 1992). Motor axons express both UNC-6 transmembrane receptors, called UNC-40 and UNC-5. While UNC-40 is required for attractive migration towards UNC-6, when coupled with UNC-5, UNC-40 mediates repulsive extension of motor axons away from ventral sources of UNC-6 (Chan et al., 1996; Hedgecock et al., 1990). Consistent with this, ectopic expression of UNC-5 in the laterally positioned mechanosensory neurons, which normally express UNC-40 but not UNC-5, causes the redirection of the normally ventrally-guided axons towards the dorsal midline (Hamelin et al., 1993). Subsequently, it was found that an interaction between the cytoplasmic 11

21 Chapter One domains of DCC and UNC-5B mediates Netrin-dependent repulsive migration (Hong et al., 1999). Heterodimerizaton of guidance receptors is a common theme in axon guidance. In addition to Robo-DCC and DCC-UNC5 interactions, Robo2 can heterodimerize with Robo (Simpson et al., 2000b), and the plexin-a receptor can heterodimerize with neuropilins to increase the variety of semaphorins they respond to (Rohm et al., 2000). Binding of plexin-a to neuropilin-1 confers sensitivity to Sema-3A, while binding of plexin-a to neuropilin-2 confers sensitivity to Sema-3F (Takahashi et al., 1999; Tamagnone et al., 1999; Winberg et al., 1998). Furthermore, the neurotrophin receptor p75ntr has been shown to act as a co-receptor for several axon guidance receptors including other structurally distinct neurotrophin receptors (TrkA, TrkB and TrkC) (Huang and Reichardt, 2003; Reichardt, 2006), the nogo receptor NgR (Wang et al., 2002; Wong et al., 2002), Ephrin-A (Lim et al., 2008) and Plexin (Ben-Zvi et al., 2007; Lee et al., 1992). Homodimerization of receptors also occur, as seen in DCC and Robo2 homodimers (Englund et al., 2002; Hong et al., 1999). Hence, accurate migration of cells can be achieved by the combination of receptors being expressed, and how different receptors can interact with each other to confer ligand-specificity. ii) Proteolytic Processing of Guidance Molecules and Receptors As described above, the guidance effects of Slit is mediated by a combination of Robo receptors. In addition to the combinatorial Robo code, Slit can be proteolytically processed to increase its long-range guidance capacity (Brose et al., 1999). Drosophila 12

22 Chapter One Slit, and mammalian Slit2 can be cleaved into N-terminal and C-terminal fragments by an unknown protease. The tightly cell-associated N-terminal Slit likely mediates shortrange repulsion, while the more readily diffusible C-terminal Slit likely mediates longrange repulsion (Brose et al., 1999). Hence, the versatility of long- and short-range Slit guidance is explained by combinatorial expression of cell-surface Robo receptors on responding cells, and also by the ability of Slit to be processed into cell-associated and readily diffusible cleavage products. Several transmembrane receptors including plexin-b, Notch, and DCC undergo proteolytic processing upon ligand binding. The extracellular domain of class-b Plexins is cleaved independently of ligand interaction and this cleavage is speculated to cause conformational changes that result in increased binding efficiency and functional responses to transmembrane semaphorins (Artigiani et al., 2003; Ayoob et al., 2006). For example, upon Notch interaction with Delta, a series of preoteolytic events generate a cytoplasmic cleavage product of Notch, which then translocates to the nucleus (Kidd et al., 1998a; Schroeter et al., 1998; Stifani et al., 1992; Struhl and Adachi, 1998). Once in the nucleus, the Notch cleavage product interacts with Suppressor of Hairless, which mediates upregulation of basic helix-loop-helix (bhlh) transcriptional repressors (Bailey and Posakony, 1995; Fortini and Artavanis-Tsakonas, 1994). In another example, DCC is a substrate for metalloprotease-dependent proteolytic processing that results in the removal of DCC ectodomains (Galko and Tessier-Lavigne, 2000). Proteolytic cleavage of the residual membrane-tethered DCC then generates an intracellular derivative of DCC (I-DCC) that is able to translocate into the nucleus where 13

23 Chapter One it activates transcription (Parent et al., 2005; Taniguchi et al., 2003). I-DCC-mediated transcription is suggested to attenuate DCC mediated intracellular signalling by mechanisms that are currently unclear (Taniguchi et al., 2003). Taken together, the function of guidance receptors can be modulated by several events including homodimer interactions, heterodimer interactions, and also by proteolytic processing. 7. Receptor-Mediated Signal Transduction In some migrating cells, upon interaction between a receptor and an attractive guidance cue, polarization is established to correctly orient the cell in the direction of the concentration gradient. In many cases, polarization of the cell is mediated by a PAR complex consisting of PAR3, PAR6 and atypical PKC (apkc), which associates with guanine nucleotide exchange factors (GEFs) that lead to Rac activation by CDC42 (Lin et al., 2000). In axon guidance, the PAR complex has been shown to be localized at the tip of the neurite that is destined to become the neuronal axon (Nishimura et al., 2005). Accompanying Rac activation, re-organization of the microtubule-organizing centre (MTOC), microtubules and the Golgi apparatus to the front of the nucleus towards the direction of migration occurs (Etienne-Manneville and Hall, 2002). Phosphoinositide signalling is also implicated in cell polarity by the production of phosphatidylinositol triphosphate (PIP3) at the leading edge by phosphoinositide 3- kinase (PI3K) (Iijima and Devreotes, 2002; Iijima et al., 2004). PTEN, which is localized to the sides and the rear of the cell, is a PIP3 phosphatase that regulates the levels of PIP3 (Stocker et al., 2002). After establishment, polarity is maintained by 14

24 Chapter One feedback loops that involve microtubulues, GTPases and differential localization of phosphoinositides (Ridley et al., 2003). Subsequent downstream recruitment of adaptor proteins ultimately leads to changes in actin modulation and membrane protrusion. Membrane protrusion is mediated by actin cytoskeletal changes that lead to the extension of filopodia and lamellipodia. Filopodia primarily consist of actin filaments bundled together in the same orientation by the cross-linking protein fascin (Vignjevic et al., 2006). Many proteins are enriched at the tip of filopodia such as N-WASP, Ena/VASP and Arp2/3 (Svitkina et al., 2003). Downstream of CDC42, N-WASP binds to both actin monomers and the Arp2/3 complex to form actin nucleation cores for polymerization (Rohatgi et al., 2000; Rohatgi et al., 1999). Ena/VASP further promotes membrane protrusion by inhibiting capping proteins that lead to branching (Bear et al., 2002). The ADF/Cofilin family of proteins have two roles to promote the assembly and disassembly of actin filaments (Bamburg, 1999). First, ADF/Cofilin increases the rate of actin disassembly at the pointed end, providing a pool of actin monomers for polymerization at the front. Second, in the presence of a pool of actin monomers, ADF/Cofilin promotes the severing of actin filaments which promotes assembly by providing free barbed ends for further polymerization and Arp2/3 nucleation. These proteins act together such that a treadmilling of actin monomer assembly and disassembly occurs to drive filopodial membrane protrusion. In lamellipodial protrusion, local activation of the Arp2/3 complex by the WASP/WAVE family of proteins at the leading edge induces actin branching to form a dense network of actin (Welch and Mullins, 2002). Actual membrane protrusion does 15

25 Chapter One not occur due to pushing on the plasma membrane via the polymerization of actin, but instead is believed to occur by an elastic Brownian-ratchet mechanism, in which random bending of actin filaments store elastic energy, and the release of this energy against the leading edge provides the force necessary to push membrane outwards (Pollard and Borisy, 2003). 8. The UNC-40/DCC Guidance Pathway The UNC-40/DCC pathway is a well characterized guidance pathway required for both axon guidance and guided cell migration. unc-40 mutants were first identified in C. elegans by Sydney Brenner in a screen for mutants that affect behaviour (Brenner, 1974). UNC-40 was subsequently found to guide circumferential migrations of pioneer axons and mesodermal cells some years later (Hedgecock et al., 1990; Hedgecock et al., 1987), and was cloned in 1996 (Chan et al., 1996). UNC-40 in C. elegans, its ortholog in Drosophila Frazzled, and its vertebrate orthologs Deleted in Colorectal Cancer (DCC) and Neogenin all encode a transmembrane guidance receptor that responds to Netrin cues (Chan et al., 1996; Keino-Masu et al., 1996; Kolodziej et al., 1996). The domain structure of UNC-40 contains six immunoglobulin (IG) domains, four fibronectin type- III (FN3) domains, a transmembrane domain, and a cytoplasmic domain of 308 residues. The cytoplasmic region of UNC-40 is further organized into three conserved regions, P1, P2, and P3 based on conservation with UNC-40 orthologs in other organisms. The transmembrane receptor UNC-40 guides a number of migrating cells along the dorsoventral axis, including the mechanosensory neurons in C. elegans. In C. 16

26 Chapter One elegans, mechanosensation is mediated by six neurons: the bilateral pair of ALM neurons just anterior to the vulva, the bilateral pair of PLM neurons located near the tail, and the AVM and PVM neurons that are located anterior to the vulva on the right-side of the worm, and posterior to the vulva on the left-side of the worm respectively (Goodman, 2006). Cell bodies of these neurons are all positioned laterally along the side of the worm. The AVM neuron sends an axon ventrally which then turns and extends anteriorly. This ventral extension is mediated in part by UNC-40, in response to the UNC-6 cue that is enriched ventrally (Chan et al., 1996). The impenetrant defects of AVM guidance in unc-6 null mutants suggest that pathways in addition to the UNC-40 pathway are required to regulate AVM axon guidance. Subsequently, it was found that AVM axon guidance requires an integration of signals from UNC-6 and SLT-1 that mediate attractive and repulsive effects through their receptors UNC-40 and SAX-3, respectively (Hao et al., 2001). Both UNC-40 and SAX-3 are expressed in the AVM neuron and work cell-autonomously to guide its ventral axon extension (Yu et al., 2002). UNC-6, through its receptor UNC-40, guides the AVM axon ventrally to the midline. Simultaneously, SAX-3 responds to a SLT-1 ligand secreted from the dorsal BWMs to mediate repulsion of the AVM axon (Hao et al., 2001; Yu et al., 2002). UNC-40 is also expressed in other neurons including the hermaphrodite-specific neurons (HSNs), which extend axons ventrally towards UNC-6 (Adler et al., 2006). In unc-40 null mutants, the HSN axon grows anteriorly instead of ventrally. It was subsequently found that UNC-40 s response to UNC-6 is required for the initial ventral polarization and neurite outgrowth of the HSN cell body, and is further supported by the 17

27 Chapter One ventral enrichment of UNC-40. UNC-34, MIG-10, and actin proteins have also been demonstrated to be ventrally enriched (Adler et al., 2006). UNC-34 is the C. elegans ortholog of Drosophila Enabled and mammalian Mena, which is part of a family of proteins including Vasp and Evl that can bind actin-associated proteins and nucleate actin polymerization (Nakagawa et al., 2001; Takenawa and Miki, 2001; Withee et al., 2004). UNC-34 has been demonstrated to bind MIG-10/Riam/Lamellipodin (Quinn et al., 2006), which contains PH-domains that are well known to interact with phospholipids. Indeed, ventral MIG-10 localization in the HSN also requires phospholipid signalling through AGE-1/PI3K and DAF-18/PTEN, which likely function together to maintain cell polarity (Chang et al., 2006). PI3K derived lipids are known to be required for proper chemotactic response in amoebae, as well as Xenopus growth cone turning towards a vertebrate homolog of UNC-6, Netrin-1 (Campbell and Holt, 2001; Comer et al., 2005; Kortholt et al., 2007; Ming et al., 1999). The cytoplasmic domains of UNC-40 are organized into three conserved motifs: P1, P2 and P3 (Kolodziej et al., 1996). The P1 domain mediates interaction between DCC and UNC5B for repulsive Netrin responses (Hong et al., 1999). Also, it was found that activation of UNC-40 mediated axon outgrowth and guidance requires UNC-34, CED-10 and UNC-115. UNC-34 was found to act through the cytoplasmic P1 motif of UNC-40, while CED-10 and UNC-115 act in a parallel pathway through the cytoplasmic P2 motif (Gitai et al., 2003). ced-10 encodes one of three C. elegans Rac proteins (Lundquist et al., 2001; Reddien and Horvitz, 2000), and unc-115 encodes an actinbinding LIM-domain containing protein, serving as a cytoskeletal effector of Rac 18

28 Chapter One signalling in axon guidance (Lundquist et al., 1998). Rac signalling is also required in vertebrates; both CDC42 and Rac1 are required for Netrin-stimulated neurite outgrowth mediated by UNC-40/DCC (Li et al., 2002; Shekarabi and Kennedy, 2002; Shekarabi et al., 2005). While both Rac and Rho GTPases stimulate actin-based membrane extension, Rac does this through WAVE and Arp2/3, and Rho GTPases such as RhoA and CDC42 s ability to stimulate membrane extension requires WASP (Pollard and Borisy, 2003). Both WAVE and WASP have been shown to be required for proper axon extension (Pinyol et al., 2007; Shakir et al., 2008). It is widely known that guanine nucleotide exchange factors (GEFs) are required to mediate the activity of Rac and Rho GTPases. Indeed, a very recent study reports the GEF Trio functioning downstream of Netrin-1 and DCC in mice (Briancon-Marjollet et al., 2008). Lastly, the P3 domain of DCC is required for both homodimerization as well as heterodimerization with the parallel guidance receptor Robo in vitro (Figure 3.1) (Stein and Tessier-Lavigne, 2001; Stein et al., 2001). In C. elegans, UNC-73 operates in all three Rac signalling pathways for proper CAN axon pathfinding (Lundquist et al., 2001). UNC-73 is the C. elegans ortholog of Drosophila Trio, a guanine nucleotide exchange factor (GEF). UNC-73 contains two tandem Dbl homology (DH) domains that can catalyze the exchange of GDP for GTP. The first DH (DH-1) domain of UNC-73 has been shown to function as a Rac-specific GEF, and the GEF activity of the DH-2 domain is specific for Rho (Steven et al., 1998; Steven et al., 2005). Disruptions in the DH-1 domain of UNC-73 results in axon guidance defects in multiple neurons including the ALM and PLM mechanosensory 19

29 Chapter One neurons, and the HSN (Steven et al., 1998). The naïve expectation of UNC-73 s role in neurite extension is to act downstream of guidance receptors, stimulating actin-based membrane extension via Rac. For ventrally growing axons expressing UNC-40, UNC-73 likely acts downstream of UNC-40 to stimulate Rac and actin-based membrane extension through WAVE and Arp2/3. However, in two independent investigations, results suggest that VAB-8 and UNC-73 act upstream of guidance receptors (Levy-Strumpf and Culotti, 2007; Watari-Goshima et al., 2007). vab-8 encodes a protein that contains a kinesin-like motor domain that is required for posteriorly-directed cell migrations, as well as axon outgrowth and guidance (Wightman et al., 1996; Wolf et al., 1998). Over-expression of VAB-8 in the PLM neuron causes reversal of PLM polarity. UNC-40 and SAX-3 overexpression in the PLM also results in this phenotype. Loss of function of UNC-73 can suppress the PLM reversals caused by over-expression of VAB-8, but not overexpression of UNC-40 or SAX-3. This suggests a general, albeit counterintuitive role of GEFs upstream of guidance receptors, as Rho and Rac GTPases are generally thought to function downstream. Although the idea that GEFs act upstream of guidance receptors is a heterodox one, it is conceivable that GEFs can act as intermediates between polarity and directed extension. For example, one signal may first polarize a particular cell before another signal mediates membrane extension of the same cell. In this case, GEFs mediate the initial polarity and are hence, upstream to the activity of the second signal that mediates extension. Recently, a novel transmembrane receptor called EVA-1 was discovered that physically interacts with both SLT-1 and SAX-3. EVA-1 is required for the proper 20

30 Chapter One extension of the AVM neuron, and is speculated to allow the SAX-3 receptor to respond to the SLT-1 guidance cue (Fujisawa et al., 2007). eva-1 and slt-1 single null mutants exhibit more defects than sax-3 single null mutants. Furthermore, the double null mutants eva-1; sax-3 and slt-1 sax-3 as well as the triple null mutant eva-1; slt-1 sax-3 exhibit the same level of defects as the sax-3 single null. This suggests a model in which SLT-1 or EVA-1 s absence allows SAX-3 to inhibit a guidance pathway that functions in parallel to SLT-1. This parallel pathway is most likely the UNC-40 pathway, and the proposed model is that SAX-3 inhibits UNC-40 activity in the absence of SLT-1. This is further supported by the report that UNC-40 and SAX-3 physically interact (Yu et al., 2002). However, in Xenopus it has been demonstrated that binding of UNC-40/DCC to Robo depends on Slit activation to silence its attractive response to Netrin (Stein and Tessier-Lavigne, 2001). It is possible that the vertebrate mechanisms for the hierarchical organization of UNC-40 and SAX-3 signalling are different from nematodes. In the presence of the co-receptor UNC-5, UNC-40 mediates repulsive extension away from the source of UNC-6 (Chan et al., 1996; Hedgecock et al., 1990). UNC-5 has a conserved domain organization: two extracellular IG and thrombospondin type-1 (Tsp) domains, a transmembrane domain, a zona occludens-1 motif (ZU-5), a DCC-binding domain (DB), and a death domain (DD) (Leung-Hagesteijn et al., 1992). The vertebrate homologs of UNC-5 are UNC5A-D. UNC5B was found to physically interact with DCC through their respective DB and P1 cytoplasmic domains (Hong et al., 1999). Longrange repulsion from UNC-6/Netrin is mediated by UNC-40 and UNC-5 heterodimer complexes (MacNeil et al., 2009). In C. elegans, UNC-5 also has UNC-40-independent 21

31 Chapter One roles that mediate short-range repulsion from UNC-6 sources. It has recently been shown that UNC-40-independent functions of UNC-5 responds to an UNC-129/TGF-β gradient that functions independent of canonical TGF-β receptors (MacNeil et al., 2009). In C. elegans, clr-1 was originally identified as a suppressor of loss of function egl-15/fgfr phenotypes (Kokel et al., 1998). clr-1 was also identified in an independent screen for suppressors of slt-1 mutant AVM defects (Chang et al., 2004). Subsequently it was found that CLR-1 acts in the UNC-40 pathway as a negative regulator of UNC-40 signalling. clr-1 encodes a receptor protein tyrosine phosphatase (RPTP) that has been shown to physically interact with UNC-40 (Chang et al., 2004). Furthermore, clr-1 s function in attenuating UNC-40 signalling is dependent on UNC- 34/Enabled. It is speculated that the role of CLR-1 is likely to inhibit UNC-40 signalling by dephosphorylating either UNC-40 cytoplasmic domains or UNC-34, or both at the same time. This model suggests that a protein tyrosine kinase must be present to phosphorylate UNC-40 and UNC-34; this kinase however, has yet to be discovered. Interestingly, RPTP deficient mice and Xenopus results in an enhanced rate of axon extension (Johnson et al., 2001; Thompson et al., 2003), suggesting a conserved mechanism in which the status of tyrosine phosphorylation of guidance receptors regulate their ability to respond to guidance cues. Lastly, in C. elegans, several UNC-6 independent roles for UNC-40 have been observed. The SDQR is a neuron positioned laterally along the right-hand side of the mid-body. Late in the first larval stage, the SDQR cell body migrates dorsally away 22

32 Chapter One from ventral UNC-6 expressing cells, suggesting that UNC-6 repels SDQR. Intriguingly, in the background of an unc-6 null mutant, SDQR migrates ventrally, suggesting that the SDQR responds to other underlying guidance cues. This response was demonstrated to be partially mediated by UNC-40 (Kim et al., 1999), suggesting that UNC-40 responds to other cues that are not UNC-6. These cues may either by ventral-directing, or may mediate repulsion of the cell body from dorsal sources. The C. elegans Nidogen has been proposed to be a novel ligand directing UNC-6 independent UNC-40 mediated SDQR migrations (Kim and Wadsworth, 2000). Although the Nidogen family of proteins are required as structural components of basement membranes, in C. elegans, it is not required for basement membrane assembly. In C. elegans, Nidogen is required for dorsoventral guidance of longitudinal neurons, as well as the guidance of axons that reside in the midline. In AVM axon guidance, it has been demonstrated that UNC-40 has an UNC-6- independent role in SAX-3 signalling. Ubiquitous expression of SLT-1 in the muscles redirects the ventral-extending AVM axon posteriorly. It was found that disruptions in unc-40, but not in unc-6, suppress this SLT-1 gain-of-function AVM extension phenotype, suggesting an UNC-6-independent role for UNC-40 (Yu et al., 2002). Subsequently, SAX-3 and UNC-40 were demonstrated to form a complex similar to that of UNC-5 and UNC-40. In the absence of UNC-40, both SAX-3 and UNC-5 can mediate guidance decisions, albeit in a less-efficient manner. The effect of guidance cues on SAX-3 and UNC-5 in combination with UNC-40 is much stronger, and underscores the versatility of UNC-40 in mediating various cellular responses. 23

33 Chapter One The QL cell migrates posteriorly on the left side of the animal to give rise to the PQR, PVM and SDQR neurons, and the QR cell migrates anteriorly on the right side to give rise to AQR, AVM and SDQL neurons. In an unc-40 null mutant, the descendents of Q-cells are often mislocated because the Q-cells themselves fail to migrate, and instead, polarize in random directions. In contrast, Q-cell migrations in the background of an unc-6 null mutation were the same as in wild-type, suggesting that UNC-40 s role in Q-cell migration is UNC-6 independent (Honigberg and Kenyon, 2000). Taken together, these observations underscore the dynamic nature of the UNC-40 transmembrane guidance receptor. UNC-40 can mediate both dorsoventral and anteriorposterior migrations, in both neuronal and non-neuronal cell types. In addition to mediating cellular responses to its canonical ligand UNC-6, it also has UNC-6 independent roles that include mediating signals from other guidance receptors. These observations suggest the presence of additional cues that mediate UNC-40 s function, or the presence of parallel pathways that provide polarity information. Further investigation of UNC-6-independent UNC-40-mediated guidance events will likely lead to the discovery of new genes and mechanisms of guided cell migration. 24

34 Chapter One UNC-6/NETRIN CLR-1 UNC-40 UNC-40 UNC-5 DCC DCC P1 P1 ZU5 P1 P1? P2 P2 DB P2 P2 AGE-1 DAF-18 UNC-73/Trio P3 P3 DD P3 P3 MIG-10 UNC-34 CED-10 UNC-115 WAVE Arp2/3 ACTIN DYNAMICS ATTRACTION REPULSION ATTRACTION Figure 1.3 UNC 40/DCC Signalling. g (A) UNC 6/Netrin mediated attraction involves UNC 34/Enabled, and CED 10/Rac with UNC 115/AbLIM that act through the P1 and P2 cytoplasmic motifs respectively. UNC 73/Trio is a likely GEF that mediates this. MIG 10 is modulated by phospholipid dynamics through AGE 1/PI3K and DAF 18/PTEN, and has been shown to bind to UNC 34. UNC 34 and CED 10 UNC 115 likely act through WAVE and Arp2/3 mediated actin dynamics to trigger attractive responses. CLR 1 may inhibit attractive response by phosphorylating UNC 40/DCC or UNC 34, or both. (B) UNC 40/DCC coupled with UNC 5/UNC5B elicits repulsion from UNC 6/Netrin sources. These two proteins physically interact through the P1 motif and DCC binding (DB) domain respectively. (C) Homodimerization of DCC requires the P1 cytoplasmic motif. This figure is partially adapted from Guan and Rao (2003). 25

35 Chapter One 9. Muscle Arm Development in Caenorhabditis elegans To study genes required for guided cell migration, the Roy lab exploits membrane extensions from the body muscles of C. elegans called muscle arms. In the adult C. elegans, there are 95 rhomboid-shaped mononucleate body-wall muscles that are required for locomotion. 14 of these are generated post-embryonically. These body-wall muscles (BWMs) are organized into four longitudinal quadrants, two that flank the dorsal nerve cord, and two that flank the ventral nerve cord. Each quadrant is comprised of two rows of BWMs in staggered conformation: a proximal and distal row relative to the nearest nerve cord (Sulston and Horvitz, 1977). The development of the nematode neuromuscular junction (NMJ) is atypical of other phyla. Instead of motor neurons extending processes to the muscle cells to make synapses, each of 95 BWMs in C. elegans extend muscle arms to their motor axon targets (Figure 1.4) (Dixon and Roy, 2005; Hedgecock et al., 1987). The post-synaptic elements of the neuromuscular junction reside at the tips of the muscle arms called the muscle arm termini (White et al., 1976). 16 BWMs located in the head (called head muscles) extend muscle arms exclusively to motor axons in the nerve ring. 16 BWMs located in the neck (called neck muscles) extend muscle arms to both nerve ring motoneurons and motor axons in the nearest nerve cord. The remaining 63 body muscles extend muscle arms exclusively to motor axon targets that reside in the nearest nerve cord. Muscle arms have simple morphology, consisting of thin stalks that emanate from muscle cell bodies and a bifurcated terminus when in contact with the motor neuron 26

36 Chapter One A dorsal muscle arm lateral hypodermal space ventral muscle arm B dorsal nerve cord dorsal left proximal dorsal left distal ventral left distal ventral left proximal ventral nerve cord Figure 1.4 Muscle Arm Extension in C. elegans. (A) Schematic of the right hand side of a C. elegans hermaphrodite. Body wall muscles (BWMs) are depicted as rhomboids. Pink and red BWMs extended muscle arms exclusively to their nearest nerve cord. Red rhomboids represent BWMs that express him 4p::MB::YFP. Blue lines represent commissural motor axons. (B) Magnifiedschematic of rectangle in (A). Neuromuscular anatomy of C. elegansconsist of BWMs extending thin actin based membrane stalks called muscle arms towards their nearest nerve cords. Schematics are courtesy of Peter John Roy. 27

37 Chapter One (Dixon and Roy, 2005). The extension of muscle arms has been shown to be a highly regulated process, as the shape, outgrowth location, and path taken by the muscle arm to reach the nerve cord is largely invariant (Dixon and Roy, 2005). The number of muscle arms that extend from the 63 BWMs that extend exclusively to the nearest nerve cord increases during development. At the onset of larval development, L1 hatchlings extend 1.7 muscle arms per BWM. The number of muscle arms increase to 3.5 per BWM before the second larval stage, and this number remains relatively constant until adulthood. This observation has lead to the proposal of a two-phase model of muscle arm development (Dixon and Roy, 2005). In the first phase, during embryogenesis, myoblasts juxtaposed with a motoneuron either migrate away or are displaced from the motoneuron, passively leaving behind one muscle arm. At the ultrastructural level, others have observed that myoblasts move away from the nerve ring and leave muscle arms behind during embryonic development (C. R. Norris, I. A. Bazykina, E. M. Hedgecock, D. H. Hall, personal communication to S. J. Dixon and P. J. Roy). The second phase of muscle arm development is characterized by active muscle arm extension during the second larval stage. This active extension is likely triggered by the birth and development of post-embryonic motoneurons that induce secretion of a guidance cue. The idea that muscle arms are guided was proposed as early as 1990 (Hedgecock et al., 1990). In wild-type animals, muscle arms extend towards the nearest nerve cords, such that the lateral hypodermal space is devoid of all muscle membrane extensions. In 28

38 Chapter One unc-5 mutants, commissural axon guidance is defective, and misguided commissural motor axons frequently form laterally misplaced axon tracts along the lateral hypodermal space. It was noticed that the muscle arms of unc-5 mutants frequently extend laterally into the hypodermal space to make contact with the laterally misplaced axon tracts (Dixon and Roy, 2005; Hedgecock et al., 1990). Furthermore, dorsal muscle arms no longer extend to the dorsal midline in unc-5 mutants. Also, it was observed that dorsal muscles of unc-104 mutants extend muscle arms towards ventral motoneuron cell bodies (Hedgecock et al., 1990). unc-104 encodes a kinesin motor required for anterograde vesicular transport along commissural axons, and electron micrographs show accumulation of electron-dense material in the ventral motoneuron cell bodies (Hall and Hedgecock, 1991; Otsuka et al., 1991). Taken together, these observations suggest a model in which a vesicle-packaged chemotropic cue is dorsally transported within the motor axons, and secreted to guide muscle arm extension to the nerve cord. 10. Previously Described Genes Required for Muscle Arm Extension Actin cytoskeletal remodelling is integral to guided cell migration to provide the force necessary for membrane protrusion (Pollard and Borisy, 2003). Given that the five actin genes in the C. elegans genome are largely redundant, the effects of actin perturbation on muscle arm extension was examined using a gain-of-function allele. An actin gain-of-function mutant resulted in a failure of muscle arms to contact the nearest nerve cord (Dixon and Roy, 2005), suggesting that modulation of actin is required for muscle arm extension. Subsequently, modulators of actin polymerization such as 29

39 Chapter One ADF/Cofilin and Tropomyosin were found to be required for the extension of larval muscle arms. The C. elegans ortholog of ADF/Cofilin is unc-60 and encodes an isoform (unc-60b) that is expressed specifically in BWMs, vulva and spermatheca (Ono et al., 1999; Ono and Benian, 1998). Loss-of-function in unc-60b results in larval muscle arm extension defects, as the average number of muscle arms per BWM is the same as that of wild-type hatchlings (Dixon and Roy, 2005). Specifically, the actin-depolymerising activity of ADF/Cofilin was found to be required for normal muscle arm extension, while the actin-severing activity was found to be dispensable. ADF/Cofilin s role in muscle arm extension is thought to provide a pool of free actin monomers for new actin filament formation (Dixon and Roy, 2005). Tropomyosin structurally reinforces actin filaments by antagonizing ADF/Cofilin-mediated actin disassembly (Cooper, 2002; Ono and Ono, 2002). It was found that lev-11, the C. elegans homolog of tropomyosin, is required for larval muscle arm extension because lev-11(rnai) treated animals extend no more muscle arms than wild-type hatchlings (Dixon and Roy, 2005). In addition to larval muscle arm extension defects, the embryonic muscle arms in lev-11(rnai) treated animals are wider than wild-type. This suggests a role for Tropomyosin in regulating embryonic muscle arm morphology. Intriguingly, unc-54 mutants defective in the production of muscle myosin heavy chain B (MHC-B) also extend fewer arms, and the muscle arms that extend are also wider (Dixon and Roy, 2005). MHC-B is a member of the muscle myosin II family and has never been demonstrated to have roles in membrane extension (Hodge and Cope, 2000; Sellers, 2000). It has been proposed that in migrating neutrophils, non-muscle myosin II 30

40 Chapter One promotes cell migration by creating tension within the cytoskeleton at the trailing edge, and also to promote disassociation of focal adhesion complexes with the substratum (Eddy et al., 2000). One hypothesis is that unc-54 and lev-11 cooperate to create actinfilament tension that is required to restrict muscle arm width and to drive muscle arm extension (Dixon and Roy, 2005). The tips of muscle arms harbour the post-synaptic elements of the neuromuscular junction. It was hypothesized that disruption of genes required for muscle arm extension would likely lead to locomotory defects. Indeed, unc-60(lf), unc-54(lf) and lev-11(rnai) animals are all paralyzed. In a screen to identify more genes required for muscle arm development, 847 genes that result in an uncoordinated or paralyzed phenotype were targeted by RNAi knockdown (Kamath et al., 2003; Simmer et al., 2003). It was found that integrin and laminin genes including lam-1, lam-2, epi-1, and pat-2 are all required for proper muscle arm extension (Dixon et al., 2006). Similarly, unc-52 which encodes the C. elegans ortholog of perlecan, which likely interacts with a PAT-2/PAT-3 integrin complex (Rogalski et al., 2000; Rogalski et al., 1993), is required for muscle arm extension. The role of integrins and laminins in muscle arm extension is still unclear, but it is possible that they could regulate the distribution of muscle arm guidance cues within the extra-cellular matrix. In an effort to identify a receptor that directs muscle arm extension, several conserved receptor tyrosine kinases were examined for possible roles in muscle arm extension. It was found that loss-of-function of egl-15/fgfr did not result in muscle 31

41 Chapter One arm extension defects, but resulted in ectopic membranous blebs along the muscle membrane (Dixon et al., 2006). Hence, FGFR signalling is likely required to prevent the formation of these blebs. CLR-1 is a muscle-expressed type II receptor tyrosine phosphatase that inhibits EGL-15 activity. To test if modulation of FGFR signalling is important for muscle arm extension, loss-of-function clr-1 mutants were examined. It was found that loss-of-function of clr-1 resulted in severe muscle arm extension defects, suggesting that proper modulation of FGFR signalling is required for muscle arm extension (Dixon et al., 2006). Insulin-like signalling was also identified to be a regulator of arm extension (Dixon et al., 2008). The lone insulin-like RTK in C. elegans is daf-2 (Kimura et al., 1997), and loss of daf-2 activity results in a supernumerary arm (Sna) phenotype (Dixon et al., 2008). This phenotype is characterized by a significantly increased number of muscle arms per BWM compared to wild-type. It was shown that insulin-like activity can regulate muscle arm extension non-autonomously, as loss of function of the downstream DAF-16/FOXO-family transcription factor in either the muscles or intestines can suppress daf-2-induced Sna extension. daf-2 plays many developmental roles in C. elegans, one of which is to regulate entry into an alternate developmental program called dauer (Gottlieb and Ruvkun, 1994; Kenyon et al., 1993). The dauer stage is a diapause-like state that promotes survival when animals are starved, or cultured in unfavourable conditions such as high temperatures and crowded populations (Cassada and Russell, 1975; Golden and Riddle, 1984a, b). Stressful conditions such as overcrowding, high temperatures or starvation did not induce the Sna phenotype in animals 32

42 Chapter One that did not enter dauer (Dixon et al., 2008). Furthermore, disruption of a TGF-β pathway that also regulates entry into the dauer program results in supernumerary arms, suggesting that supernumerary arms specifically arise from entry into the dauer program and not from stressful conditions. Since muscle arms are the post-synaptic partner of neuromuscular junctions, it is conceivable that an increase in muscle arm number may promote escape from harsh conditions. However, this idea could not be experimentally verified, despite significant effort (S.J.D., M.A. & P.J.R., unpublished observations). The Sna phenotype, and hence regulation of muscle arm extension, may be a novel dauer-specific phenotype that may facilitate some aspect of dauer behaviour. In summary, previous work demonstrated that: First, muscle arm extension requires the cytoskeletal modulators unc-60, unc-54 and lev-11. Second, several integrin and laminin genes including lam-1, lam-2, epi-1 and pat-2 are required for muscle arm extension and are likely involved in the distribution of guidance cues. Third, modulation of the FGFR signalling pathway alters the ability of muscle cells to extend muscle arms. Lastly, the dauer program induces the extension of supernumerary muscle arms that may facilitate dauer behaviour (Dixon et al., 2008). 11. Forward Genetic Screen for Muscle Arm Development Defective Mutants To identify additional genes required for muscle arm extension, Mariam Alexander and Teresa Lee performed a forward genetic screen for muscle arm development defective (Madd) mutants. The strain RP112 was used, which contains tris25, a chromosomally-integrated array of muscle-specific YFP and pan-neuronal 33

43 Chapter One DsRed2 as well as the prf4 (rol-6(su1006)) transgene, which causes worms to twist in helices (Kramer et al., 1990). The rolling phenotype of this strain facilitates screening because it allows for a portion of the ventral or dorsal midline to always be visible to the observer. 50,000 haploid C. elegans genomes were screened by looking for mutant worms that extend qualitatively fewer muscle arms on an epi-fluorescence emitting dissection microscope. Out of this screen, 23 genes were isolated, and grouped into 14 complementation groups based on relative mapping positions and complementation. Satisfyingly, alleles of unc-60 and unc-54 were isolated from the screen, suggesting that the screen was able to identify previously characterized genes known to regulate muscle arm extension. As previously described, unc-5 mutants extend muscle arms towards misguided axon tracts, and dorsal BWMs no longer extend muscle arms to the dorsal midline, suggesting that muscle arm defects are a secondary consequence to axon misguidance. However, ventral muscle arm extension in unc-5 mutants remains wild-type. Disruption of a key gene required for muscle arm extension should result in both dorsal and ventral muscle arm defects. The muscle arm defects of three alleles isolated from the screen can likely be attributed to secondary effects of misguided axons: tr114 and tr126 were respectively found to represent an allele of unc-33/crmp-2 and unc-51/ulk, both of which are required for axon outgrowth (Hedgecock et al., 1985; McIntire et al., 1992); (Ogura et al., 1994), and tr105 remains uncloned. An allele of unc-93 was also isolated, which encodes a regulatory subunit of a potassium-leak channel complex (de la Cruz et al., 2003; Levin and Horvitz, 1992). Further investigation must be done to elucidate the 34

44 Chapter One role of UNC-93 in muscle arm extension. Finally, six alleles (tr64, tr96, tr101, tr103, tr113 and tr129) of a novel complementation group called madd-2 were isolated. madd- 2 encodes the sole member of the C1-subfamily of tripartite motif (TRIM) proteins in C. elegans (Alexander et al., manuscript in preparation), and its characterization in muscle arm development will not be presented in detail here, because it forms the bulk of Mariam Alexander s Ph.D. thesis. The remaining alleles isolated from the screen include tr116, tr117, tr61, tr63, tr115 and tr121. I discovered that tr63, tr115 and tr121, are new alleles of unc-40/dcc. The discovery that unc-40 is required for muscle arm extension supports the idea that muscle arms are guided to the motor axons, because UNC-40 is a well characterized axon guidance receptor that responds to the secreted ligand, UNC-6 (Chan et al., 1996). Furthermore, the discovery of unc-40 allows for more informed genetic experiments, because data can be extrapolated from neuronal UNC-40 pathways. Lastly, in a collaborative effort with Alexandra Byrne and Mariam Alexander, tr117 was found to represent an allele of unc-73/rhogef/trio, tr116 was found to represent an allele of gex- 2/Sra-1, and tr61 was found to represent an allele of unc-95 which encodes a component of the C. elegans dense body (Broday et al., 2004). All these mutants have strong ventral muscle arm defects, suggesting a primary role for their corresponding wild-type gene products in muscle arm extension. This chapter has served as an introduction to guided cell migration, in which I first described the general mechanisms of migration, and then further described the roles 35

45 Chapter One of the guidance receptor, and the different ways receptors can be modulated to mediate various cellular responses. In the next chapter, I will present the results of my efforts in characterizing UNC-40 as a guidance receptor for muscle arm extension. I further present evidence that the extracellular domains of UNC-40 are dispensable for its function in directing muscle arms, suggesting the involvement of a co-receptor or parallel polarizing pathways. Lastly, using a neomorphic phenotype induced by UNC-40 overexpression, I ordered several Madd genes downstream of UNC-40, describing an UNC- 40 pathway that mediates muscle arm extension to motor axon targets. My work has increased our understanding of muscle arm extension by providing a well-conserved guidance receptor as a key component to muscle arm extension. This finding will greatly aid our efforts in the discovery of a muscle arm guidance cue. Furthermore, using what we already know of UNC-40 s roles in axon guidance, we can design more efficient strategies to study the role of UNC-40 in muscle arm extension. Finally, given that I have found differences between the UNC-40 pathway in muscle arm extension and the UNC-40 pathway in axon guidance, I can provide a more complete picture of how this conserved guidance receptor functions. 36

46 Chapter 2: Materials and Methods 37

47 Chapter Two 1. Molecular Biology Standard laboratory protocols were used in the manipulation of all bacterial strains used for molecular cloning. PCR reactions, ligations and digestions by restriction enzymes were performed as previously described (Sambrook, 2001). 2. Expression Constructs UNC-40::GFP with a 120bp deletion at the 5 end of exon 7: obtained by linearizing pzh94 (mec7p::unc-40::gfp with 120bp deletion, yet is sufficient to induce mechanosensory axon rerouting (Levy-Strumpf and Culotti, 2007)) with NotI and then isolating the 6.0kb fragment after a partial digest with NcoI.*GFP is inserted into exon 16 of UNC-40 cdna. pprkc256 (unc-119p::unc-40::gfp): 5.2kb NotI/NcoI fragment containing the unc- 119 promoter from pprrf182 (unc-119p::dsred2) was ligated to the 6.0kb UNC- 40::GFP fragment. *has 120bp deletion. pprkc257 (myo-3p::unc-40::gfp): 5.4kb NotI/NcoI fragment containing the myo-3 promoter from pprzl86 (myo-3p::dsred2) was ligated to the 6.0kb UNC-40::GFP fragment. *has 120bp deletion. pzh94.c (mec-7p::unc-40::gfp) corrected for 120bp deletion: pzh94 was first linearized with MluI and then digested with EcoRI to isolate a 9.3kb fragment. A 317bp MluI/EcoRI fragment from pzh223 (plasmid containing deleted fragment of pzh94 in 38

48 Chapter Two pbluescript-ks) was ligated to the 9.3kb MluI/EcoRI fragment from pzh94 to create pzh94.c. pprkc291 (corrected version of pprkc256): 650bp BsiWI/XcmI fragment from pzh94.c was ligated to a 10500bp BsiWI/XcmI fragment from pprkc256. pprkc292 (corrected version of pprkc257): 650bp BsiWI/XcmI fragment from pzh94.c was ligated to a 10700bp BsiWI/XcmI fragment from pprkc257. pprkc293 (UNC-40 cdna with complete exon 16 in pbluescript-ks): First, a 700bp PCR amplicon containing unc-40 genomic DNA was obtained using two primers that incorporates BamHI, Cfr10I and AgeI sites: unc-40ex16-5 : 5 -ctctacgtggaacacctccaa-3 unc-40ex17-3 : 5 -cgggatccaccggtaacttatccatactcgtctcaaaa-3 This PCR product was digested with BamHI and Cfr10I. Second, a 4.0kb Asp718/Cfr10I fragment was isolated from pprkc292. Third, pbluescript-ks was digested with Asp718 and BamHI. Lastly, all three fragments were ligated together to create pprkc293. pprkc294 (him-4p::unc-40::yfp): 4.6kb AgeI fragment isolated from pprkc293 was ligated into the AgeI site of pprzl183.1 (him-4p::yfp). 39

49 Chapter Two pprkc299 (him-4p::myr::unc-40(δecto)::yfp): First, a 1.5kb PCR amplicon containing the cytoplasmic domains of UNC-40 were amplified using two primers that incorporates Asp718 and NcoI restriction sites: MYRUNC40-5 : 5 - acgtggtaccaatgggtagctctaagtcgaaacgatctagtggtggagggcgaaag-3 MYRUNC40-3 : 5 -acccatggaacaggtagttttc-3 The 5 primer contains the MGSSKS myristoylation signal (underlined) (Kamps et al., 1985). This PCR product was digested with Asp718 and NcoI. Second, pprzl138.1 (him-4p::yfp) was digested using Asp718 and NcoI to obtain a 2.2kb fragment. Lastly, the two DNA fragments were ligated together to create pprkc299. pprkc321 (him-4p::mb::myr::unc-40(δecto)::yfp: 258bp Asp718 fragment containing the membrane anchor sequence from pprzl183.2 (him-4p::mb::yfp) was ligated into the Asp718 site of pprkc299. pprkc322 (UNC-40(Δcyto) in pbluescript-ks): First, a 500bp PCR amplicon containing the transmembrane domain of UNC-40 was obtained using two primers that incorporates EagI and AgeI restriction sites: unc-40-tm-5 : 5 -acgtgatctcactgtgctgcctgca-3 unc-40-tm-3 : 5 -gcatcggccgaccggtccactagatcgtttccaacaacacat-3 This PCR product was digested with EagI and PstI and ligated with pprkc293 digested with the same restriction enzymes to create pprkc

50 Chapter Two pprkc323 (him-4p::unc-40(δcyto)::yfp: 3.4kb AgeI fragment from pprkc322 was ligated with a 6.5kb AgeI fragment from pprkc Nematode Strains, Transgenics and Photomicroscopy Unless otherwise indicated, all nematode strains were cultured at 20 C according to standard protocols (Brenner, 1974; Lewis and Fleming, 1995). All mutants were obtained from the Caenorhabditis Genetics Center (CGC), except those that are designated with a RP or tr prefix, which were generated in the Roy lab. All muscle arm counts were performed in the background of the tris30 integrated array as previously described (Dixon and Roy, 2005). Transgenic animals were generated using standard microinjection techniques (Mello et al., 1991). To count muscle arms, worms were anaesthetized in 2-10mM levamisole (Sigma) in M9 solution (Lewis and Fleming, 1995) and mounted on a 1-2% agarose pad. Worms were manipulated such that either the ventral or dorsal nerve cord is facing the observer. A Leica DMRA2 HC microscope with standard Leica filter sets for GFP, YFP, CGFP and DsRed epifluorescence was used for all micrographs. Muscle arm counts were done using micrographs taken using a 20X or 40X dry objective, while localization analyses were done using a 63X oil-immersion objective. 41

51 Chapter Two 4. Forward Genetic Screen, Molecular Mapping and Complementation Tests The forward genetic screen was performed by Mariam Alexander and Teresa Lee. The screen was done in a semi-clonal manner by incubating mixed-stage populations of RP112 in 50uM ethyl methanesulfonate (EMS) for four hours as previously described (Brenner, 1974). RP112 animals contain tris25 [pprrf138.2 (him-4p::mb::yfp), pprzl47 (F25B3.3p::DsRed2), prf4 (rol-6(su1006)] and rrf-3(pk1426). Two to three resulting F1s were dispensed into each well of a 12-well plate seeded with the OP50 strain of E. coli using the COPAS (Complex Object Parametric Analyzer and Sorter) Biosort (Union Biometrica). Adult F2s were screened 4 days later using a Leica MZFLIII epifluorescence dissection microscope with a 2X objective. Madd mutants isolated from the screen were bulk mapped to a chromosome interval by snip-snp mapping (Wicks et al., 2001). Single worm genetic mapping was subsequently performed to narrow down the genetic interval containing the mutation. Complementation tests were performed by crossing tris30 into canonical alleles of candidate genes (gene-x). Resulting gene-x/+; tris30/+ males were crossed into the Madd mutant under investigation. Muscle arms were counted on resulting Madd progeny. 5. Quantification of Muscle Arms and Neuronal Guidance All muscle arm counts were performed in the background of tris30 as previously described (Dixon and Roy, 2005). Dorsal muscle arm counts were counted from muscle 15 in the dorsal right quadrant (DR15) and ventral muscle arm counts were counted from 42

52 Chapter Two muscle 11 in the ventral left quadrant (VL11) for 30 individual young adults. These muscles were chosen because they are easily recognized. To assay for axon guidance defects, mutants in the background of tris30 were manipulated such that the dorsal cord was facing the observer. Commissural axons from the right side of the worm that fasciculated with the dorsal nerve cord were counted beginning from the pharynx of the worm to its tail for 30 individual young adults. 6. Temperature Sensitivity Experiments Temperature sensitivity experiments were done by culturing worms at 15 C, 20 C or 25 C. The same procedures were used for muscle arm and neuronal guidance counts as described above. 7. UNC-40 Over-expression Ectopic myopodia were induced by injecting pprkc294 (him-4p::unc- 40::YFP) (50ng/ul) with co-injection markers pprgs317 (him-4p::mb::cfp)(20ng/ul) and ppr1.1 (unc-25p::dsred2) (10ng/ul) into various control and experimental strains. Myopodia were counted from the outer row of muscles (numbers 9-19) on the dorsal right quadrant of 15 independent F1 transgenic progeny. To examine the UNC-40::YFPinduced myopodia in a background compromised for wve-1, the injection mixture described above was injected into the RNAi-hypersensitive mutant rrf-3(pk1426). wve- 1(RNAi) or negative control RNAi-inducing bacteria were then fed to injected nematode parents as previously described (Timmons and Fire, 1998). 43

53 Chapter Two 8. Genetics For gex-2 and gex-3 experiments, tris30/+ males were crossed into either gex- 2(ok1603) or gex-3(zu196) hermaphrodites. Resulting tris30 homozygous animals were cloned from tris30/+; gex- /+ progeny that segregated sterile animals. Muscle arms were counted from 30 individual sterile animals that segregated from tris30 homozygous populations. For candidate co-receptor experiments, the strains RP1263 and RP1264 were used. RP1263 and RP1264 represent two independent lines of unc-40(n324) tris30; Ex[pPRKC299 (him-4p::myr::unc-40(δecto)::yfp) (10ng/ul), pprgs317 (him- 4p::MB::CFP)(20ng/ul), myo-2p::yfp (10ng/ul)]. Heterozygous males of these two strains were crossed into various candidate co-receptors, and the MYR::UNC-40(Δecto) transgene was followed by the myo-2p::yfp marker. 9. RNAi Experiments All RNAi experiments were performed by feeding worms dsrna-producing bacteria as previously described (Timmons and Fire, 1998). Negative control RNAi was the L4440 plasmid provided by the Fire lab. 44

54 Chapter 3: The Transmembrane Receptor UNC-40 Directs Muscle Arm Extension in Caenorhabditis elegans 45

55 Chapter Three Dr. Joseph Culotti and his group (Samuel Lunenfeld Research Institute and Department of Molecular Genetics, University of Toronto) first cloned unc-40, and provided me with many valuable resources, including many unsequenced unc-40 alleles, a plasmid containing the unc-40 minigene (psc11), a mechanosensory neuron specific UNC-40 expression construct (pzh94), as well as the strain evis103 that has a chromosomallyintegrated array driving UNC-40::GFP expression by its native promoter (Chan et al., 1996). Sequence information for all unc-40 alleles that I have obtained from Dr. Culotti s lab, as well as alleles we isolated in our own lab are summarized in Figure 3.3A. 46

56 Chapter Three 1. Introduction Guided cell migration and membrane extension events are crucial to the proper development and maintenance of multi-cellular organisms. For example, the development of the mammalian nervous system requires the orchestrated migration of neuroblasts and accessory cells to their final destinations. Neurons then precisely extend axons to their post-synaptic partners such as the skeletal muscles and form a neuromuscular junction (NMJ) that is essential for motor activity. To identify new components involved in guided cell migration and extension, we study the post-synaptic membrane extensions of C. elegans NMJs. In the formation of the mammalian NMJ, synaptic boutons on extending motor neurons innervate striated muscles. The postsynaptic membrane does not just passively accommodate the growth cone. For example, the embryonic muscles of flies and mammals extend microprocesses called myopodia toward incoming growth cones (Ritzenthaler and Chiba, 2003). This myopodial extension is thought to be an essential target recognition step that allows for highly reproducible synaptic pairing (Ritzenthaler et al., 2000). Once target recognition has occurred, the postsynaptic membrane undergoes dramatic expansion to give rise to the highly convoluted and multi-layered subsynaptic reticulum (SSR), where receptors, ion channels and other postsynaptic elements reside (Gorczyca et al., 2007; Marrs et al., 2001; Slater, 2008). Mutations in genes required to maintain the SSR result in compromised electrophysiology of the NMJ (Gorczyca et al., 2007), underscoring the importance of postsynaptic dynamics on NMJ integrity. 47

57 Chapter Three In the tiny nematode worm C. elegans, the BWMs extend multiple postsynaptic membrane structures called muscle arms, to form NMJs with their motor axon targets (Dixon and Roy, 2005; Hedgecock et al., 1990). Molecular markers previously developed in the lab allow for clear visualization of muscle arms, which allow for detailed genetic characterization of genes involved in post-synaptic membrane extension. To further understand the biology of muscle arm extension, an unbiased forward genetic screen for muscle arm development defective (Madd) mutants was performed by Mariam Alexander and Teresa Lee in the Roy lab. From this, 23 genes in 14 complementation groups were isolated, including genes that encode cytoskeletal regulators such as UNC- 60B/Cofilin, UNC-54/MHC-B, UNC-73/Trio, and a member of the WAVE actin nucleation complex (Table 3.1)(Alexander et al., 2009). When I joined the lab, my project was to characterize the first complementation group that was isolated from the screen, madd-1. I found that alleles of madd-1 represent the unc-40 gene, which encodes UNC-40/DCC, a single-pass transmembrane guidance receptor characterized by four immunoglobulin domains, six type III fibronectin (FNIII) domains, a transmembrane domain, and a cytoplasmic domain of 308 residues (Chan et al., 1996). In this chapter, I describe the role of UNC-40 in muscle arm extension and postulate that UNC-40 is required at the leading edge to direct muscle arm extension to motor axon targets. I demonstrate that UNC-40 is required cell-autonomously in the BWMs for muscle arm extension, and that UNC-40 is enriched at muscle arm termini. I developed an assay to order other Madd genes relative to unc-40 by using a neomorphic phenotype I call ectopic myopodial extensions that is induced by UNC-40 over- 48

58 Chapter Three expression. From this, I found that homologs of the C. elegans focal adhesion complex, components of the WAVE complex, as well as the C. elegans Rho GEF, unc-73, all likely function downstream of UNC-40. Finally, I provide evidence that the cytoplasmic domains of UNC-40 are sufficient for muscle arm extension, and that PAT-2, a C. elegans α-integrin, may be a co-receptor for UNC-40 s function in muscle arm guidance. 49

59 Complementa tion Group LG 1 Allele Failed to Contributing Complement 2 Homolog Mutation 3 Authors 4,5 1 gex 2 IV tr116 ok1603 Sra 1 R420Stop MA, JO 2 madd 2 V tr64 MID1 L667F MA 3 tr96 A745T MA 4 tr101 I503N MA 5 tr103 R304Stop MA 6 tr113 Rearrangement MA 7 tr129 Q147Stop MA 8 unc 33 IV tr114 e204 CRMP 2 R502H AB 9 unc 40 I tr63 n324 DCC/Neogenin Intron 6 splice KC donor 10 tr115 n324 W1107Stop KC 11 tr121 n324 exon 8 splice KC, AB donor 12 unc 51 V tr126 e369 ULK2 I59T AB 13 unc 54 I tr112 e190 MHC B MA 14 tr124 e190 MA 15 unc 60B V tr125 su158 ADF/Cofilin G44E MA 16 tr50 su158 MA 17 unc 73 I tr117 e936 Rho GEF E1335K AB 18 unc 93 III tr120 sd e1500 UNC 93 G388R EW 19 unc 95 I tr61 su33 UNC 95 intron 1 splice MA acceptor 20 I tr98 d 21 I tr I tr I tr123 Chapter Three Table 3.1 Mutants Isolated from A Forward Genetic Screen for Genes Required for Muscle Arm Extension. 1 The linkage group (LG), or chromosome for each corresponding allele is shown. 2 If performed, the allele used for each complementation test is shown. 3 Mutant residue is shown. For tr113 (row 6), the mutation is a complex rearrangement. For tr63 (row 9), a guanine-to-adenine mutation in the invariant first nucleotide of the splice donor of intron 6 (g4869a) likely causes improper splicing (Cartegni et al., 2002), resulting a truncated protein after the first IG domain. For tr121 (row 11), a guanine-to-adenine mutation in the last nucleotide of exon 8 likely disrupts splicing (Farrer et al., 2002). If splicing is disrupted, an additional 99 codons are translated, followed by a stop codon resulting in a truncated protein after the fourth IG domain. If splicing occurs normally, the mutation in tr121 results in a D426N missense mutation between the fourth IG domain and the first FNIII domain. 4 Initials of the contributing author in the cloning of the allele is shown. MA: Mariam Alexander, JO: Jasmine Ono, AB: Alexandra Byrne, KC: Kevin Chan, EW: Eric Wong. 5 Guillermo Selman and Mariam Alexander contributed to the initial bulk mapping of all the alleles. sd Muscle arm phenotype is semi-dominant. d Muscle arm phenotype is dominant. 50

60 Chapter Three 2. Results 2.1. UNC-40/DCC is Required for Muscle Arm Extension in C. elegans. i) madd-1 Represents Three New Alleles of unc-40. The forward genetic screen for muscle arm development defective (Madd) mutants was a semi-clonal screen performed by Mariam Alexander and Teresa Lee by incubating mixed-stage RP112 animals in ethyl methanesulfonate (EMS) (Alexander et al., 2009). Second generation adult progeny of mutagenized parents were screened for obvious defects in the number of muscle arms extending to respective nerve cords. The screen resulted in the isolation of 23 alleles representing 14 complementation groups that have been assigned based on relative mapping positions and similarity of phenotypes (Table 3.1). Of the 14 complementation groups, the group represented by the second largest number of alleles was tentatively assigned the name madd-1, as it contains one of the first Madd alleles that were isolated. The three alleles of madd-1 that were isolated are tr63, tr115, and tr121, and were grouped together because they were all mapped to the middle of chromosome I, and failed to complement one another. Taking advantage of the highly polymorphic C. elegans strain from Hawaii, single nucleotide polymorphism (SNP-snip) mapping (Wicks et al., 2001) was performed, and tr63 was mapped to a 1.5Mbp interval between -0.73cm and +0.97cm. This 1.5Mbp interval encoded 365 genes. In addition to their Madd phenotype, tr63 and tr115 were also short (dumpy or Dpy), uncoordinated (Unc) and egg-laying defective (Egl-d). To further investigate the 51

61 Chapter Three muscle arm extension and axon guidance of these mutants, I crossed the tris30 chromosomally integrated transgenic array into tr63 and tr115. tris30 harbours the constructs him-4p::mb::yfp, hmr-1b::dsred2, and unc-129p::dsred2, which allows for the visualization of muscle arms and motor axons in different fluorescent channels. In addition to muscle arm defects, I found that both alleles had dramatic axon guidance defects (Figure 3.1A-F). Out of the 365 genes in the 1.5Mbp interval, only unc-40 confers Unc, Egl-d, Dpy and axon guidance phenotypes when mutated (Hedgecock et al., 1990; Hedgecock et al., 1987). To determine if madd-1 is allelic to unc-40, I performed complementation tests using a null allele of unc-40 (n324). Since both madd-1 and the fluorescent marker tris30 is located close to each other on chromosome I, tris30 proved to be a useful marker for following the segregation of madd-1 alleles. I first established that tr63 and tr115 acted recessively when I observed that all heterozygous progeny from a wild-type out-cross had normal muscle arm extension and axon guidance. When I examined tr63tris30/n324 and tr115tris30/n324 trans-heterozygotes, all animals were muscle arm and axon guidance defective (Figure 3.2). In collaboration with Alexandra Byrne, we found that the third madd-1 allele (tr121) that had weaker muscle arm and axon guidance defects also represented an allele of unc-40. With the help of Guillermo Selman and Rachel Puckrin, we identified polymorphisms in unc-40 for tr63, tr115 and tr121. tr63 was found to carry a guanineto-adenine mutation in the invariant first nucleotide of the splice donor of intron 6 (g4869a). This likely causes improper splicing of intron 6 (Cartegni et al., 2002) 52

62 Chapter Three A. wild type B. madd-1(tr63) ( ) C. madd-1(tr115) D. madd-1(tr121) D. madd-1(tr121) E. wild type E. wild type F. madd-1(tr63) F. madd-1(tr63) Figure 3.1 madd 1 has Severe Muscle Arm and Axon Guidance Defects. (A D) Fluorescent micrographs of ventral left and right distal BWMs in representative animals of indicated genotypes. Fluorescence in all animals is driven by the tris30 integrated array which harbours him 4p::membrane anchored YFP and pan neuronal DsRed2 (see Materials and Methods). Right is up, anterior is to the right. Motoneuronal cell bodies and commissural axons are false coloured blue. Yellow arrows indicate the ventral nerve cord. Red arrows indicate muscle arms extending from the ventral left muscle 11 (VL11). (E F) Fluorescent micrographs showing commissural axon guidance on the right hand side of animals of indicated genotypes. Ventral is bottom, anterior is to the right. Motoneuronal cell bodies extend commissures circumferentially around the animal to the dorsal cord. Green arrow in F indicates a misguided commissure. 53

63 Chapter Three 4 3 Arms/ /BWM Figure 3.2 madd 1 Represents Alleles of unc 40. Summary of average number of muscle arms extending from dorsal right muscle 15 (dark gray) and ventral left muscle 11 (light (g gray) of 30 individual animals of indicated genotypes. Complementation tests were performed using the null allele unc 40(n324). Trans heterozygotes are indicated by n324/x where X is the corresponding madd 1 allele. Error bars represent standard error of the mean. 54

64 Chapter Three resulting in the translation of an additional 11 codons followed by a stop codon, and a truncated protein after the first IG domain. The tr115 mutation encodes an early stop codon (W1107Stop) in the transmembrane domain of the UNC-40 protein. tr121 was found to be a guanine-to-adenine mutation in the last nucleotide of exon 8. According to Alan Zahler s group, this will likely disrupt splicing (Farrer et al., 2002). If splicing is disrupted, an additional 99 codons are translated after the fourth IG domain, followed by a stop codon. If splicing occurs normally, the mutation in tr121 results in a D426N missense mutation between the fourth IG domain and the first FNIII domain. Since I have shown that alleles of madd-1 are allelic to unc-40, most work henceforth was done on the putative null allele unc-40(n324). ii) Temperature-Sensitivity Analysis of unc-40 Alleles Temperature-sensitive alleles are useful genetic reagents because they allow for the detailed temporal analysis of a gene product s requirement. To determine if any unc- 40 alleles are temperature sensitive with regards to muscle arm extension, I first sequenced all available unc-40 alleles to find any that contain missense mutations (Figure 3.3A). Next, I examined muscle arm extension in several missense unc-40 alleles that were each raised at 16 C, 20 C, and 25 C (Figure 3.3B). If an allele is temperaturesensitive, the number of muscle arms that a representative animal extends at 25 C should be dramatically fewer than the number of arms it extends at 16 C. I have found that the alleles ev502 and ev546 extend significantly fewer muscle arms at 25 C compared to 16 C (p<0.001) (Figure 3.3B). However, the increase in muscle arm defects is not so 55

65 Chapter Three signal IG IG IG IG FNIII FNIII FNIII FNIII FNIII FNIII TM P1 P2 P3 A. Domain Organization of UNC-40 and Nature of unc-40 Alleles. 5 16C 20C 25C 4 3 * 2 * 1 0 tris30 ev502 ev507 ev546 n473 tr63 tr183 B. Temperature Sensitivity of Muscle Arm Extension in unc-40 Mutants. Figure 3.3 Domain Organization of UNC 40. (A) A schematic of UNC 40 domains as predicted by Simple Modular Architecture Tool (SMART), approximately to scale. Various unc 40 alleles are indicated with arrows. Alleles that are underlined are those of which polymorphisms were identified in the Roy lab. (B) Temperature sensitivity of muscle arm extension in various unc 40 mutantalleles alleles. All muscle armcounts were done in the background of the tris30 integrated strain. All counts presented are an average number of muscle arms per ventral left quadrant muscle 11 in 30 young adults. Asterisks represent p<0.001 compared to the muscle arm number of the same allele at 16 C. Error bars represent standard error of the mean. 56

66 Chapter Three dramatic as to warrant a detailed temporal analysis of the requirement of unc-40 in muscle arm extension. iii) tr176 May Represent a Muscle Arm Specific Mutation of unc-40 Forward screens performed by Serena D Souza and Louis Barbier to find additional genes required for muscle arm extension resulted in the isolation of tr176. tr176 is characterized with muscle arm extension defects (on average 1.5 muscle arms compared to 3.3 in wild-type animals), but no obvious axon guidance defects or locomotory defects. Rachel Puckrin performed bulk mapping and found that the tr176 mutation is in the middle of chromosome I, and Serena determined that tr176 fails to complement unc-40(n324), suggesting that tr176 may represent an allele of unc-40 that has a mutation specifically in regards to its role in muscle arm extension. To determine whether failure of tr176 to complement unc-40(n324) is a result of non-allelic noncomplementation, I crossed tr176 into the background of tris34, which is a strain that harbours an integrated array of muscle-specific UNC-40::YFP (transgenic rescue of unc- 40 mutants is further discussed below). I found that transgenic expression of musclespecific UNC-40::YFP in the background of tr176 results in a significant rescue of muscle arm extension defects from 1.5 to 3.7 muscle arms (p<0.001), suggesting that tr176 is a novel allele of unc-40. With the help of Rachel Puckrin, we sequenced the exons and splice-sites of tr176 and could not identify any polymorphisms. This raises the possibility that the mutation in tr176 could be in a muscle arm-specific enhancer element in the promoter. This investigation is currently ongoing. 57

67 Chapter Three iv) unc-40, but not unc-6 is Required for Muscle Arm Extension I next examined other components of the unc-40 pathway to see if they were also involved in regulating muscle arm extension. Although commissural axons in mutants of the unc-40 pathway are misguided and rarely reach the dorsal midline, their outgrowth from ventral cell bodies is relatively normal. Therefore, the ventral nerve cord remains relatively intact. Hence, loss of function of a gene required for muscle arm extension should have compromised ventral muscle arm extension, irrespective of axon guidance defects. I found that unc-40(n324) mutants extend dramatically fewer ventral muscle arms than wild-type (Figure 3.2 and Figure 3.4B,F), consistent with the idea that unc-40 is required to direct muscle arm extension. To investigate the roles of other unc-40 components in muscle arm extension, I examined ventral muscle arm extension in unc- 5(e53) and unc-6(ev400) mutants. Ventral muscle arm number in unc-5(e53) mutants is not different from wild-type controls (p>0.1), suggesting that it has no direct role in muscle arm extension (Figure 3.4C,F). As described previously, unc-6 encodes a laminin-related ligand for UNC-40 in axonal guidance. The ventral muscle arm number of the nulls unc-6(ev400) and unc- 6(e78) are indistinguishable from wild-type (p>0.1) (Figure 3.4D-F), suggesting that UNC-6 is not required for muscle arm extension. v) UNC-40 Directs Muscle Arm Extension to Motor Axon Targets In unc-5 and unc-6 mutants, commissural motor axons are misguided and form lateral axon tracts along the side of the worm. In these mutants, BWMs are observed to 58

68 Chapter Three A. wild type A. wild type 5 4 B. unc-40(n324) B. unc-40(n324) C. unc-5(e53) D. unc-6(ev400) Arms/BWM E. unc-6(e78) E. unc-6(e78) F. Ventral Muscle Arms in UNC-40 Pathway Components Figure 3.4 UNC 6 is Not Required for Proper Muscle Arm Extension. (A E) Fluorescent micrographs of ventral BWMs of indicated genotypes. Annotation is the same as in Figure 3.1. Red arrows indicate individual muscle arms extending from ventral left muscle 11. Yellow arrows indicate the ventral nerve cord. (F) Summary of average number of muscle arms extending from dorsal right muscle 15 (dark gray) and ventral left muscle 11 (light gray) of 30 individual animals of indicated genotypes. Ventral muscle arm extension in unc 5 and unc 6 nulls is not compromised. Error bars represent standard error of the mean. 59

69 Chapter Three A. Body-Wall Muscles Extend Muscle Arms Errant Arms/BWM B. Muscle Arms Extend to Misguided Motor Axon Targets C. Errant Lateral Muscle Arms Figure 3.5 UNC 40 is Required to Direct Muscle Arm Extension to Motor Axon Targets. (A) A schematic of muscle arm extension in wild type animals. Distal BWMs (red) extend muscle arms to their nearest nerve cord (blue). (B) Schematic showing errant muscle arm extension to misplaced axon tracts in mutants defective for commissural axon guidance. (C) Summary of the number of errant muscle arms in various genotypes. Loss of function of unc 40 suppresses the errant muscle arm extension of axon guidance mutants. t Error bars represent standard error of the mean. 60

70 Chapter Three extend errant muscle arms towards these misplaced axon tracts (Figure 3.5A-B) (Dixon and Roy, 2005; Hedgecock et al., 1990), suggesting that the motor axons may secrete attractive cues to guide muscle arm extension. In support of this idea, muscle arms are seen to extend towards areas of dense core vesicle accumulation, in the motoneuronal cell bodies of unc-104 mutants that have disrupted axonal anterograde vesicular transport (Hall and Hedgecock, 1991; Zhou et al., 2001). I found that unc-5(e53) and unc-6(ev400) mutants extend about 4 and 6 errant muscle arms to laterally misplaced axon tracts respectively. Despite also having misguided commissures, the number of errant muscle arms in unc-40(n324) mutants is no more than that of wild-type controls. This suggests a requirement of unc-40 in directing muscle arm extension to motor axon targets. If this is indeed the case, disruption of UNC-40 function in both unc-5(e53) and unc-6(ev400) animals should suppress the extension of errant muscle arms. When I examined the number of errant muscle arms in the double mutants unc-5(e53); unc-40(n324) and unc-6(ev400); unc- 40(n324), I found that the number of errant muscle arms was significantly suppressed (p<0.01) (Figure 3.5C). Taken together, these results suggest that UNC-40 is required to direct muscle arm extension to motor axon targets. vi) UNC-40 is Expressed in the Body Wall Muscles UNC-40 expression in the BWMs has never been documented in the literature. Since UNC-40 is required for muscle arm extension, I hypothesized that UNC-40 is expressed in the BWMs. To test this, I first examined the expression pattern of UNC-40 in the evis103 chromosomally integrated transgenic array that harbours unc-40p::unc- 61

71 Chapter Three 40::GFP and a dominant rol-6 mutation. As expected, UNC-40::GFP was obviously expressed in the nervous system. In support of my hypothesis, UNC-40::GFP was also expressed in the BWMs, with enrichment at the muscle plasma membrane (Figure 3.6A). To examine the subcellular localization of UNC-40 in the muscle cells, I examined the expression of an UNC-40::YFP fusion protein driven by the him-4 promoter (pprkc294). The him-4 promoter directs expression specifically to the outer row of BWMs (Vogel and Hedgecock, 2001), and allows for an unobstructed view of individual muscle arms. UNC-40::YFP is obviously enriched at the muscle arm termini in transgenic animals expressing UNC-40::YFP in muscles (Figure 3.6B). UNC-40::YFP can also be seen throughout the muscle plasma membrane. The chromosomally integrated tris34 transgenic array harbours muscle-specific UNC-40::YFP expressed at much lower levels. Observations made by Alexandra and I show that in tris34 animals, the expression of UNC-40::YFP is further restricted, such that UNC-40::YFP is localized exclusively at the muscle arm termini (Figure 3.6C). vii) UNC-40 Acts Cell-Autonomously to Regulate Muscle Arm Extension To investigate where UNC-40 is required to autonomously regulate muscle arm extension, I tested whether UNC-40 could rescue the Madd phenotype of unc-40(n324) when expressed specifically in either the nervous system or muscles. Because unc-40 mutants are defective in axon guidance, the Madd phenotype may be a secondary consequence of commissural axon guidance defects. To test this possibility, I made unc- 119p::UNC-40::GFP (pprkc256) which expresses functional UNC-40::GFP throughout the nervous system. Control animals extend about 18.4 axons into the dorsal nerve cord 62

72 Chapter Three A. unc-40p::unc-40::gfp A. unc-40p::unc-40::gfp B. him-4p::unc-40::yfp B. him-4p::unc-40::yfp C. ti tris34 Figure 3.6 UNC 40 Expression and Localization Pattern. (A) UNC 40::GFP driven by its native promoter. Expression can be seen in the nerve cord as well as in the BWM. Enrichment at muscle plasma membrane is indicated by a white arrow. (B) BWM showing subcellular localization of UNC 40::YFP driven by the him 4 promoter. Red arrows indicate individual muscle arms. UNC 40::YFP is distributed along the muscle plasma membrane, and enriched at muscle arm termini (blue arrow). (C) UNC 40::YFP localization as seen in the tris34 integrated array that harbours him 4p::UNC 40::YFP. High levels of UNC 40::YFP is further restricted to the muscle arm termini (blue arrow). 63

73 20 Chapter Three A. wild type A. wild type B. unc-40(n324) B. unc-40(n324) s/animal Axon C. unc-40(n324)+n-rescue D. unc-40(n324)(dorsal) G. Nervous System Rescue of unc-40 4 D. unc-40(n324)(ventral) E. unc-40(n324)+n-rescue(dorsal) Arms/BWM E. unc-40(n324)+n-rescue(ventral) F. unc-40(n324)+m-rescue(dorsal) F. unc-40(n324)+m-rescue(ventral) H. UNC-40 Acts Cell-Autonomously Figure 3.7 UNC 40 Acts Cell Autonomously to Direct Muscle Arm Extension. (A C) Fluorescent micrographs showing commissural motor axons in indicated genotypes. Annotation is the same as in Figure 3.1. (D F) Fluorescent micrographs showing dorsal BWMs (D,E,F) and ventral BWMs (D,E,F ) of indicated genotypes. UNC 40::GFP expression was driven by the unc 119 pan neuronal promoter (N rescue in C, E E ). UNC 40::YFP expression was driven by the him 4 muscle specific promoter (M rescue in F F ). Red arrows in F F indicate rescued muscle arm extension. (G) Graphical summary of commissural axon rescue. (H) Average number of muscle arms extending from dorsal right muscle 15 (dark gray) and ventral left muscle 11 (light gray) of 30 young animals of indicated dgenotypes. Muscle UNC 40: him 4p directed d UNC 40::YFP expression. Neuro UNC 40: unc 119p directed UNC 40::GFP expression. Control represents transgenes that are common to all transgenic lines. Independent transgenic lines are indicated with a number. Wild type is the tris30 integrated strain. Error bars represent standard error of the mean. 64

74 Chapter Three from the right-hand side of the worm. In contrast, unc-40(n324) mutants extend 6 axons that enter the dorsal nerve cord. Two independent transgenic lines of unc-40(n324) animals harbouring pprkc256 have respectively, 18.5 and 19.1 axons entering the dorsal nerve cord, which is not significantly different from wild-type controls (p>0.1) ( Figure 3.7A-C,G). Furthermore, the locomotory defects of unc-40(n324) mutants were rescued by the array (unpublished observations). Despite a fully rescued nervous system, dorsal and ventral muscle arm extension of these transgenic unc-40(n324) animals remain severely compromised (Figure 3.7E-E,H). This demonstrates that the muscle arm defects of unc-40 mutants are not secondary to neuronal defects. Next, I injected the him-4p::unc-40::yfp construct into unc-40(n324) animals. Two independently derived lines of transgenic animals harbouring extra-chromosomal arrays of the construct, as well as chromosomally-integrated tris34 animals show full rescue of muscle arm extension (Figure 3.7F-F,H). Therefore, unc-40 acts cell-autonomously in muscles to regulate muscle arm extension Genes that Regulate Muscle Arm Extension in an UNC-40 Pathway i) Focal Adhesion Homologs are Required for Muscle Arm Extension tr61 is an allele isolated from the forward genetic screen for genes involved in muscle arm extension. Mariam Alexander demonstrated that tr61 failed to complement the null allele unc-95(su33). unc-95 encodes a LIM-domain containing protein that localizes to dense bodies, nuclei, and muscle arms of BWMs (Broday et al., 2004). C. elegans dense bodies are analogous to vertebrate focal adhesions that serve as signaling hubs and mechanical linkages to the extra-cellular matrix (Burr and Gans, 1998; 65

75 Chapter Three Lecroisey et al., 2007). To investigate whether unc-95 acts through an unc-40 pathway, I made an unc-40(n324) unc-95(su33) double mutant. If unc-95 acts through a non-unc-40 pathway, the muscle arm extension defects of the double mutant should be significantly enhanced compared to the unc-40(n324) single null. I found that the muscle arm defects of the double is not different from the muscle arm defects of unc-40(n324) (p>0.1), suggesting that the two genes act in the same pathway (Figure 3.8). In contrast, I found that mutants of the recently characterized guidance receptor eva-1(ok1133), which is also Madd (Appendix 2A), can significantly enhance the severity of muscle arm defects in unc-40(n324) (p<0.01), indicating that muscle arm defects can be further abrogated with respect to unc-40 s level (Figure 3.8). This enhancement is also seen in unc-40(n324); unc-5(e53) double mutants (p<0.01). ii) The C. elegans WAVE Complex Mediates Muscle Arm Extension in an UNC-40 Pathway The tr116 allele isolated from our forward genetic screen was cloned by Jasmine Ono with the help of Mariam Alexander. tr116 failed to complement the gex-2(ok1603) deletion allele, and subsequently we found a R420Stop mutation in the gex-2 transcript. gex-2 encodes the C. elegans homolog of Sra-1, a mammalian substrate of the small GTPase Rac1 (Soto et al., 2002). In the dissociation model for WAVE function, Sra-1 and Nap1 form a regulatory complex to keep WAVE in an inactive state (Kunda et al., 2003). When Rac1 binds to Nap1, it causes the complex to split, such that WAVE is released, and is in an active form to stimulate Arp2/3 mediated de novo actin branching (Blagg and Insall, 2004; Steffen et al., 2004). WAVE is a member of the Wiskott- 66

76 Chapter Three 0.6 Arms/BWM * * 0 Figure 3.8 unc 40 Double Mutant Analysis for Muscle Arm Defects. Graphical summary of muscle arm extension of ventral left muscle 11 in unc 40 double mutants. Asterisks indicate significantly enhanced muscle arm defects compared to controls (p<0.01). Error bars represent standard error of the mean. 67

77 Chapter Three Aldrich syndrome protein (WASP) family that also includes N-WASP and WASp (Miki and Takenawa, 2003; Smith and Li, 2004). WASp functions similarly to WAVE in that when active, it also stimulates actin branching through Arp2/3. In contrast to WAVE, WASp is intrinsically auto-inhibited and can only carry out its function upon interaction with CDC42, PIP2 and other SH3 domain proteins such as Grb2 and Nck (Higgs and Pollard, 2000, 2001; Pollard and Borisy, 2003; Rohatgi et al., 1999). The C. elegans homologs of Nap1 and WAVE are gex-3 and wve-1 respectively (Soto et al., 2002; Withee et al., 2004). To further investigate the involvement of the WAVE regulatory complex in muscle arm extension, I first examined muscle arm extension in animals compromised for gex-2, gex-3 or wve-1. Since there are no viable alleles or hypomorphs of wve-1 (Soto et al., 2002; Withee et al., 2004), I used an RNAi approach for examining wve-1 s role. I found that gex-2(ok1603), gex-3(zu196), and wve-1(rnai) animals extend fewer muscle arms compared to wild-type and RNAi controls (p<0.01) (Figure 3.9A-E). In contrast, genetic or RNAi knockdown of wsp-1 (the C. elegans homolog of WASp (Sawa et al., 2003)) function does not disrupt muscle arm extension (Figure 3.9G). To investigate whether components of the WAVE complex operate in an unc-40 pathway, I made double mutants of gex-2(ok1603) and gex-3(zu196) with unc-40(n324). I found that the double mutants extend the same number of muscle arms as unc-40(n324) alone (p>0.1) (Figure 3.8). Disrupting wve-1 function via RNAi in the background of unc-40(n324) also does not enhance the Madd phenotype of unc-40(n324) (p>0.1) 68

78 Chapter Three (Figure 3.8). This suggests that gex-2, gex-3 and wve-1 all function in an unc-40 pathway. In collaboration with Mariam Alexander, we examined where gex-2 is required to regulate muscle arm extension. We found that transgenic animals expressing GEX- 2::CFP specifically in muscles rescued the muscle arm defects of gex-2(ok1603) back to wild-type levels, suggesting a cell-autonomous role for GEX-2 (Figure 3.9G). Next, Alexandra Byrne studied the localization of a functional him-4p::gex-2::cfp construct. She found that GEX-2::CFP expression co-localizes with UNC-40::YFP at the muscle arm termini (Figure 3.9F-F ). Therefore, we conclude that GEX-2, and likely other members of the WAVE complex act cell-autonomously at the tips of muscle arms to regulate arm extension. Taken together, these observations suggest an unc-40 pathway that likely involves WAVE activation to stimulate actin branching during muscle arm extension. iii) UNC-73 Acts in an UNC-40 Pathway to Direct Muscle Arm Extension Alexandra Byrne cloned the tr117 allele isolated from the forward genetic screen, and found that it fails to complement mutations in unc-73, which encodes a Trio ortholog (Forrester and Garriga, 1997; Forrester et al., 1998; Steven et al., 1998). We found that unc-73(tr117) carries a missense mutation (E1335K) in the first of two tandem Rho guanine nucleotide exchange factor (GEF) domains in the unc-73 transcript (Steven et al., 2005). Mammalian Trio functions as a Rho GEF that activates Rac signaling (Charrasse et al., 2007; Debreceni et al., 2004). To determine where unc-73 acts to regulate muscle arm extension, Alexandra Byrne injected a muscle-specific UNC- 69

79 Chapter Three 5 A. wild type 4 * * B. gex-2(tr116) Arms/BWM C. gex-2(ok1603) C. gex-2(ok1603) 0 N.D. N.D. N.D. N.D. D. gex-3(zu196) E. wve-1(rnai) G. Ventral Muscle Arms of WAVE Complex Members F. GEX-2::CFP F. UNC-40::YFP F. MERGE F. MERGE Figure 3.9 The WAVE Complex Acts in an UNC 40 Pathway Independent of WASP. (A E) Fluorescent micrographs of ventral muscle arm extension in indicated genotypes. Annotation is the same as in Figure 3.1. (F F ) GEX 2::CFP and UNC 40::YFP co localize at muscle arm termini. Muscle specific GEX 2::CFP expression in the background of tris34 that expresses muscle specific UNC 40::YFP by the him 4 promoter. Proteins are enriched and co localize at muscle arm termini (blue arrows in F F ). (G) Summary of muscle arm extension in WAVEcomplex related genotypes. GEX 2::YFP is expressed by the him 4 muscle specific promoter. Dark gray bars represent muscle arm extension from DR15 and light gray bars represent muscle arm extension from VL11. Independent d transgenic lines are indicated dwith a number. N.D. represents dorsal muscle arm numbers not determined. Asterisks represent significantly rescued muscle arm defects (p<0.01). Error bars represent standard error of the mean. 70

80 Chapter Three A. unc-73(tr117) E. UNC-73B::CFP B. unc-73(e936) E. UNC-40::YFP C. unc-73(e936)+m-rescue E. MERGE C. unc-73(e936)+m-rescue E. MERGE 6 5 Arms/BWM N.D. * * N.D. D. UNC-73 Functions Cell-Autonomously Figure 3.10 UNC 73 Functions Cell Autonomously for Muscle Arm Extension Downstream of UNC 40. (A C) Fluorescent micrographs depicting ventral muscle arm extension in indicated genotypes. Annotation is the same as in Figure 3.1. UNC 73::CFP is driven by the him 4 muscle specific promoter (M rescue in C, UNC 73::CFP in D). (D) Summary of muscle arm extension from DR15 (dark gray) and VL11 (light gray). Independent transgenic lines are indicated with a number. N.D. represents dorsal muscle arm numbers not determined. Asterisks represent significantly rescued muscle arm defects (p<0.01). (E E ) UNC 73::CFP expression driven by the muscle specific him 4 promoter in the background of tris34 that expresses muscle specific UNC 40::YFP. Both proteins co localize l at muscle arm termini indicated dby a blue arrow in E. Error bars represent standard error of the mean. 71

81 Chapter Three 73B::CFP into unc-73(e936) mutants. The UNC-73B isoform was provided by Dr. Rob Steven, and lacks the second Rho GEF domain (Steven et al., 2005). We found that UNC-73B::CFP expressed in transgenic muscles rescued the muscle arm defects of unc- 73(e936) (Figure 3.10A-D). We also found that UNC-73 and UNC-40 co-localize at muscle arm termini (Figure 3.10E-E ). We conclude that unc-73 acts cell-autonomously in the muscles to regulate muscle arm extension. Furthermore, we infer from our results that the first Rho GEF domain is necessary and sufficient for UNC-73 s function in muscle arm extension Over-expression of UNC-40 Induces Ectopic Myopodial Extensions A widely used technique to genetically order genes in a pathway, is to find suppressors of a phenotype induced by over-expressing a specific gene (Gitai et al., 2003; Levy-Strumpf and Culotti, 2007; Watari-Goshima et al., 2007). To investigate the affects of UNC-40 over-expression in the muscles, I found that injecting the him- 4p::UNC-40::YFP construct at 50ng/ul induced ectopic myopodial extensions from muscles of transgenic progeny (Figure 3.11A). These myopodia extended randomly and were qualitatively different from normal muscle arms. Furthermore, UNC-40::YFP was enriched along the entire plasma membrane of transgenic muscles, as well as at the muscle arm termini. To investigate which genes are required for UNC-40-induced ectopic myopodial extensions, I injected the same injection mix into various Madd mutants that we isolated from the forward genetic screen. A gene may be required for UNC-40-induced ectopic myopodia in two ways: the gene may act downstream of UNC- 40 or the gene may be required for some aspect of UNC-40 functionality. For example, 72

82 Chapter Three suppressors of UNC-40-induced ectopic myopodia may act upstream of UNC-40 if they are required for the proper subcellular localization of UNC-40. If disrupting a gene suppresses UNC-40-induced ectopic myopodia without obviously disrupting the localization of UNC-40, it is likely that the gene acts downstream of UNC-40. In contrast, knock down of gene products that do not suppress UNC-40-induced ectopic myopodia and do not disrupt UNC-40 localization indicate that the gene product may act upstream of UNC-40, or is unrelated to the pathway. i) Ordering genes downstream of UNC-40 I described evidence suggesting that dense body components, members of the WAVE complex, and the Rho GEF UNC-73 likely act in an UNC-40 pathway to regulate muscle arm extension. To order these genes in a pathway relative to UNC-40, I examined their requirement for UNC-40-induced ectopic myopodia. I found that loss-offunction of unc-95, gex-2, gex-3, wve-1 and unc-73 all suppressed UNC-40-induced ectopic myopodia (p<0.01) (Figure 3.11E,G-J,L), suggesting a downstream role for these gene products. In contrast, loss of function of an unc-40 pathway component, madd- 2(tr103), could not suppress UNC-40-induced ectopic myopodia (p>0.1) (Figure 3.11L), suggesting that madd-2 acts upstream of unc-40 (Mariam Alexander, manuscript and thesis in preparation). To further investigate the model that UNC-73 acts downstream of UNC-40, Alexandra Byrne crossed an extra-chromosomal array containing him-4p::unc-73::cfp into unc-40(n324) animals. If UNC-73 indeed functions downstream of UNC-40, overexpressing UNC-73 might suppress the muscle arm defects of unc-40 mutants. Indeed, 73

83 Chapter Three transgenic animals harbouring excess UNC-73 significantly suppressed the muscle arm defects of unc-40(n324) (p<0.05) (Figure 3.10D). Therefore, we conclude that UNC-73 functions downstream of UNC-40. ii) unc-6 May Play an Ancillary Role in Muscle Arm Extension In a previous section, I established that unc-6 does not play a direct role in regulating muscle arm extension. To determine whether known components of the neuronal unc-40 pathway involved in regulating extending axons are also involved in regulating ectopic myopodial extension, I tested whether unc-5 and unc-6 would suppress the extension of ectopic myopodia. As expected, disruptions in unc-5 do not affect the number of ectopic myopodial extensions induced by UNC-40 over-expression (Figure 3.11C,L). This is consistent with my previous observation that unc-5(e53) is not required in muscle arm extension. Surprisingly, genetic disruption of unc-6 suppressed UNC-40- induced ectopic myopodial extensions (p<0.01) (Figure 3.11D,L). The role of unc-6 in muscle membrane extension was only obvious in this sensitized background, suggesting that unc-6 may play a redundant role to regulate myopodial and muscle arm extensions. iii) Other Genes Involved in Ectopic Myopodial Extensions It has previously been reported by our lab that UNC-60B is required for muscle arm extension (Dixon and Roy, 2005). UNC-60B encodes the C. elegans orthologs of actin-depolymerizing factor (ADF) and Cofilin, and is expressed specifically in the BWMs, vulva and spermatheca (Maciver and Hussey, 2002; Ono et al., 2003; Ono et al., 2008). The depolymerization activity of UNC-60B is speculated to provide a pool of 74

84 Chapter Three free G-actin for new actin filament formation during muscle arm extension (Dixon and Roy, 2005). To test if unc-60b functions in an unc-40 pathway, I examined UNC-40- induced ectopic myopodia in the background of unc-60b(su158). I found that loss of function of unc-60b significantly suppressed the number of extending myopodia (p<0.01), without obviously disrupting the localization of UNC-40::YFP at the muscle plasma membrane (Figure 3.11F,L). This result suggests that unc-60b functions downstream of unc-40 to regulate muscle arm extension. Cori Bargmann s group used a similar approach to investigate the genes involved in Netrin signalling. They examined the excess outgrowth of cell bodies of the hermaphrodite-specific neurons (HSNs) caused by a gain-of-function UNC-40 molecule. To that end, they defined two pathways downstream of UNC-40. The first pathway involves CED-10/Rac and UNC-115/AbLIM acting through the cytoplasmic P2 motif of UNC-40. The second pathway involves UNC-34/Enabled acting through the cytoplasmic P1 motif of UNC-40. Both pathways converge downstream to influence actin dynamics (Gitai et al., 2003). I found that only unc-34 is required for UNC-40- induced ectopic myopodia (Figure 3.11L). However, UNC-34 may play only a redundant role, as it is not required for normal muscle arm extension (Mariam Alexander, thesis in preparation). Both ced-10 and unc-115 were dispensable, but these observations do not exclude the possibility that they act redundantly in the UNC-40 pathway. Gitai and colleagues also found that unc-73 was dispensable for HSN cell body outgrowth, which is in contrast to my evidence of unc-73 functioning downstream of unc-40. Collectively, these observations underscore that the UNC-40 pathway in muscles may act 75

85 Chapter Three A. wild type B. unc-40(n324) C. unc-5(e53) D. unc-6(ev400) A. wild type B. unc-40(n324) C. unc-5(e53) D. unc-6(ev400) E. unc-73(e936) F. unc-60b(su158) G. unc-95(su33) H. gex-2(ok1603) I. gex-3(zu196) J. wve-1(rnai) 0 Myopod dia/bwm K. pat-2(rnai) K. pat-2(rnai) L. Ectopic Myopodia Induced by UNC-40 Over-Expression Figure 3.11 UNC 40 Over Expression Induces Ectopic Myopodial Extensions. (A K) Fluorescent micrographs of representative transgenic muscles of indicated genotypes injected with myopodiainducing levels of muscle specific UNC 40::YFP. Orange arrows indicate individual myopodia extending from the muscle cell. (L) Candidate suppression analysis of ectopic myopodia induced by UNC 40 over expression. The perforated gray line represents a significance threshold. All bars that fall below the line represent significant suppression of ectopic myopodia (p<0.001). Error bars represent standard error of the mean. 76

86 Chapter Three through different downstream components compared to the UNC-40 pathway in neurons, or in different redundant versus non-redundant combinations Extracellular Domains of UNC-40 are Dispensable for Muscle Arm Extension i) Signal Transduction Through UNC-40 is Required for Proper Arm Extension The observation that unc-6 is not directly required for muscle arm extension prompted the question of whether signal transduction through UNC-40 is necessary for muscle arm extension. To test this, I generated the expression construct him-4p::unc- 40(Δcyto)::YFP that lacks all cytoplasmic domains after the transmembrane domain. Expression of this construct failed to rescue the muscle arm phenotype of transgenic unc- 40(n324) animals (Figure 3.12C,E). This suggests that transmission of extra-cellular signals through UNC-40 cytoplasmic domains is required for extension. This finding is also consistent with two unc-40 alleles: unc-40(tr115) that encodes an early stop in the last residue of the transmembrane domain of UNC-40, and unc-40(ev547) that encodes an R1208Q missense mutation in the cytoplasmic domain (Table 3.2 and Figure 3.3). Both of these alleles are muscle arm defective (Table 3.3), supporting the observation that the cytoplasmic domains of UNC-40 are required for muscle arm extension. These observations also rule out the possibility that UNC-40 acts solely as a cell-adhesion molecule to anchor muscle arms to motor axons. ii) The Extracellular Domains of UNC-40 Induce a Dominant Negative Phenotype Recently, the extracellular domains of Frazzled, the Drosophila ortholog of UNC- 40, have been reported to be a dominant negative for full-length Frazzled in commissural 77

87 Chapter Three axon guidance. I decided to determine if transgenic expression of him-4p::unc- 40(Δcyto)::YFP in an otherwise wild-type background would yield similar findings. Indeed, I found that transgenic expression of him-4p::unc-40(δcyto)::yfp in tris30 animals resulted in an average of 2.0 muscle arms across three independent transgenic lines (compared to 3.3 in wild-type), suggesting that UNC-40(Δcyto) induces a dominant negative phenotype. iii) The Cytoplasmic Domains of UNC-40 are Sufficient for Muscle Arm Extension To determine whether the extracellular domains of UNC-40 are required for muscle arm extension, I generated a YFP fusion construct with only the cytoplasmic domains of UNC-40. Since the transmembrane domain is no longer present in this molecule, I ensured plasma membrane localization by tagging the molecule with a myristoylation (MYR) signal. The MYR signal is a co-translational protein modification that was first discovered in plants, and is essential for membrane targeting, and has also been used by other groups for similar purposes (Gitai et al., 2003; Kamps et al., 1985). Intriguingly, muscle specific expression of MYR::UNC-40(Δecto)::YFP rescued the muscle arm defects of transgenic unc-40(n324) animals (Figure 3.12D,E). Upon closer examination, the localization of MYR::UNC-40(Δecto) is slightly enriched at the muscle plasma membrane, and is obviously localized within muscle arms (Figure 3.12H). This plasma membrane enrichment and obvious localization to muscle arms is no longer seen upon removal of the MYR tag (Figure 3.12I). Furthermore, non-myr tagged UNC- 40(Δecto)::YFP fails to rescue the muscle arm defects of unc-40(n324) nulls (Figure 3.12E). Also, nuclear enrichment is evident, but is not further discussed in my thesis. 78

88 Chapter Three A. unc-40(n324) F. full-length UNC-40 B. unc-40(n324)+full-length UNC-40 G. UNC-40( cyto) C. unc-40(n324)+unc-40( cyto) H. MYR::UNC-40( ecto) D. unc-40(n324)+myr::unc-40( ecto) full length UNC 40 I. UNC-40( ecto) UNC 40(Δcyto) MYR::UNC 40(Δecto) 4 UNC 40(Δecto) Arms/BWM E. UNC-40 Constructs and Transgene Rescue Figure 3.12 The Cytoplasmic Domains of UNC 40 are Sufficient for Muscle Arm Extension. (A D) Fluorescent micrographs of unc 40(n324) harbouring indicated transgenes. Annotation is the same as in Figure 3.1. Schematics of transgenes used in A D are depicted in E. (E) UNC 40 domain analysis was done in the background of unc 40(n324) null animals. Dark gray bars represent muscle arm counts for DR15 and light gray bars represent counts for VL11. Independent d transgenic lines are indicated dwith iha number. (F I) Localization i pattern of indicated transgenes. Enrichment of transgene expression at muscle arm termini is indicated by blue arrows in F I. In I, green arrow represents nuclear enrichment. Error bars represent standard error of the mean. 79