RESEARCH ARTICLE. Abstract. Introduction. CHUNFENG GUAN 1, JING JI 1, XIAOZHOU LI 2, CHAO JIN 1 and GANG WANG 1

Transcription

1 Inin Aemy of Sienes RESEARCH ARTICLE LMKK, MAPK kinse from Lyium hinense, onfers mium tolerne in trnsgeni too y trnsriptionl upregultion of ethylene responsive trnsription ftor gene CHUNFENG GUAN 1, JING JI 1, XIAOZHOU LI 2, CHAO JIN 1 n GANG WANG 1 1 Shool of Environmentl Siene n Engineering, Tinjin University, Tinjin , People s Repuli of Chin 2 Deprtment of Meil Genetis, Tinjin Meil University Generl Hospitl, Tinjin , People s Repuli of Chin Astrt Cmium (C) is highly toxi element to plnts. Ethylene is n importnt phytohormone in the regultion of plnt growth, evelopment n stress response. Mitogen-tivte protein kinse (MAPK) tivtion hs een oserve in plnts expose to C stress n ws suggeste to e involve in ethylene iosynthesis. We hypothesize tht there my e link etween MAPK ses n ethylene signlling in C-stresse plnts. To test this hypothesis, the expression of LMKK, LhERF n LGSH1 genes, enogenous ethylene umultion, GSH ontent n C onentrtion in Lyium hinense with or without C stress tretment were stuie. Our results showe tht LMKK gene expression n e inue y the tretment of C in L. hinense. The trnsgeni too expressing 35S::LMKK showe greter tolerne to C stress n enhne expression of NtERF n NtGSH1 genes, initing tht LMKK is ssoite with the enhne expression level of ERF n GSH synthesis-relte genes in too. We lso foun tht enogenous ethylene n GSH ontent n e inue y C stress in L. hinense, n inhiite y otretment with PD98059, n inhiitor of MAPK kinse. Evienes presente here suggest tht uner C stress, GSH umultion ourre t lest prtilly y enhne LMKK gene expression n the ethylene signl trnsution pthwys might e involve in this umultion. [Gun C., Ji J., Li X., Jin C. n Wng G LMKK, MAPK kinse from Lyium hinense, onfers mium tolerne in trnsgeni too y trnsriptionl upregultion of ethylene responsive trnsription ftor gene. J. Genet. 95, ] Introution Aroun the worl wter n soil re inresingly eing ontminte with mium (C) ue to some nthropogeni tivities, suh s nikel C ttery proution, the use of C-ontining sewge sluge n the pplition of phosphte fertilizers (Semne et l. 2007). C is nonessentil element for plnt metolism n n e esily tken up y plnt roots (Menoz-Cóztl et l. 2011). C n istur ellulr reox homeostsis, resulting in elevte retive oxygen speies (ROS) levels in plnts (Clemens et l. 2013). This proess in turn ffets the istriution of the tivity of C 2+ -ining proteins, phospholipi signlling proesses n mitogen-tivte protein kinse (MAPK) pthwys (Jonk et l. 2004; Openkker et l. 2012). MAPK ses re signlling moules onserve in eukryoti orgnisms. Exogenous signls re pereive y reeptors, whih then initites the MAPK ses. One For orresponene. E-mil: Jing Ji, jijing@tju.eu.n; Gng Wng, gngwng@tju.eu.n. tivte, MAPK kinse kinse (MAPKKK) phosphoryltes its ownstrem MAPK kinse (MAPKK), whih in turn tivtes its ownstrem MAPK. To te, 80 MAPKKKs, 10 MAPKKs n 20 MAPKs hve een ientifie in the Ariopsis genome, n the rie genome hrours 75 MAP- KKKs, 8 MAPKKs n 15 MAPKs (Hmel et l. 2006; Kumr et l. 2008; Ro et l. 2010). The smll numer of MAPKKs suggests tht MAPKKs my hve multiple MAPK trgets n the sme MAPKK my funtion in severl ifferent MAPK ses (Cristin et l. 2010). For exmple, the Ariopsis MKK3 MPK7 kinse se ws reporte to prtiipte in pthogen signlling, wheres the MKK3/CM- MPK8 meites C 2+ n ROS signlling in erly woun signlling (Tmur et l. 2007). MAPK tivtion hs een oserve in severl plnt speies expose to hevy metls. For exmple, MAPK tivity ws foun to e higher in C-tolernt plnts thn in C-sensitive plnts (Yeh et l. 2007). Similrly, the result of stuy on Meigo stiv seelings inite tht multiple MAPK pthwys were involve in plnt responses to hevy metl stress (Jonk et l. 2004). In ition, MAPK Keywors. mium; glutthione; ethylene; Lyium hinense. Journl of Genetis, DOI /s , Vol. 95, No. 4, Deemer

2 Chunfeng Gun et l. trnsript levels in Ariopsis seelings were shown to inrese following exposure to C n Cu (Openkker et l. 2012). Liu et l. (2010) showe tht in Ariopsis, MPK3 n MPK6 re tivte y short-term exposure to CCl 2 y the umultion of ROS. Ethylene is n importnt phytohormone involve in plnt evelopment n efense responses uner ioti stress (Lin et l. 2009; Shn et l. 2012). Zhng et l. (2014) reporte tht ethylene ws involve in lleviting C-inue stress in too. The stimultion of ethylene iosynthesis y C stress hs lso een reporte in other plnt speies (Snità i Toppi n Grielli 1999; Ikimov et l. 2005; Liu et l. 2008; Roríguez-Serrno et l. 2009; Chmielowsk-Bąk et l. 2013). Ethylene iosynthesis is tlyze y 1-mino ylopropne-1-roxyli i synthses (ACS). C exposure ws reporte to inrese the unne of ACS isoforms, ACS2 n ACS6 trnsript levels (Che n Kieer 2005). Severl groups presente t to suggest tht the MAPK se ws involve in ethylene iosynthesis (Hn et l. 2010; Li et l. 2012). For exmple, the phosphoryltion of ACS2 n ACS6 y MPK6 uses elevte rtes of ethylene iosynthesis (Liu n Zhng 2004). The MKK9MPK3/6 pthwy ws shown to funtion in ethylene iosynthesis. Constitutive expression of MKK9 inue umultion of ethylene through tivtion of MPK3/6 n onseutive positive regultion of ACS2 n ACS6 gene expressions (Xu et l. 2008; Hn et l. 2010; Li et l. 2012). The ove reports inite tht MAPK ses my e involve in regultion of ethylene iosynthesis or ethylene signl trnsution, however, the reltionship etween MAPK ses n ethylene signlling in C-stresse plnts is still unler. In our previous stuy, n ERF gene ws lone from Lyium hinense n esignte s LhERF (Wu et l. 2014). We showe tht C stress triggere ethylene inution n LhERF gene expression in L. hinense. Overexpression of LhERF in trnsgeni too showe greter tolerne to C stress (Gun et l. 2015). It is likely tht there my e link etween tivtion of MAPK, ethylene iosynthesis n upregultion of ERF gene in plnts uner C stress. Stuying the reltionship etween these signl trnsution pthwys is expete to help in eluiting the funtion of MAPK in plnt response to C stress. As its fruit is use for tritionl Chinese meiine, L. hinense hs ttrte onsierle interests in reent yers (Asno et l. 1997; Zheng et l. 2010; Dong et l. 2013). L. hinense is lso eiuous perennil hlophyte grown in lrge vriety of soil types (Zhng et l. 2010). In this stuy, the expression pttern of MAPKK gene (LMKK) in C-stresse L. hinense n its funtion in trnsgeni too were investigte. Mterils n methos L. hinense growth n C stress tretment L. hinense plnts were grown in pots ontining mixture (v/v) of 20% wshe onrete sn n 80% GB-Pinstrup sustrtes no. 1 (Ryomgr, Denmrk). The pots were ple in ontrolle-growth hmer uner onitions s esrie previously (Gun et l. 2015). Experiments were rrie out using 10 week-ol plnts with leves. Before stress tretments, L. hinense plnts were uproote n trnsferre to Hogln s solution to ulture uner the sme onitions s plnts grown in pots for 7 (pttion perio). For C tretments, the L. hinense plnts were ple in ifferent ulture ottles ontining Hogln s solution plus 100 μm CCl 2. Sine the eginning of the tretment, the root tips were hrveste for 0, 2, 4, 6, 8 n 12 h from unstresse n stresse plnts. Zero hour ws the lst hour efore tretments egn. Eh tretment ontine five plnts, n ll experiments were repete t lest three times. For PD98059 n AVG (2-mino ethoxyvinlglyine) tretments, the L. hinense plnts were ple in ifferent ulture ottles ontining Hogln s solution plus (1) ontrol, (2) 100 μm CCl 2, (3) 100 μm CCl μm PD98059 n (4) 100 μm CCl μm AVG. Sine the eginning of the tretment, the root tips were hrveste on 6 h from ifferent stresse plnts. C tretment on trnsgeni too overexpressing LMKK Sees from T 1 progeny of trnsgeni lines were surfesterilize n sown on MS meium (Wu et l. 2015). After 7, seelings of too were trnsferre onto MS gr meium supplemente with or without 100 μm CCl 2 for 21. At the en of C tretment, the seelings were use for susequent ssy of root length, mlonilehye (MDA) proution, glutthione (γ -Glu Cys Gly, GSH) ontent n C umultion in roots; the leves were use for hlorophyll ontent n ROS ssy; the totl RNA in roots ws extrte n use for gene expression nlysis. Rel-time quntittive PCR (qpcr) nlysis Totl RNA ws extrte oring to mnufturer s instrutions (Life Tehnologies, Crls, USA). The primers use for the expression nlysis of LMKK, LhERF n LGSH1 genes were esigne se on the EST unigene of L. hinense sequene y BGI (Wng et l. 2015) n inite in tle 1. The primers use for the expression nlysis of NtERF n NtGSH1 were esigne oring to Hung et l. (2010) n Király et l. (2012), respetively. QPCR retions were rrie out oring to our previous stuy (Gun et l. 2014). The onstitutively expresse uiquitin gene ws use s n internl ontrol to show the normliztion of the mount of templtes in the PCR retion; the reltive hnges in trget gene trnsripts were lulte s -fol hnges reltive to the ontrol smples. Determintion of C ontent The onentrtion of C ws etermine y flme tomi sorption spetrophotometer oring to our previous stuy (Gun et l. 2015). 876 Journl of Genetis, Vol. 95, No. 4, Deemer 2016

3 LMKK is ssoite with the enhne expression level of ERF n GSH synthesis-relte genes Tle 1. Oligonuleotie primers use in this stuy. Primer Primer sequenes 5 3 LhERF-F LhERF-R LMKK-F LMKK-R LGSH1-F LGSH1-R NtGSH1-F NtGSH1-R NtERF-F NtERF-R LUBI-F LUBI-R NtUBI-F NtUBI-R Ethylene etermintion TTGGAACTTACGAGACGGCT CAGCTGATCGTCGCTTAACC TGCAGATGGCAGCAAGATAC GTTGTCTGATGGCTGTAT GCTGCAAGTCCTCCAACAGAGG CAATGATATATTTTGCTTTCCC CAGGTAAATCTGGACTTCAG CAATATACTTCTTCTTCCGATAC CAAGTATTTGAAGAATCCTC GGAAAATTAAGAAGAGACCAAGG GGAAACATAGTGCTCAGTGGTG GCTGAGGGAAGCCAAGATAG GTGAAAGAAAAGCTTGCTTAC CATGGTAGAGCCACCACTGA For etermintion of enogenous ethylene proution, fresh roots (10 12 g) were ple in 80 ml hermeti vils, flushe with ethylene-free ir n inute for 2 h t room temperture. The ethylene onentrtion ws etermine on gs hromtogrph s esrie (Gun et l. 2015). GSH ontent ssy Root smples were homogenize in mortr oring to e Kneht et l. (1994). GSH ws etermine using postolumn erivtiztion with 300 mm Ellmn s regent (5,5 ithio (2-nitroenzoi i)), etete t 412 nm. Ientifition of GSH ws se on the omprison of their retention times with stnr GSH smples (Gun et l. 2015). Chlorophyll ontent The fresh plnt lef isks (0.1 g) uner ifferent tretments s inite ove were homogenize in 1 ml of 80% etone n the homogente ws entrifuge t 4000 g for 5 min. The superntnt ws retine n the sorne ws reore t 663 n 646 nm. The hlorophyll ontent ws expresse in mirogrms per grm fresh weight (FW) (Lihtenthler 1987). In situ histohemil loliztion of O 2 In situ umultion of O 2 ws exmine se on histohemil stining y nitrolue tetrzolium (NBT) (Lu et l. 2013). For etetion of O 2, the seon leves from the top of the nontrnsgeni n trnsgeni lines were immerse in NBT solution (0.1 mg ml 1 ) for 24 h t 25 C in the rk. The NBT solution ws prepre using 10 mm phosphte uffer. After stining, the leves were soke in 95% ethnol overnight to remove hlorophyll, n then photogrphe. Anlysis of lipi peroxition Lipi peroxition in the plnt roots ws etermine y mesuring MDA whih ws mesure using the proeure esrie y Gun et l. (2014). Preprtion of protein extrts n in-gel kinse tivity ssy The root tissue, ollete from L. hinense grown uner ifferent tretments s inite ove ws quikly frozen n groune in liqui nitrogen. Groun smples were issolve in extrtion uffer (50 mm ph 7.5 HEPES, 5 mm EDTA, 5 mm EGTA, 2 mm DTT, 1 mm N 3 VO 4, 25 mm NF n 20% glyerol). After entrifugtion t g for 20 min twie, the superntnt ws use immeitely or store t 80 C. Proteins were seprte using 10% SDS-polyrylmie gel with 0.25 mg/ml myelin si protein (MBP) emee s kinse sustrte. After eletrophoresis, the gel ws wshe thrie in wshing uffer (25 mm ph 7.5 Tris-HCl, 0.5mMDTT,0.15mMN 3 VO 4, 5 mm NF, 0.05% BSA n 0.1% Triton X-100) to remove SDS. The proteins were then renture overnight t 4 C with three hnges of renturing uffer. The gel ws inute in 30 ml retion uffer (25 mm ph 7.5 Tris-HCl, 2 mm EGTA, 12 mm MgCl 2, 1mMDTT,0.1mMN 3 VO 4 ) t room temperture for 30 min, then phosphorylte in 20 ml of the sme retion uffer ontining 250 nm ATP n 50 μci of γ - 32 P- ATP t room temperture for 2 h. MBP phosphoryltion ws visulize y utoriogrphy. Sttistil nlysis The signifine of the ifferenes etween ifferent experimentl groups ws nlyse y one-wy ANOVA. Vlues mrke with ifferent letters represente signifint ifferenes etween the tretments (one-wy ANOVA, P < 0.05). All experiments were repete t lest thrie. Dt were expresse in mens ± SD. Results Effet of C stress on L. hinensis plnts As shown in figure 1, ontinuous umultion of C ws oserve in L. hinense plnts from 2 to 12 h of C tretment, wheres C ws not etete in nonc-trete plnts uring the sme time ourse. The enogenous ethylene ontent in L. hinense inrese signifintly in response to C tretment. After 2 h of C stress, mjor inrese in enogenous ethylene proution in L. hinense ws oserve, in omprison to the nontrete plnts (figure 1), wheres ethylene proution egin to erese t 6 h of C tretment. As shown in figure 1, signifint inution of LMKK expression ws etete in L. hinense fter 2 h of C tretment. The expression levels of LMKK were erese fter 4 h of C Journl of Genetis, Vol. 95, No. 4, Deemer

4 Chunfeng Gun et l. e n.. n.. n.. n.. n.. n.. () () () (e) () (f) Figure 1. The effet of C tretment on L. hinensis plnts. The L. hinense plnts were trete with 100 μmccl 2. Sine the eginning of the tretment, the root tips were hrveste for 0, 2, 4, 6, 8 n 12 h from ifferent tretments for () the ssy of C onentrtion, () enogenous ethylene ontent, ( e) LMKK, LhERF n LGSH1 trnsripts levels n (f) GSH ontent. Dt showe the verge ± SD of five inepenent experiments. tretment. The LMKK trnsript levels of L. hinense uner nonc onitions were mintine t low level from 0 to 12 h. As shown in figure 1, &e, signifint inution of LhERF n LGSH1 expressions ws etete fter 2 h of C tretment. However, the peks of LhERF n LGSH1 trnsript levels ppere t 4 n 6 h, respetively, whih ws lter thn the pek time of LMKK expression. The GSH ontent in root tissues followe similr tren with LGSH1 expression levels (figure 1f). The GSH ontent of L. hinense plnt uner nonc onition ws monitore t onstnt low level from 0 to 12 h. Enogenous ethylene n LhERF trnsript levels my e moulte y MAPK signlling pthwy The potentil involvement of MAPK signlling in moultion of ethylene ontent n LhERF trnsript levels ws investigte fter exogenous pplition of PD98059, n 878 Journl of Genetis, Vol. 95, No. 4, Deemer 2016

5 LMKK is ssoite with the enhne expression level of ERF n GSH synthesis-relte genes n.. () () () () (e) (f) (g) Figure 2. Applition of PD98059 n AVG on C-trete L. hinensis plnts. The L. hinense plnts were trete with (1) ontrol, (2) 100 μmccl 2, (3) 100 μmccl μm PD98059 n (4) 100 μmccl μm AVG. The root tips were hrveste for 6 h () for the ssy of C onentrtion, () enogenous ethylene ontent, ( e) LhERF, LMKK n LGSH1 trnsripts levels, (f) GSH ontent n (g) C tivte MBP-phosphorylting protein kinses in L. hinense. Dt showe the verge ± SD of five inepenent experiments. inhiitor of MAPK kinse (figure 2, &). Our result showe tht the exogenous PD98059 pplition reue the inution of ethylene emission, LhERF n LGSH1 gene expression, however, use no signifint reution in LMKK trnsript levels in the sme onitions (figure 2 e). GSH umultion n C ontent showe similr tren Journl of Genetis, Vol. 95, No. 4, Deemer

6 Chunfeng Gun et l. with LGSH1 trnsript expression in the sme onitions (figure 2, &f), onfirming the lose link etween MAPK signlling n GSH synthesis in plnts inue y C. As shown in figure 2, pplition of AVG, n inhiitor of ethylene iosynthesis, signifintly suppresse ethylene proution in L. hinense uring 6 h of C tretment. Our result showe tht the exogenous AVG pplition reue the C inution of LhERF n LGSH1 genes expression (figure 2, &e). However, AVG pplition use no signifint reution in LMKK trnsript levels n C onentrtion (figure 2, &). GSH umultion showe similr tren with LGSH1 trnsript expression uner tretment of C plus AVG in L. hinense (figure 2f), onfirming tht enogenous ethylene my e plying n importnt role in L. hinense uner C stress. The exogenous PD98059 pplition reue the inution of MAPK tivity sustntilly; however, AVG pplition use no signifint reution of MAPK tivity in the sme onitions (figure 2g). Overexpression of LMKK in trnsgeni too onfers C tolerne The phenotypes of nontrnsgeni n trnsgeni too with or without C tretment re shown in figure 3. Plnts with C tretment exhiite less green leves thn tht without C tretment. This effet ws more pronoune in nontrnsgeni plnts thn in trnsgeni plnts (figure 3). This result suggeste tht the LMKK trnsgenis were more tolernt to C stress whih ws onsistent with the ssy of hlorophyll ontent. As shown in figure 3, uner noncstresse growth onitions, hlorophyll ontent i not iffer etween trnsgeni n nontrnsgeni plnts. Uner Cstress onitions, hlorophyll ontent of oth trnsgeni n nontrnsgeni plnts eline. Chlorophyll ontent of the trnsgeni lines ws signifintly higher thn the nontrnsgeni plnts. The C ontent ws lso etermine in this stuy. Uner nonc-trete onitions, the C ontent ws not etete in ll plnts. Uner C stress onitions, the C ontent ws signifintly higher in trnsgeni plnts thn in nontrnsgeni plnts (figure 3). To further stuy the ifferene etween trnsgeni n nontrnsgeni plnts uner C tretment, root length ws mesure. As shown in figure 3, root length of nontrnsgeni plnts ws signifintly shorter thn tht of trnsgeni plnts uner Ctrete onitions, while the trnsgeni plnts i not iffer from nontrnsgeni plnts uner nonc-trete growth onitions. n.. () () y () () Figure 3. The effet of C tretment on trnsgeni too seelings. () The seeling morphology of ontrol (WT n Ve) n LMKKoverexpressing lines (L1 n L3). The sees were plnte on MS meium for 7 n then trnsferre to MS meium supplemente with or without C tretment. The photogrph ws tken 21 lter. () Totl hlorophyll ontent of ontrol n LMKK-overexpressing lines fter 21 of C tretment. () C umultion in too plnts sujete to C stress. () Primry root lengths of the seelings. Dt showe the verge ± SD of five inepenent experiments. 880 Journl of Genetis, Vol. 95, No. 4, Deemer 2016

7 LMKK is ssoite with the enhne expression level of ERF n GSH synthesis-relte genes LMKK meites the umultion of ROS in trnsgeni plnts With the hypothesis tht the trnsgeni lines might e sujete to less serious oxitive stress thn ontrol plnts, the ROS umultion ws evlute in the teste lines uner C stress. Histohemil stining y NBT ws use to revel in situ umultion of ROS. As shown in figure 4, without C tretment, slight NBT stining ws etete in ll teste plnts. After C tretment, lthough NBT stining in ll these lines eepene reltive to the norml onitions, the trnsgeni lines exhiite less intense NBT stining in omprison with the ontrol plnts. Tken together with figure 4, these t inite tht the trnsgeni lines umulte lower levels of ROS uner C stress. Lipi peroxition is goo initor of ellulr oxitive mge, n the hnge in lipi peroxition inue y C ws mesure y etermining MDA ontent in this stuy. Uner nonc-trete onitions, the MDA ontent i not iffer signifintly etween nontrnsgeni n trnsgeni plnts. () () () Figure 4. ROS urst n MDA ontent in too seelings with or without C tretment. () Representtive photogrphs showing umultion of O 2 in leves of too plnts with or without 100 μm CCl 2 for 21. () The DCF fluoresene intensity in the leves of too. () MDA ontent in roots of nontrnsgeni n trnsgeni too plnts. Dt showe the verge ± SD of five inepenent experiments. Journl of Genetis, Vol. 95, No. 4, Deemer

8 Chunfeng Gun et l. Uner C stress onitions, however, the MDA ontent ws signifintly lower in trnsgeni plnts thn in nontrnsgeni plnts (figure 4). MKK, ERF n GSH1 trnsript levels in trnsgeni too with or without C tretment To gin further insight into the moleulr mehnisms unerlying the enhne C resistne in trnsgeni too lines, the trnsript levels of MKK, ERF n GSH1 genes were exmine in ll plnts with or without C tretment. For tht, the MKK gene from L. hinense n N. tum n e mplifie y the primers provie in tle 1. As shown in figure 5, the expression levels of MKK gene in trnsgeni lines were signifintly higher thn those in nontrnsgeni plnts. MKK gene ws inue y C t muh higher levels s ompre to those plnts without C tretment. The expression levels of NtERF n NtGSH1 genes in trnsgeni plnts were 3 times n 1.7 times, respetively, higher thn in nontrnsgeni plnts with C stress tretment. The ontent of GSH in trnsgeni plnts ws similr to tht in nontrnsgeni plnts without C tretment. After C tretment, the ontents of GSH in oth LMKK trnsgeni n nontrnsgeni plnts were ll rose oviously. Espeilly this effet ws signifint in trnsgeni plnts, whih h 1.6-fol thn tht in the nontrnsgeni plnts (figure 5). Disussion The MAPK se is one of the most importnt signlling pthwys in plnts (Xiong n Yng 2003). An inresing numer of investigtions onfirme the importnt roles of MAPK signlling in plnt evelopment, ell prolifertion n hormone physiology, s well s in ioti stress signlling (Nkgmi et l. 2005). MAPK tivtion hs een oserve in plnts expose to hevy metls. For exmple, OsMAPK2 trnsripts inrese upon C tretment, whih suggests tht the MAPK se my funtion in the C-responsive signlling pthwy in rie (Yeh et l. 2004). This umultion of OsMAPK2 trnsripts ws lso foun to e enhne y opper in rie root tip ells (Hung et l. 2005). In ition, MAPK trnsript levels in Ariopsis seelings were shown to inrese in time-epenent mnner following exposure to Cu n C (Openkker et l. 2012). Similrly, in this stuy, we foun tht signifint inution of LMKK trnsript levels ws etete in L. hinense fter C tretment () () () () Figure 5. The trnsripts levels of () LMKK, () NtERF n () NtGSH1 were etermine using qpcr. Totl RNA ws isolte from seelings of ontrol (WT n Ve) or trnsgeni too plnts overexpressing 35S::LMKK onstrut sujete to 0 μm or 100 μmccl 2. Uiquitin gene ws use s n internl ontrol to show the normliztion of the mount of templtes. The reltive hnges of gene trnsripts were lulte s X-fol hnges reltive to the WT smples uner unstresse onitions s inite. () GSH ontent in roots of ontrol or trnsgeni plnts with or without C tretment. Dt showe the verge ± SD of five inepenent experiments. 882 Journl of Genetis, Vol. 95, No. 4, Deemer 2016

9 LMKK is ssoite with the enhne expression level of ERF n GSH synthesis-relte genes (figure 1). The overexpression of LMKK in trnsgeni too showe greter tolerne to C stress thn WT seelings (figure 3). The potentil involvement of MAPK signlling in moulting the ethylene ontent n LhERF trnsript levels ws investigte y pplition of PD98059, n inhiitor of MAPK kinse (figure 2). Our result showe tht the exogenous PD98059 pplition reue the C inution of ethylene emission n LhERF gene expression. Moreover, the expression levels of NtERF gene in trnsgeni plnts were 3 times higher thn in nontrnsgeni plnts with C stress tretment (figure 5). Ethylene iosynthesis in plnts is tightly regulte y oth enogenous evelopmentl ues n exogenous stimuli, mostly through regultion of ACS tivity. Preise ontrol of ethylene iosynthesis is lerly importnt in vrious evelopmentl n physiologil proesses, n emerging eviene hs inite the involvement of MAPK se in regulting ethylene iosynthesis uner stress (Joo et l. 2008). Further stuy inite tht phosphoryltion of ACS2/ACS6 y MAPK prevente rpi egrtion of ACS2/ACS6 y 26S protesome resulting in n inrese in ACS tivity n ethylene proution (Hn et l. 2010). In Ariopsis, MPK3 n MPK6 n ontriute to the inution of ethylene proution in response to oth ioti n ioti stresses (Liu et l. 2008; Li et l. 2012), n these two MAPKs hve previously een reporte to e tivte y slt stress(xu et l. 2008) n pthogen infetion (Li et l. 2012). In this stuy, LMKK might inue the emission of ethylene, whih in turn tivte the expression of ERF gene in L. hinense. A propose working moel for the C-triggere MAPK signlling pthwy is shown in figure 6. This result is in orne with the work pulishe y Yoo et l. (2008), onstitutively tive MKK9 ws le to inue MPK3 n MPK6 kinse tivities n to upregulte the trnsript mount of ERF gene in plnt. Reent reserh hs eluite the signifint role of ERF in plnt pttion to ioti stresses (Shmit et l. 2013). Trnsgeni too plnts overexpressing the GmERF3 gene showe inrese resistne to high slinity n ehyrtion stresses (Zhng et l. 2009). TERF3 from Tritium estivum positively regulte whet pttion responses to ioti stresses through the tivtion of stress-relte genes (Rong et l. 2014). In the present stuy, the nontrnsgeni plnts umulte more ROS thn LMKK-overexpressing lines uner C stress onition. Previous stuies showe tht the MAPK pthwy plys n importnt role in ROS homeostsis. Overexpression of AtMKK1 in Ariopsis n erese stress-ssoite ROS umultion n inrese rought tolerne; onversely, AtMKK1 efiieny results in elevte ROS genertion s well s inrese sensitivity to rought tolerne (Xing et l. 2008). Our result showe tht the ontent of GSH in trnsgeni too ws higher thn in nontrnsgeni plnts uner C tretment (figure 5). Sine GSH is well known s mjor ntioxint (Notor et l. 2012; Zhng n Formn 2012), there my e link etween ROS Figure 6. Propose working moels for the C-triggere MAPK signlling pthwy. umultion n GSH synthesis in the trnsgeni too expressing 35S::LMKK uner C tretment. Ethylene signlling ws reently inite to regulte GSH synthesis for etter pttion of plnts ginst stress (Iql et l. 2013). The involvement of ethylene in regultion of GSH to overome metl stress (nikel n zin) in Brssi june (Khn n Khn 2014) ws inite. Ethylene hs lso een foun to regulte GSH synthesis n C stress tolerne (Msoo et l. 2012, ). Our previous stuy presente the eviene tht the overexpression of LhERF ws importnt for the upregultion of NtGSH1 n NtGSHS genes expression in trnsgeni too. The enhnement of Ctolerne in trnsgeni too might e ue to the ssoition of LhERF with the inution of GSH synthesis-relte genes (Gun et l. 2015). Conlusions In L. hinense, uner C stress, we foun tht GSH umultion ourre y enhne gene expression of LMKK, LhERF n LGSH1 n the ethylene s signl moleule my e involve in these umultions. Further, the overexpression of LMKK in trnsgeni too resulte in greter tolerne to C stress. Eviene presente here suggests tht the overexpression of LMKK my ount for the upregultion of GSH umultion in trnsgeni too. The enhnement of C-tolerne in trnsgeni too expressing LMKK might ue to the upregultion of ERF expression whih hs positive effet on the inution of GSH synthesis-relte genes. Journl of Genetis, Vol. 95, No. 4, Deemer

10 Chunfeng Gun et l. Aknowlegements This work ws supporte y Ntionl Nturl Siene Fountion of Chin ( ), Tinjin Reserh Progrmme of Applition Fountion n Avne Tehnology (no. 15JCQNJC14700) n the Sientifi Reserh Fountion for the returne Overses Chinese Sholrs, Stte Eution Ministry. Referenes Asno N., Kto A., Miyuhi M., Kizu H., Tomimori T., Mtsui K. et l Speifi α-gltosise inhiitors, N-methyllystegines struture/tivity reltionships of lystegines from Lyium hinense. Eur. J. Biohem. 248, Che H. S. n Kieer J. J Eto Brute? Role of ACS turnover in regulting ethylene iosynthesis. Trens Plnt Si. 10, Chmielowsk-Bąk J., Lefèvre I., Lutts S. n Dekert J Short term signling responses in roots of young soyen seelings expose to mium stress. J. Plnt Physiol. 170, Clemens S., Arts M. G., Thomine S. n Verruggen N Plnt siene: the key to prevent slow mium poisoning. Trens Plnt Si. 18, Cristin M. S., Petersen M. n Muny J Mitogen-tivte protein kinse signling in plnts. Annu. Rev. Plnt Biol. 61, e Kneht J. A., vn Dillen M., Koevoets P. L., Sht H., Verkleij J. A. n Ernst W. H Phytoheltins in mium-sensitive n mium-tolernt Silene vulgris (hin length istriution n sulfie inorportion). Plnt Physiol. 104, Dong J. Z., Wng Y., Wng S. H., Yin L. P., Xu G. J., Zheng C. et l Selenium inreses hlorogeni i, hlorophyll n rotenois of Lyium hinense leves. J. Si. Foo Agri. 93, Gun C., Ji J., Gun W., Feng Y., Li X., Jin C. et l A Lyium hinense-erive P5CS-like gene is regulte y wter efiitinue enogenous sisi i n overexpression of this gene enhnes tolerne to wter efiit stress in Ariopsis. Mol. Bree. 34, Gun C., Liu X., Song X., Wng G., Ji J. n Jin C Overexpression of peroxireoxin Q gene, SsPrxQ, in Eustom grniflorum Shinn enhnes its tolerne to slt n high light intensity. Mol. Bree. 33, Gun C., Ji J., Ji C., Gun W., Li X., Jin C. et l A GSHSlike gene from Lyium hinense my e regulte y miuminue enogenous sliyli i n overexpression of this gene enhnes tolerne to mium stress in Ariopsis. Plnt Cell Rep. 34, Gun C., Ji J., Wu D., Li X., Jin C., Gun W. et l The glutthione synthesis my e regulte y mium-inue enogenous ethylene in Lyium hinense, n overexpression of n ethylene responsive trnsription ftor gene enhnes tolerne to mium stress in too. Mol. Bree. 35, Gun C., Jin C., Ji J., Wng G. n Li X LBiP, enoplsmi retiulum hperone ining protein gene from Lyium hinense, onfers mium tolerne in trnsgeni too. Biotehnol. Prog. 31, Hmel L.-P., Niole M.-C., Sritutim S., Moreny M.-J., Ellis M., Ehlting J. et l Anient signls: omprtive genomis of plnt MAPK n MAPKK gene fmilies. Trens Plnt Si. 11, Hn L., Li G. J., Yng K. Y., Mo G., Wng R., Liu Y. et l Mitogen-tivte protein kinse 3 n 6 regulte Botrytis inere-inue ethylene proution in Ariopsis. Plnt J. 64, Hung X.-S., Liu J.-H. n Chen X.-J Overexpression of PtrABF gene, ZIP trnsription ftor isolte from Ponirus trifolit, enhnes ehyrtion n rought tolerne in too vi svenging ROS n moulting expression of stress-responsive genes. BMC Plnt Biol. 10, 230. Hung W.-C., Hung D.-D., Yeh C.-M. n Hung H.-J Retive oxygen speies, lium n serine/threonine phosphtse re require for opper-inue MAP kinse gene OsMAPK2, expression in rie. Plnt Growth Regul. 45, Ikimov E., Kphin-Totev V., e Jong A., Atnssov A. n Woltering E Involvement of ethylene, oxitive stress n lipi-erive signls in mium-inue progrmme ell eth in tomto suspension ells. BMC Plnt Biol. 5 (suppl 1), S19. Iql N., Msoo A., Khn M. I. R., Asgher M., Ftm M. n Khn N. A Cross-tlk etween sulfur ssimiltion n ethylene signling in plnts. Plnt Signl. Behv. 8, 1 9. Jonk C., Nkgmi H. n Hirt H Hevy metl stress: tivtion of istint mitogen-tivte protein kinse pthwys y opper n mium. Plnt Physiol. 136, Joo S., Liu Y., Lueth A. n Zhng S MAPK phosphoryltioninue stiliztion of ACS6 protein is meite y the non-tlyti C-terminl omin, whih lso ontins the iseterminnt for rpi egrtion y the 26S protesome pthwy. Plnt J. 54, Khn M. I. R. n Khn N. A Ethylene reverses photosyntheti inhiition y nikel n zin in mustr through hnges in PS II tivity, photosyntheti nitrogen use effiieny, n ntioxint metolism. Protoplsm 251, Király L., Künstler A., Höller K., Fttinger M., Juhász C., Müller M. et l Sulfte supply influenes omprtment speifi glutthione metolism n onfers enhne resistne to too mosi virus uring hypersensitive response. Plnt Physiol. Biohem. 59, Kumr K., Ro K. P., Shrm P. n Sinh A. K Differentil regultion of rie mitogen tivte protein kinse kinse (MKK) y ioti stress. Plnt Physiol. Biohem. 46, LiG.,MengX.,WngR.,MoG.,HnL.,LiuY.et l Dul-level regultion of ACC synthse tivity y MPK3/MPK6 se n its ownstrem WRKY trnsription ftor uring ethylene inution in Ariopsis. PLoS Genet. 8, e Lihtenthler H. K Chlorophylls n rotenois: pigments of photosyntheti iomemrnes. Methos Enzymol. 148, Lin Z., Zhong S. n Grierson D Reent vnes in ethylene reserh. J. Exp. Bot. 60, Liu H., Wng Y., Xu J., Su T., Liu G. n Ren D Ethylene signling is require for the elertion of ell eth inue y the tivtion of AtMEK5 in Ariopsis. Cell Res. 18, Liu K., Shen L. n Sheng J Improvement in mium tolerne of tomto seelings with n ntisense DNA for 1-minoylopropne-1-roxylte synthse. J. Plnt Nutr. 31, Liu X.-M., Kim K.E., Kim K.-C., Nguyen X. C., Hn H. J., Jung M. S. et l Cmium tivtes Ariopsis MPK3 n MPK6 vi umultion of retive oxygen speies. Phytohemistry 71, Liu Y. n Zhng S Phosphoryltion of 1-minoylopropne-1-roxyli i synthse y MPK6, stress-responsive mitogen-tivte protein kinse, inues ethylene iosynthesis in Ariopsis. Plnt Cell 16, Lu W., Chu X., Li Y., Wng C. n Guo X Cotton GhMKK1 inues the tolerne of slt n rought stress, n meites efene responses to pthogen infetion in trnsgeni Niotin enthmin. PLoS One 8, e Msoo A., Iql N., Khn M. I. R. n Khn N. A The oorinte role of ethylene n gluose in sulfur-meite protetion of photosyntheti inhiition y mium. Plnt Signl. Behv. 7, Journl of Genetis, Vol. 95, No. 4, Deemer 2016

11 LMKK is ssoite with the enhne expression level of ERF n GSH synthesis-relte genes Msoo A., Iql N. n Khn N. A Role of ethylene in llevition of mium-inue photosyntheti pity inhiition y sulphur in mustr. Plnt Cell Environ. 35, Menoz-Cóztl D. G., Joe T. O., Huser F. n Shroeer J. I Long-istne trnsport, vuolr sequestrtion, tolerne, n trnsriptionl responses inue y mium n rseni. Curr. Opin. Plnt Biol. 14, Nkgmi H., Pitzshke A. n Hirt H Emerging MAP kinse pthwys in plnt stress signlling. Trens Plnt Si. 10, Notor G., Mhmi A., Chouh S., Hn Y., Neukermns J., Mrquez-Gri B. et l Glutthione in plnts: n integrte overview. Plnt Cell Environ. 35, Openkker K., Remns T., Vngronsvel J. n Cuypers A Mitogen-tivte protein (MAP) kinses in plnt metl stress: regultion n responses in omprison to other ioti n ioti stresses. Int. J. Mol. Si. 13, Ro K. P., Rih T., Kumr K., Rghurm B. n Sinh A. K In silio nlysis revels 75 memers of mitogen-tivte protein kinse kinse kinse gene fmily in rie. DNA Res. 17, Roríguez-Serrno M., Romero-Puerts M. C., Pzmiño D. M., Testillno P. S., Risueño M. C., Luis A. et l Cellulr response of pe plnts to mium toxiity: ross tlk etween retive oxygen speies, nitri oxie, n lium. Plnt Physiol. 150, Rong W., Qi L., Wng A., Ye X., Du L., Ling H. et l The ERF trnsription ftor TERF3 promotes tolerne to slt n rought stresses in whet. Plnt Biotehnol. J. 12, Snità i Toppi L. n Grielli R Response to mium in higher plnts. Environ. Exp. Bot. 41, Shmit R., Mieulet D., Huerten H.-M., Ot T., Hoefgen R., Fernie A. R. et l Slt-responsive ERF1 regultes retive oxygen speies-epenent signling uring the initil response to slt stress in rie. Plnt Cell 25, Semne B., Cuypers A., Smeets K., Vn Belleghem F., Horemns N., Sht H. et l Cmium responses in Ariopsis thlin: glutthione metolism n ntioxitive efene system. Physiol. Plnt 129, Shn X., Yn J. n Xie D Comprison of phytohormone signling mehnisms. Curr. Opin. Plnt Biol. 15, Tmur K., Duley J., Nei M. n Kumr S MEGA4: moleulr evolutionry genetis nlysis (MEGA) softwre version 4.0. Mol. Biol. Evol. 24, Wng G., Du X., Ji J., Gun C., Li Z. n Josine T. L De novo hrteriztion of the Lyium hinense Mill. lef trnsriptome n nlysis of nite genes involve in rotenoi iosynthesis. Gene 555, Wu D., Ji J., Wng G., Gun C. n Jin C LhERF, novel ethylene-responsive trnsription ftor from Lyium hinense, onfers slt tolerne in trnsgeni too. Plnt Cell Rep. 12, Wu D., Ji J., Wng G., Gun W., Gun C., Jin C. et l LMKK, novel group, mitogen-tivte protein kinse kinse gene in Lyium hinense, onfers ehyrtion n rought tolerne in trnsgeni too vi svenging ROS n moulting expression of stress-responsive genes. Plnt Growth Regul. 76, Xing Y., Ji W. n Zhng J AtMKK1 meites ABA-inue CAT1 expression n H 2 O 2 proution vi AtMPK6-ouple signling in Ariopsis. Plnt J. 54, Xiong L. n Yng Y Disese resistne n ioti stress tolerne in rie re inversely moulte y n sisi iinuile mitogen-tivte protein kinse. Plnt Cell 15, Xu J.,LiY.,Wng Y.,LiuH.,LeiL.,YngH.et l Ativtion of MAPK kinse 9 inues ethylene n mlexin iosynthesis n enhnes sensitivity to slt stress in Ariopsis. J. Biol. Chem. 283, Yeh C.-M., Hsio L.-J. n Hung H.-J Cmium tivtes mitogen-tivte protein kinse gene n MBP kinses in rie. Plnt Cell Physiol. 45, Yeh C.-M., Chien P.-S. n Hung H.-J Distint signlling pthwys for inution of MAP kinse tivities y mium n opper in rie roots. J. Exp. Bot. 58, Yoo S.-D., Cho Y.-H., Ten G., Xiong Y. n Sheen J Dul ontrol of nuler EIN3 y ifurte MAPK ses in C 2 H 4 signlling. Nture 451, Zhng H. n Formn H. J Glutthione synthesis n its role in reox signling. Semin. Cell Dev. Biol. 23, Zhng B., Shng S., Jeen Z. n Zhng G Involvement of ethylene in llevition of C toxiity y NCl in too plnts. Eotoxiol. Environ. Sf. 101, Zhng G., Chen M., Li L., Xu Z., Chen X., Guo J. et l Overexpression of the soyen GmERF3 gene, n AP2/ERF type trnsription ftor for inrese tolernes to slt, rought, n iseses in trnsgeni too. J. Exp. Bot. 60, Zhng R., Ah Kng K., Pio M. J., Kim K. C., Kim A. D., Che S. et l Cytoprotetive effet of the fruits of Lyium hinense Miller ginst oxitive stress-inue heptotoxiity. J. Ethnophrmol. 130, Zheng G., Zheng Z., Xu X. n Hu Z Vrition in fruit sugr omposition of Lyium rrum L. n Lyium hinense Mill. of ifferent regions n vrieties. Biohem. Syst. Eol. 38, Reeive 7 Septemer 2015, in revise form 21 Mrh 2016; epte 28 Mrh 2016 Uneite version pulishe online: 31 Mrh 2016 Finl version pulishe online: 23 Novemer 2016 Corresponing eitor: JITENDRA KHURANA Journl of Genetis, Vol. 95, No. 4, Deemer