Flow Cytometry as a Strategy to Study the Endosymbiosis of Algae in Paramecium bursaria
|
|
- Dana Bridges
- 5 years ago
- Views:
Transcription
1 2000 Wiley-Liss, Inc. Cytometry 41: (2000) Flow Cytometry as a Strategy to Study the Endosymbiosis of Algae in Paramecium bursaria Bogdan I. Gerashchenko, 1 Naohisa Nishihara, 1 Toshiko Ohara, 2 Hiroaki Tosuji, 2 Toshikazu Kosaka, 1 and Hiroshi Hosoya 1,3 * 1 Department of Biological Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima, Japan 2 Department of Chemistry and Bioscience, Faculty of Science, Kagoshima University, Kagoshima, Japan 3 PRESTO, Japan Science and Technology Corporation (JST), Higashi-Hiroshima, Japan Received 13 April 2000; Revision Received 13 July 2000; Accepted 21 July 2000 Background: The stable symbiotic association between Paramecium bursaria and algae is of interest to study such mechanisms in biology as recognition, specificity, infection, and regulation. The combination of algae-free strains of P. bursaria, which have been recently established by treating their stocks of green paramecia with herbicide paraquat (Hosoya et al.: Zool Sci 12: , 1995), with the cloned symbiotic algae isolated from P. bursaria (Nishihara et al.: Protoplasma 203: 91 99, 1998), provides an excellent clue to gain fundamental understanding of these phenomena. Methods: Flow cytometry and light microscopy have been employed to characterize the algal cells after they have been released from the paramecia by ultrasonic treatment. Algal optical properties such as light scattering and endogenous chlorophyll fluorescence intensity have been monitored for symbiotic and free-living strains, and strains at stages of interaction with a host. Results: Neither algal morphology nor chlorophyll content has been found to be altered by sonication of green paramecia. This fact allows to interpret in adequate degree changes in the optical properties of symbiont that just has been released from the association with a host (decreased forward light scatter and chlorophyll fluorescence signals). Optical characterization of both symbiotic and free-living algal strains with respect to their ability to establish symbioses with P. bursaria showed that chlorophyll content per cell volume seems to be a valuable factor for predicting a favorable symbiotic relationship between P. bursaria and algae. Conclusions: Flow cytometry combined with algae-free paramecia and cloned symbiotic algae identifies algal populations that may be recognized by host cells for the establishment of symbioses. Cytometry 41: , Wiley-Liss, Inc. Key terms: cloned symbiotic algae; Paramecium bursaria; symbiosis; light scattering; chlorophyll; fluorescence; flow cytometry; microscopy Symbiotic associations are excellent models for studying cell-to-cell interaction, mechanisms of immunity, and evolution of eukaryotic cells. Endosymbioses of freshwater hosts and algae, i.e., green ciliates, achieve stability through such complex phenomena as recognition, specificity, and regulation (1). Actually, green protozoa are widespread in different types of freshwater and seawater habitats. They, particularly green ciliates, were among the first organisms ever observed by light microscopy. The ciliate, Paramecium bursaria, exists as a green paramecium because each animal cell carries in its cytoplasm several hundred unicellular green algal cells that are morphologically similar to the genus, Chlorella. One of the remarkable and not well-understood peculiarities of this system is the steady state in number of algae per protozoan cell. Although P. bursaria and algae coexist symbiotically (2 5), these two partners can be separated, cultured independently, and recombined to reestablish a symbiotic relationship (6 11; Fig. 1). Recently, endosymbiotic algae isolated from P. bursaria were cloned and their infectivity to algae-free paramecia examined (10 12). In the present study, using flow cytometry, algal cell size and chlorophyll content were used to evaluate the symbiont interaction with a host. This is because both cell growth and chlorophyll metabolism are presumed to be readily affected by changes in environmental conditions. In addition, these two criteria are informative enough to discriminate algal populations on their ability to establish symbioses with host cells. For this purpose, we employed clones of symbiotic as well as free-living (non-symbiotic) algae. Grant sponsor: Japan Science and Technology Corporation (JST). *Correspondence to: Dr. Hiroshi Hosoya, Department of Biological Science, Graduate School of Science, Hiroshima University, Kagamiyama, Higashi-Hiroshima , Japan. hhosoya@sci.hiroshima-u.ac.jp
2 210 GERASHCHENKO ET AL. FIG. 1. Schematic diagram showing the reestablishment of symbiotic unit (1) after separation of the host (P. bursaria) and the symbiont (algae; 2 and 3) for independent culturing. Symbiotic algae are ingested by algae-free P. bursaria (4). After ingestion, only a few are still alive. They are enclosed in special perialgal vacuoles (5) and they expand (6) until the system reaches a steady state in symbiont number per host cell (7, 8). MATERIALS AND METHODS Experimental Organisms One strain of P. bursaria syngen 1 (KSK-103, mating type IV) was isolated from the Kawasa-kyo river in Fuchu City (Hiroshima, Japan) in It was maintained in lettuce infusion supplemented with Klebsiella pneumoniae as a food with a 12- h light and 12-h dark (LD) regimen at 23 1 C. Five strains of cloned symbiotic algae (SA-1, SA-3 and SA-3a, SA-4, and SA-9) were obtained from the following strains of P. bursaria singen 1: OK-312, I (Okuda-Oike pond, Higashi-Hiroshima City, Hiroshima, Japan, 1991); KSK-103, IV (Kawasa-kyo river, 1995); BS-4, II (a river in Bessiyama Village, Ehime, Japan, 1994); and OZ-3, III (Ozegawa river, Otake City, Hiroshima, Japan, 1994; respectively (12). Five strains of free-living algae (Chlorella vulgaris [c-27], Chlorella sorokiniana [c-43 and c-212], and Chlorella kessleri [c-208 and c-531]) were obtained in 1998 from the Institute of Applied Microbiology (IAM) culture collection at the University of Tokyo. Before the experiment, both symbiotic and free-living algae were transferred from agar plates containing CA medium (12) to the liquid CA medium and cultured under constant light (approximately 2,000 lux) at 24 C as described previously (12). At the stationary phase of growth (10-day culture), the algal cells in suspension were centrifuged at 720g for 5 min, washed three times in phosphate-buffered saline (PBS; 137 mm NaCl, 2.7 mm KCl, 1.5 mm KH 2 PO 4, 8.0 mm Na 2 HPO 4, ph 7.3), brought to a concentration of cells/ml, and further analyzed by flow cytometry. Reinfection In order to estimate the effects of symbiosis with respect to the cloned algal cells, one strain of symbiotic algae (SA-3) was employed to reinfect (procedure: 12) the algae-free P. bursaria (KSKw-103) obtained from the green paramecia (KSK-103) using the herbicide, paraquat (10). Both the algae and the algae-free paramecia were washed three times with lettuce infusion and mixed at a ratio of about algae:1 paramecium. One hundred paramecia were used for reinfection. The mixture was incubated for 24 h under the same conditions as the stock culture. After incubation, the paramecia were individually isolated from the reaction mixture, washed three times in depression slides, and transferred for culturing to the hanging drops of bacterized lettuce infusion (one paramecium per drop). The ratio of reinfection obtained in paramecia after 5-day culturing in the hanging drops reached 95%. Finally, reinfected ( re-green ) paramecia (KSKr-103) were expanded in lettuce infusion after they had been individually separated from noninfected cells. Sonication Conditions Both green (KSK-103) and re-green (KSKr-103) paramecia at the late logarithmic phase of growth (10-day culture) were washed three times with lettuce infusion followed by ultrasonic treatment (Branson Sonifier model 450, Branson Ultrasonics, Danbury, CT). Approximately 3,000 cells in 1 ml of lettuce infusion were sonicated in 1.5-ml plastic tubes surrounded by ice at the output control setting of 3 for 90 s. Under these conditions, paramecia were completely destroyed, but symbiotic algae were not affected in appearance. Prior to flow cytometry, the homogenates of paramecia were centrifuged at 720g for 5 min. The released algae were washed three times in PBS and brought to a concentration of cells/ml. The control experiment with algae (SA-3) that were not used for reinfection of the host cells, using various treatment conditions such as output control settings of 2 and 3 and a sonication time of 0, 45, 90, or 135 s, gave similar results in the algal numbers as well as in algal morphology and chlorophyll content according to the microscopic and flow cytometric observations (data not shown).
3 SYMBIOTIC ALGAE AND FLOW CYTOMETRY 211 FIG. 2. Two-parameter light scatter plots (FSC versus SSC) and histograms of chlorophyll fluorescence (FL3) of control algal cells (SA-3), which were not used for reinfection of paramecia (A,B) and algal cells (SA-3) after they were collected from reinfected paramecia (KSKr-103; C,D). E,F: Wild-type algae of green paramecia (KSK-103). Events with low light scatter (E) and fluorescence signal (F) may correspond to algae of the clone SA-3a shown in Figure 3A. Optical Measurements The algal samples were analyzed on a FACSCalibur flow cytometer (Becton-Dickinson Immunocytometry Systems, San Jose, CA) equipped with a 15-mW argon-ion laser (488 nm). The fluorescence of endogenous chlorophyll was measured in the red fluorescence channel (FL 3) through a 650-nm longpass filter with logarithmic amplification. The forward (FSC) and 90 side scatter (SSC) signals were collected in linear mode. Approximately events were measured. Analysis of the data was performed with CELLQuest software (Becton Dickinson). Cells were gated on the chlorophyll fluorescence signals to eliminate debris from the analysis. In addition, algae were characterized morphologically by bright field light microscopy (BH-2 microscope, Olympus, Japan). RESULTS Comparison of control SA-3 cells with algal cells collected from reinfected P. bursaria (KSKr-103) did not show a change in SSC, but showed a decrease in FSC (Fig.
4 FIG. 3. Strains of cloned symbiotic (A) and free-living (B) algae (10-day culture in liquid CA medium) characterized by flow cytometry and bright field light microscopy. Light micrographs of the cloned algae of each strain are shown with their dual-parameter histograms of FSC against SSC and histograms of chlorophyll fluorescence intensity (FL3). Scale bar 10 m.
5 SYMBIOTIC ALGAE AND FLOW CYTOMETRY 213 FIG. 3.CONT.
6 214 GERASHCHENKO ET AL. 2A versus 2C). There was also an alteration in the profile of the fluorescence histogram (bimodality with the tendency to trimodality) with a slight decrease of the relative fluorescence intensity (Fig. 2B versus 2D). The same optical parameters were utilized to monitor the wild type, i.e., noncloned, algae from green paramecia (KSK-103; Figs. 2E and 2F). Together, the appearance of events with lower light scatter and fluorescence signal, and the shape of the major peak of the fluorescence histogram, may reflect the fact that a population of algae naturally inhabiting the green paramecia (KSK-103) is composed of various cell clones. Figure 3 presents the flow cytometric and microscopic characterization of the cloned algae of different strains at the stationary phase of growth. The algae of both symbiotic and free-living strains were highly diverse in their morpho-optical parameters. Because the algal cells are coccoid, the FSC signals from algae in general were correlated with their size. These algal strains were further characterized by the dependency between cell sizes and fluorescence intensities of endogenous chlorophyll. Their distribution based on the mean magnitude of FSC signals is demonstrated in the relationship with mean chlorophyll fluorescence per cell (Fig. 4A). The majority of algal strains were distributed in accordance with a logarithmic type curve, except for three clones of symbiotic algae (SA-1, SA-3, and SA-9). Thus, algal cell size may not always correlate with chlorophyll fluorescence intensity. The same three clones were also distinguishable in the graph of clonal dispersion where the FSC parameter was substituted for the SSC parameter (Fig. 4B). DISCUSSION We have shown that reinfection of P. bursaria by cloned symbiotic algae (SA-3) results in changes in the algal light scatter and in autofluorescence characteristics (reduced forward light scatter and fluorescence signals). This may be due to the fact that the algae in the host decrease in size with concordant decrease of the relative chlorophyll content per cell. A number of growth and metabolic parameters in algae, including chlorophyll content, are affected by changes in environmental conditions (e.g., nutrition, light intensity, and temperature; 13). The bimodal character of the algal fluorescence histogram (Fig. 2D) may reflect the distinct redistribution of the chlorophyll content within the population of algae inhabited in the host. To determine whether or not this phenomenon is cell division cycle dependent, further investigations are needed. The same optical properties of algae (light scattering and fluorescence of endogenous chlorophyll) have been examined to evaluate the algal potential for the establishment of symbioses with P. bursaria. For this purpose, strains of free-living and symbiotic algae were screened together as a reference, because little is known about the perfect symbiotic relationships between free-living algae and P. bursaria. In general, they are not infective for P. bursaria, or they have low infectivity with no permanent symbioses. Although there are no principal differences in FIG. 4. Optical mapping of algal strains based on the relationship between chlorophyll fluorescence intensity per cell and magnitude of FSC (A) and SSC (B) signals. Their values are expressed as mean channel numbers. ( ), ( ), ( ), and (-) represent clones with high, intermediate, low, and no infectivity, respectively. morphology or cytology between symbiotic and free-living algae, they differ by some physiological properties (14). Symbiotic algae can excrete monosaccharides and disaccharides such as glucose, fructose, xylose, maltose, and trehalose, and this function is not induced by external factors. Moreover, they produce more oxygen at low light fluence rates than do free-living algae. The ability of algae to release sugar and the algal cell surface organization are the only criteria known to date by which P. bursaria selects its symbiotic partner (1,15,16). We demonstrate that by two-parametric analysis of mean channel numbers of the optical signals (FSC versus chlorophyll fluorescence and SSC versus chlorophyll fluorescence) from algae of
7 SYMBIOTIC ALGAE AND FLOW CYTOMETRY 215 different strains with different infectivity for P. bursaria (KSKw-103) an algal symbiotic capability is likely to be reliably assessed by the additional two criteria such as cell size/volume and chlorophyll content. The infectivities of various algal strains with respect to P. bursaria (KSKw- 103) were previously examined and expressed as a percentage of reinfected paramecia (KSKr-103) among the total number of paramecia taken for reinfection after a 20-day incubation of reaction mixture (our unpublished data). Algae capable of reinfecting % of host cells were designated as highly infective; 40 69% of host cells algae with intermediate infectivity; less than 40% of host cells algae with low infectivity. Algae that did not infect paramecia at all were designated as noninfective. Among the highly infective algal strains demonstrated in optical maps (Fig. 4), the clones of symbiotic algae such as SA-1, SA-3, and SA-9 were located separately from the major group of less infective and noninfective clones: SA-3a; SA-4; C. vulgaris (c-27); C. sorokiniana (c-43 and c-212); and C. kessleri (c-208 and c-531) with a logarithmic character of dispersion. Although the algae of SA-1, SA-3, and SA-9 clones have smaller sizes than the freeliving algae of clones such as C. sorokiniana (c-43) and C. kessleri (c-208 and c-531), they autofluoresce brighter except C. kessleri (c-208). At the same time, they are larger and brighter than SA-3a, SA-4, C. vulgaris (c-27), and C. sorokiniana (c-212). These findings prompted us to conclude that algae with smaller sizes/volumes with larger amounts of chlorophyll have the higher probability to reinfect a host with a subsequent stable symbiosis. In this regard, a factor such as chlorophyll content per cell volume is valuable for predicting favorable symbiotic relationships between P. bursaria and algae. Interestingly, the algae of other symbiotic clones, such as SA-3a and SA-4, which have smaller sizes and less autofluorescence intensities, are known to be noninfective. Moreover, the SA-4 clone showed no infectivity with respect to its stock host, BS-4 (our unpublished data). We propose that algae of these two clones, and possibly algae of other unknown symbiotic clones, which became smaller and chlorophyll deficient, became low or noninfective, were generated later and survived the evolution/selection process. Thus, optical mapping of algal strains by means of flow cytometry is an easy, quick, and reliable tool for monitoring chlorophyll content/cell volume state and assessing their symbiotic potential. ACKNOWLEDGMENTS We thank Y. Ishizaka for her helpful technical assistance. B.I.G. is grateful for the Monbusho-scholarship provided by The Ministry of Education, Science and Culture of Japan. LITERATURE CITED 1. Reisser W. Basic mechanisms of signal exchange, recognition, specificity, and regulation in endosymbiotic systems. In: Reisser W, editor. Algae and symbioses: plants, animals, fungi, viruses, interaction explored. Bristol: Biopress; p Karakashian MW. Growth of Paramecium bursaria as influenced by the presence of algal symbionts. Physiol Zool 1963;36: Pado R. Mutual relation of protozoans and symbiotic algae in Paramecium bursaria. I. The influence of light on the growth of symbionts. Folia Biol 1965;13: Weis DS. Regulation of host and symbiont population size in Paramecium bursaria. Experientia 1969;25: Weis DS. Synchronous development of symbiotic chlorellae with Paramecium bursaria. Trans Am Microsc Soc 1977;96: Loefer JB. Isolation and growth characteristics of the zoochlorella of Paramecium bursaria. Am Nat 1936;70: Siegel RW. Hereditary endosymbiosis in Paramecium bursaria. Exp Cell Res 1960;19: Weis DS, Ayala A. Effect of exposure period and algae concentration on the frequency of infection of aposymbiotic ciliates by symbiotic algae from Paramecium bursaria. J Protozool 1979;26: Meier R, Wiessner W. Infection of algae-free Paramecium bursaria with symbiotic Chlorella sp. isolated from green paramecia. I. Effect of the incubation period. Eur J Protistol 1988;24: Hosoya H, Kimura K, Matsuda S, Kitaura M, Takahashi T, Kosaka T. Symbiotic algae-free strains of the green paramecium Paramecium bursaria produced by herbicide paraquat. Zool Sci 1995; 12: Nishihara N, Takahashi T, Kosaka T, Hosoya H. Characterization of symbiotic algae-free strains of Paramecium bursaria produced by the herbicide paraquat. J Protozool Res 1996;6: Nishihara N, Horiike S, Takahashi T, Kosaka T, Shigenaka Y, Hosoya H. Cloning and characterization of endosymbiotic algae isolated from Paramecium bursaria. Protoplasma 1998;203: Meeks JC. Chlorophylls. In: Stewart WDP, editor. Algal physiology and biochemistry. Botanical monographs, Volume 10. Oxford: Blackwell Scientific Publications; p Reisser W, Widowski M. Taxonomy of eukaryotic algae endosymbiotic in freshwater associations. In: Reisser W, editor. Algae and symbioses: plants, animals, fungi, viruses, interaction explored. Bristol: Biopress; p Weis DS. Correlation of infectivity and concanavalin A agglutinability of algae exsymbiotic from Paramecium bursaria. J Protozool 1978; 25: Weis DS. Correlation of sugar release and concanavalin A agglutinability with infectivity of symbiotic algae from Paramecium bursaria for aposymbiotic P. bursaria. J Protozool 1979;26:
Four important cytological events needed to establish endosymbiosis of symbiotic Chlorella sp. to the algafree Paramecium bursaria
Jpn. J. Protozool. Vol. 44, No. 1. (2011) 1 Review Four important cytological events needed to establish endosymbiosis of symbiotic Chlorella sp. to the algafree Paramecium bursaria Yuuki KODAMA 1* and
More informationPhotoadaptation Alters the Ingestion Rate of Paramecium bursaria,
APPLIED AND ENVIRONMENAL MICROBIOLOGY, Aug. 1991, p. 2312-2316 Vol. 57, No. 8 0099-2240/91/082312-05$02.O0/0 Copyright 1991, American Society for Microbiology Photoadaptation Alters the Ingestion Rate
More informationAnswer Key- Biology Review for Fall Benchmark
Name Class Answer Key- Biology Review for Fall Benchmark Definitions You should know what every word on this page means. Look through the entire review sheet and highlight any words you do not recognize.
More informationCHAPTER 7 VIRUSES BACTERIA PROTISTS FUNGI
CHAPTER 7 VIRUSES BACTERIA PROTISTS FUNGI 1 Chapter 7 Objectives: Section 1: 1. List characteristics of viruses and start reasons why viruses are considered to be nonliving 2. Describe the components of
More informationMeasuring Mitochondrial Membrane Potential with JC-1 Using the Cellometer Vision Image Cytometer
Measuring Mitochondrial Membrane Potential with JC-1 Using the Cellometer Vision Image Cytometer Nexcelom Bioscience LLC. 360 Merrimack Street, Building 9 Lawrence, MA 01843 T: 978.327.5340 F: 978.327.5341
More informationCHAPTER 1 BIOLOGY THE SCIENCE OF LIFE
CHAPTER 1 BIOLOGY THE SCIENCE OF LIFE BIOLOGICAL THEMES 1. Cell Structure & Function cell is the basic unit of life all organisms are composed of at least one cell Unicellular single celled ; bacteria,
More informationProtists are in the Eukaryote Domain
Protista Protists are in the Eukaryote Domain All protists are eukaryotic (cells with a nucleus) Euglena Paramecium Amoeba Protists are really just all of the Eukaryotes that don t fit into the Animal,
More informationTEMPORAL RELATIONSHIPS OF HOST CELL AND ALGAL MITOSIS IN THE GREEN HYDRA SYMBIOSIS
J. Cell Sci. 58, 423-431 (1982) 423 Printed in Great Britain Company of Biologists Limited 1982 TEMPORAL RELATIONSHIPS OF HOST CELL AND ALGAL MITOSIS IN THE GREEN HYDRA SYMBIOSIS P.J.McAULEY Department
More informationPLANT BIOLOGY (PBIO) Plant Biology (PBIO) 1
Plant Biology (PBIO) 1 PLANT BIOLOGY (PBIO) PBIO 1052 How Plants Shaped Our World (LN) Description: This course is an eclectic dive into the world of plants and their influence on human society. Students
More informationViruses of symbiotic Chlorella-like algae isolated from Paramecium
Proc. Nat. Acad. Sci. USA Vol. 79, pp. 3867-3871, June 1982 Microbiology Viruses of symbiotic Chlorella-like algae isolated from Paramecium bursaria and Hydra viridis (symbiosis/double-stranded DNA viruses/eukaryotic
More informationWhat Are the Protists?
Protists 1 What Are the Protists? 2 Protists are all the eukaryotes that are not fungi, plants, or animals. Protists are a paraphyletic group. Protists exhibit wide variation in morphology, size, and nutritional
More informationBioMEDIA ASSOCIATES LLC HIDDEN BIODIVERSITY Series
BioMEDIA ASSOCIATES LLC HIDDEN BIODIVERSITY Series Ciliates Study Guide Written and Photographed by Rubén Duro Pérez Supplement to Video Program All Text and Images Copyright 2015 BioMEDIA ASSOCIATES LLC
More informationEFFECTS OF OXALIC ACID ON CHLOROPHYLL CONTENT, VEGETATIVE SURVIVAL AND REPRODUCTION OF THE FRESHWATER GREEN ALGAE
ISSN: 976-876 (Print) ISSN: -8 (Online) EFFECTS OF OXALIC ACID ON CHLOROPHYLL CONTENT, VEGETATIVE SURVIVAL AND REPRODUCTION OF THE FRESHWATER GREEN ALGAE SUMAN BHARDWAJ a AND S. C. AGRAWAL b ab Phycology
More informationExplain your answer:
Biology Midterm Exam Review Introduction to Biology and the Scientific Method Name: Date: Hour: 1. Biology is the study of: 2. A living thing is called a(n): 3. All organisms are composed of: 4. The smallest
More informationEvolutionary Significance of Symbiosis in Ecosystem Development
Evolutionary Significance of Symbiosis in Ecosystem Development, Division of Microbiology, ICAR-Indian Agricultural Research Institute, New Delhi (India) 110 012 * Corresponding author e-mail: amanjaiswal1989@gmail.com
More informationMicrobiology. Definition of a Microorganism. Microorganisms in the Lab. The Study of Microorganisms
Microbiology The Study of Microorganisms Definition of a Microorganism Derived from the Greek: Mikros, «small» and Organismos, organism Microscopic organism which is single celled (unicellular) or a mass
More informationMODULE 2 : FOUNDATIONS IN BIOLOGY
OCR A LEVEL BIOLOGY MODULE 2 : FOUNDATIONS IN BIOLOGY REVISION NOTES For 2015 onwards specification Miss T Banda All living things are primarily made from 4 key elements: Carbon (C) Hydrogen (H) Oxygen
More informationChapter 2 Microbes in Perspective: Of Collectors and Classifiers
Chapter 2 Microbes in Perspective: Of Collectors and Classifiers Objectives: After reading Chapter Two, you should understand The schemes used throughout history to classify organisms. How microorganisms
More informationStructures and Life Functions of Single-Celled Organisms
Structures and Life Functions of Single-Celled Organisms 7.L.1.1 - Compare the structures and life functions of single-celled organisms that carry out all of the basic functions of life including: Euglena
More informationIntroductory Microbiology Dr. Hala Al Daghistani
Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health
More informationObjective 1: I can describe protists. Protists are a kingdom of living organisms that CAN NOT be classified as animals plants or fungus.
Kingdom Protista Objective 1: I can describe protists Protists are a kingdom of living organisms that CAN NOT be classified as animals plants or fungus. They are: Eukaryotic they contain a nucleus Can
More informationINTRODUCTION prokaryotic eukaryotic pigments
INTRODUCTION This exercise is intended for you to get familiar and comfortable with using a microscope as well as identifying common microbial groups. Thus, we will observe representatives of all microbes
More informationIntroduction to Biology with Lab
Introduction to Biology with Lab Course Text/Materials Mader, Sylvia S. Inquiry into Life, 12th edition, McGraw-Hill, 2008, ISBN: 9780073309330 [find and buy the text: Straighterline.com/textbooks] Custom
More informationVariation and asymmetry in host-symbiont dependence in a microbial symbiosis
Minter et al. BMC Evolutionary Biology (2018) 18:108 https://doi.org/10.1186/s12862-018-1227-9 RESEARCH ARTICLE Open Access Variation and asymmetry in host-symbiont dependence in a microbial symbiosis
More information13. The diagram below shows two different kinds of substances, A and B, entering a cell.
Name 1. In the binomial system of nomenclature, which two classification groups provide the scientific name of an organism? A) kingdom and phylum B) phylum and species C) kingdom and genus D) genus and
More informationCELL STRUCTURE & FUNCTION
CELL STRUCTURE & FUNCTION CELL TYPES Living cells can be classified into 2 different types on the basis of their internal structure: 4. Prokaryotic Cells 5. Eukaryotic Cells 1. Prokaryotic Cells Are the
More informationANALYSIS OF MICROBIAL COMPETITION
ANALYSIS OF MICROBIAL COMPETITION Eric Pomper Microbiology 9 Pittsburgh Central Catholic High School Grade 9 Introduction Escherichia coli (E. coli) and Saccharomyces cerevisiae (Yeast) were grown together
More informationThe Evolutionary Relationships between Endosymbiotic Green Algae of Paramecium bursaria Syngens Originating from Different Geographical Locations
ISSN 0015-5497, e-issn 1734-9168 Folia Biologica (Kraków), vol. 64 (2016), No 1 Institute of Systematics and Evolution of Animals, PAS, Kraków, 2016 doi:10.3409/fb64_1.47 The Evolutionary Relationships
More informationKILGORE COLLEGE BIOLOGY DEPARTMENT Biology 2421 Syllabus
COURSE: BIOL 2421 (4-3-4) TITLE: CATALOG DESCRIPTION: Microbiology and Pathology A study of the morphology, physiology, genetics, taxonomy and control of microorganisms. This course includes a study of
More informationPage 1. Name: UNIT: PHOTOSYNTHESIS AND RESPIRATION TOPIC: PHOTOSYNTHESIS
Name: 4667-1 - Page 1 UNIT: PHOTOSYNTHESIS AND RESPIRATION TOPIC: PHOTOSYNTHESIS 1) The diagram below illustrates the movement of materials involved in a process that is vital for the energy needs of organisms.
More informationDO NOT WRITE ON THIS TEST Topic 3- Cells and Transport
Topic 3- Cells and Transport 1. All of the following are true regarding cells except? A) All cells have genetic material B) All cells have cell walls C) All cells have plasma membranes D) All cells can
More informationThe impact of spore aggregation on viable and total counts of Bacillus subtilis
The impact of spore aggregation on viable and total counts of Bacillus subtilis Nikos Mavroudis and Catherine Bowe Food Engineering and Separation of Actives, FoESA, laboratory Department of Applied Sciences,
More informationThe diagram below represents levels of organization within a cell of a multicellular organism.
STATION 1 1. Unlike prokaryotic cells, eukaryotic cells have the capacity to a. assemble into multicellular organisms b. establish symbiotic relationships with other organisms c. obtain energy from the
More informationTopic 1.1 Characteristics of Living Things
Science 8 Unit 1 Worksheet Topic 1.1 Characteristics of Living Things DIRECTIONS: In the textbook, read Unit 1 Topics 1.1, 1.2, and 1.3. Once you are done, answer the questions below. To check your understanding
More informationLecture #9-2/8 Dr. Kopeny
Lecture #9-2/8 Dr. Kopeny Protistans, Part 1 Lecture VIII Protistans Lecture Themes structure and function; recurring evolutionary themes and unifying features the origin of mitochondria and chloroplasts
More informationHEAVY METAL-INDUCED PROTEINS IN CHLAMYDOMONAS REINHARDTII AND THALASSIOSIRA WEISSFLOGII CELLS
Proceedings of the 14 th International Conference on Environmental Science and Technology Rhodes, Greece, 3-5 September 2015 HEAVY METAL-INDUCED PROTEINS IN CHLAMYDOMONAS REINHARDTII AND THALASSIOSIRA
More informationTopic 17 Introduction to Domain Eukarya - Organisms with nucleated cells
Topic 17 Introduction to Domain Eukarya - Organisms with nucleated cells Domain Eukarya. Eukaryotes have nucleated cells. Endosymbiosis has played an important role in the evolution of the group. Both
More informationORIGIN OF CELLULARITY AND CELLULAR DIVERSITY
ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY Geological stratigraphy, together with radioactive dating, show the sequence of events in the history of the Earth. Note the entry for cyanobacteria and stromatolites
More informationExam 1-6 Review Homework Answer the following in complete sentences.
Exam 1-6 Review Homework Answer the following in complete sentences. 1. Explain the relationship between enzymes and activation energy. (Clue: How are enzymes and activation energy related?) http://raeonscience.weebly.com/enzymes.html
More informationProtists & Fungi. Words to Know: Chapters 19 & 20. Label the paramecium diagram above. (pg. 548)
Words to Know: Protozoan Chapters 19 & 20 Protists & Fungi Microsporidium Contractile vacuole Pseudopod Bioluminescent Colony Plasmodium Chitin Hypha Septum Spore Sporangium Rhizoid Lichen Mycorrhiza Label
More informationRayBio CaspGLOW TM Fluorescein Active Caspase-3 Staining Kit
RayBio CaspGLOW TM Fluorescein Active Caspase-3 Staining Kit User Manual Version 1.0 May 10 th, 2015 RayBio Caspase-3 Fluorometric Assay Kit Protocol (Cat#: 68FLS-Casp3-S) RayBiotech, Inc. We Provide You
More informationEukarya. Eukarya includes all organisms with eukaryotic cells Examples: plants animals fungi algae single-celled animal-like protozoa
Eukarya Eukarya includes all organisms with eukaryotic cells Examples: plants animals fungi algae single-celled animal-like protozoa Protists Eukaryotic; but comprises its own Kingdom Protista Algae -
More informationPlant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus.
4.1 Cell biology Cells are the basic unit of all forms of life. In this section we explore how structural differences between types of cells enables them to perform specific functions within the organism.
More informationLesson Overview 4.2 Niches and Community Interactions
THINK ABOUT IT If you ask someone where an organism lives, that person might answer on a coral reef or in the desert. Lesson Overview 4.2 Niches and Community Interactions These answers give the environment
More information(DMB 01) M.Sc. (Previous) DEGREE EXAMINATION, DECEMBER First Year. Microbiology. Paper I INTRODUCTION TO MICROORGANISMS
wk 7 (DMB 01) Paper I INTRODUCTION TO MICROORGANISMS PART A (5 8 = 40 marks) 1. Explain the growth of microbiology in the twentieth century. 2. Describe the structure of eukaryotic cell with a neat-labeled
More informationDiversity of Life Unit Map Grade 7
Diversity of Life Unit Map Grade 7 Course Goal and Description: Diversity of Life emphasizes the use of knowledge and evidence for students to construct explanations for the structures and functions of
More informationSymbiotic Fungal Endophytes that Confer Tolerance for Plant Growth in Saline and Dry Soils Zakia Boubakir, Elizabeth Cronin, Susan Kaminskyj
Symbiotic Fungal Endophytes that Confer Tolerance for Plant Growth in Saline and Dry Soils Zakia Boubakir, Elizabeth Cronin, Susan Kaminskyj Department of Biology University of Saskatchewan 1 Outline Background
More informationPlants Week 3 Booklet
Plants Week 3 Booklet Living vs. Non-Living Foss Investigation #2 The Microscope Part 3: Microscopic Life: Brine Shrimp Foss Investigation #3 The Cell Part 1: Discovering Cells-Elodea Protists, Fungi &
More informationChromatic adaptation and photoreversal in blue-green alga Calothrix clavata West
J. Biosci., Vol. 2, Number 1, March 1980, pp. 63-68. Printed in India. Chromatic adaptation and photoreversal in blue-green alga Calothrix clavata West A. S. AHLUWALIA, R. K. RAI and H. D. KUMAR Department
More informationHYDROGEN. technique. uptake/co2 uptake, which according to equation (1) should equal 4, has
184 BA CTERIOLOG Y: H. A. BARKER PROC. N. A. S. STUDIES ON THE METHANE FERMENTATION. VI. THE IN- FLUENCE OF CARBON DIOXIDE CONCENTRATION ON THE RATE OF CARBON DIOXIDE REDUCTION BY MOLECULAR HYDROGEN By
More informationCaspase 3 (active) Red Staining Kit
ab65617 Caspase 3 (active) Red Staining Kit Instructions for Use For the rapid, sensitive and accurate detection of activated Caspase 3 in living cells. This product is for research use only and is not
More informationStudies on Basidiospore Development in Schizophyllum commune
Journal of General Microbiology (1976), 96,49-41 3 Printed in Great Britain 49 Studies on Basidiospore Development in Schizophyllum commune By SUSAN K. BROMBERG" AND MARVIN N. SCHWALB Department of Microbiology,
More informationLesson Overview. Niches and Community Interactions. Lesson Overview. 4.2 Niches and Community Interactions
Lesson Overview 4.2 Niches and Community Interactions The Niche What is a niche? A niche is the range of physical and biological conditions in which a species lives and the way the species obtains what
More informationCELLS. Single Celled Organisms. The Building Blocks of Life. Junior Science
CELLS Single Celled Organisms The Building Blocks of Life Junior Science Lesson Objectives Know what is meant by unicellular and multicellular organisms. List the six kingdoms of life. Explain the difference
More informationTHE CELL THEORY (R+R+R+E+G+N+T+S) 3).
CELL BIOLOGY All living things are made up of small individual units called cells. Cells are the smallest functioning living unit. Cells can not normally be seen with the naked eye. To usually observe
More informationCyFlow Ploidy Analyser High-resolution DNA analysis
CyFlow Ploidy Analyser High-resolution DNA analysis For agroscience breeding aquaculture www.sysmex-partec.com A dedicated solution for ploidy analysis and genome size determination Determining ploidy
More informationLiving Things are made of Cells
1 Diversity of Living Things 2 Living Things are made of Cells Living things are called organisms. Organisms are made up of one or more cells. (unicellular or multicellular) A cell is the basic unit of
More information6 th Grade Life Science Strand 3: Characteristics and Interactions of Living Organisms
Middle School Life Science Standards There are 15 standards that encompass the proposed middle school life science standards. The new standards are listed 4 times to match the four times life science is
More informationAll living things are made of cells
All about CELLS! 12F recognize that according to cell theory all organisms are composed of cells and cells carry on similar functions such as extracting energy from food to sustain life 12C recognize levels
More informationEukaryotic Cells. Figure 1: A mitochondrion
Eukaryotic Cells Figure 1: A mitochondrion How do cells accomplish all their functions in such a tiny, crowded package? Eukaryotic cells those that make up cattails and apple trees, mushrooms and dust
More informationACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC
SUPPLEMENTAL TABLE S1. Promoter and riboswitch sequences used in this study. Predicted transcriptional start sites are bolded and underlined. Riboswitch sequences were obtained from Topp et al., Appl Environ
More informationMORPHOLOGY STUDY EXTERNAL PLANT STRUCTURE
MORPHOLOGY STUDY EXTERNAL PLANT STRUCTURE TERMINAL BUD ^ P LATERAL BUD TERMINAL BUD SCALE SCAR ANGIOSPERM TWIG MORPHOLOGY TERMINAL BUD SCALE SCAR BUD SCAR TERMINAL BUD SCALE SCAR BUNDLE SCARS PHYLOGENY
More informationTopic 2.1 Cell Theory
Topic 2.1 Cell Theory Assessment Statements What you need to know: 2.1.1 Outline the cell theory. 2.1.2 Discuss evidence for the cell theory. 2.1.3 State that unicellular organisms carry out all the functions
More informationWhich row in the chart below identifies the lettered substances in this process?
1. A biological process that occurs in both plants and animals is shown below. Which row in the chart below identifies the lettered substances in this process? A) 1 B) 2 C) 3 D) 4 2. All life depends on
More informationWarm Up. What are some examples of living things? Describe the characteristics of living things
Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure
More information2 x 10-4 M Reaction buffer Distilled Chloroplast Tube # DCPIP (ml) ph 7.0 (ml) water (ml) preparation ( l) 1. Experimental
1 Sample exam questions: Dean Unit, Biology 2290F/G (Answers start on page 6) Question 1: Chlorella is a unicellular alga that grows well in liquid culture media. Using a haemacytometer, the cell density
More informationUnit 1 ~ Scientific Reasoning & Logic
Unit 1 ~ Scientific Reasoning & Logic A) An Introduction to Biology What is the study of Biology? Every thing can be classified into one of 3 groups... o _ o _ o _ Why do people study it?... Or better
More informationPredict the effect of increased competition for abiotic and biotic resources on a food web. colored pencils graph paper ruler
Edit File QUICK LAB Effect of Abiotic and Biotic Factors No organism exists in isolation. Organisms depend on and compete for the abiotic, or non-living, factors in its environment. For example, organisms
More informationChapter Niches and Community Interactions
Chapter 4 4.2 Niches and Community Interactions Key Questions: 1) What is a niche? 2) How does competition shape communities? 3) How do predation and herbivory shape communites? 4) What are three primary
More informationCyFlow Ploidy Analyser & CyFlow Space High-resolution DNA analysis
CyFlow Ploidy Analyser & High-resolution DNA analysis For agroscience breeding aquaculture CyFlow Ploidy Analyser www.sysmex-flowcytometry.com Dedicated solutions for ploidy analysis and determining genome
More informationMovement of Molecules Biology Concepts of Biology 3.1
Movement of Molecules Biology 100 - Concepts of Biology 3.1 Name Instructor Lab Section Objectives: To gain an understanding of: The basic principles of osmosis and diffusion Brownian motion The effects
More informationUNIVERSITY COLLEGE OF THE FRASER VALLEY COURSE INFORMATION. DISCIPLINE/DEPARTMENT: Biology IMPLEMENTATION DATE: May 1994
UNIVERSITY COLLEGE OF THE FRASER VALLEY COURSE INFORMATION DISCIPLINE/DEPARTMENT: Biology IMPLEMENTATION DATE: May 1994 Revised: Introductory Biology II 4 SUBJECT/NUMBER OF COURSE DESCRIPTIVE TITLE UCFV
More informationBIO 114 Spring Protozoan Population Ecology and Interactions
Protozoan Population Ecology and Interactions Laboratory Learning Outcomes Conceptual 1. Describe the effect of birth rate and death rate on population growth. 2. Apply the concepts in BMEs 24.1, 24.2
More informationA comparison of the Mitotic Index of Zooxanthellae in two species of Anthopleura
Bailey et al. 1 A comparison of the Mitotic Index of Zooxanthellae in two species of Anthopleura By Brooke Bailey, Maja Barlo, Susan Bonar, Jordan Bonnet, Riley Charlebois, Phillida Drummond, Carissa Graydon,
More informationConstruction of nanoantennas on the outer bacterial membrane
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Construction of nanoantennas on the outer bacterial membrane
More informationBio 134. Ch. 19 Protists
Bio 134 Ch. 19 Protists Main Idea! Protists form a diverse group of organisms that are subdivided based on their method of obtaining nutrients What do all protists have in common?! They are all eukaryotes
More informationACETYLENE REDUCTION BY BLUE-GREEN ALGAE IN SUB TROPICAL GRASSLAND
New Phytol. (1977)78,421-426. ACETYLENE REDUCTION BY BLUE-GREEN ALGAE IN SUB TROPICAL GRASSLAND BY KEITH JONES Department of Botany, University of Pretoria, Pretoria 2, South Afriea and Department of Biological
More informationREVIEW 2: CELLS & CELL COMMUNICATION. A. Top 10 If you learned anything from this unit, you should have learned:
Name AP Biology REVIEW 2: CELLS & CELL COMMUNICATION A. Top 10 If you learned anything from this unit, you should have learned: 1. Prokaryotes vs. eukaryotes No internal membranes vs. membrane-bound organelles
More informationNucView TM 488 Caspase-3 Assay Kit for Live Cells
NucView TM 488 Caspase-3 Assay Kit for Live Cells Catalog Number: 30029 (100-500 assays) Contact Information Address: Biotium, Inc. 3423 Investment Blvd. Suite 8 Hayward, CA 94545 USA Telephone: (510)
More information6 Kingdoms of Life. What is life? How are all living things organized?
6 Kingdoms of Life What is life? How are all living things organized? Engage List reasons to support why this man is living. List reasons to support why this car is not living. Characteristics of Life
More informationUnit 8: Prokaryotes, Protists, & Fungi Guided Reading Questions (60 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Chapter 27 Bacteria and Archaea Unit 8: Prokaryotes, Protists, & Fungi
More informationWhat are Cells? How is this bacterium similar to a human? organism: a living thing. The cell is the basic unit of life.
Have you ever wondered how people are similar to bacteria? It may seem like a silly question. After all, humans and bacteria are very different in size and complexity. Yet scientists have learned that
More informationBEHAVIOURAL RESPONSES TO LIGHT IN PARAMECIUM BURSARIA IN RELATION TO ITS SYMBIOTIC GREEN ALGA CHLORELLA
J. exp. Biol. 134, 43-60 (1988) 43 Printed in Great Britain The Company of Biologists Limited 198S BEHAVIOURAL RESPONSES TO LIGHT IN PARAMECIUM BURSARIA IN RELATION TO ITS SYMBIOTIC GREEN ALGA CHLORELLA
More informationMicroscopy and the Diversity of Microorganisms
Microscopy and the Diversity of Microorganisms Today we will learn how to use one of the most important tools a biologist has, the microscope. We will use the microscope to study organisms throughout the
More informationIntroduction to Biology Web Course Informational and Test Schedule
Introduction to Biology Web Course Informational and Test Schedule Spring 2011 Inquiry into Life by Sylvia Mader Introduction to Biological Science (BIO1100AAW1 & 2) Three Hours Credit Nancy Petersen Brian
More informationThe Microbial World. Chapter 5
The Microbial World Chapter 5 Viruses Non-cellular infectious agents that have two basic characteristics: Not capable of reproduction without a host cell Structure: Nucleic acid core- can be DNA or RNA
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationUnit 2: Cellular Chemistry, Structure, and Physiology Module 4: Cellular Physiology
Unit 2: Cellular Chemistry, Structure, and Physiology Module 4: Cellular Physiology NC Essential Standard: 1.2.1 Explain how homeostasis is maintained in a cell and within an organism in various environments
More informationPlant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus.
4.1 Cell biology Cells are the basic unit of all forms of life. In this section we explore how structural differences between types of cells enables them to perform specific functions within the organism.
More informationNBRP ID: Strain: Syngen and mating type: Collected location and date: Chain of custody: Biosafety level: Product format: Other characters:
Paramecium sp. NBRP ID: PS000001A Strain: Y-2 Syngen and mating type: unknown Collected location and date: unknown Chain of custody: NBRP M. Fujishima unknown species name being analyzed. Autogamy fertility
More informationCell Size. What determines the size of a cell? 1. Are the cells shown in Model 1 plant or animal cells? Explain your answer.
Why? Cell Size What determines the size of a cell? Sometimes bigger is better tall basketball players, more closet space, and savings accounts may come to mind. What about cells? Does having big cells
More informationELECTRONIC SUPPLEMENTARY INFORMATION (ESI) variable light emission created via direct ultrasonic exfoliation of
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 ELECTRONIC SUPPLEMENTARY INFORMATION (ESI) High quantum-yield luminescent MoS 2 quantum dots
More informationFigure 2 If birds eat insects that feed on corn, which pyramid level in the diagram would birds occupy? 1. A 3. C 2. B 4. D
Ecology Week 1 Assignment. This week's assignment will count as a quiz grade. Please speak to Mr. Roes about any questions that you would like help on! 1. The fact that no organism exists as an entity
More informationExperiences with the Coulter Counter in Bacteriology1
Experiences with the Coulter Counter in Bacteriology1 ELLEN M. SWANTON, WILLIAM A. CTJRBY, AND HOWARD E. LIND Sias Laboratories, Brooks Hospital, Brookline, Massachusetts Received for publication May 24,
More information5A Order Among Cells. 5B Cellular Respiration
Life Science Chapter 5 Activities of Cells 5A Order Among Cells unicellular the cells survive by themselves (example paramecium) Multicellular organisms divide the functions they need to perform among
More informationThe study of life. All organisms share certain properties. All organisms do these things at some point during their life.
Biochemistry The study of life All organisms share certain properties. Cellular organization Homeostasis Metabolism Responsiveness Reproduction Heredity Growth All organisms do these things at some point
More informationMICROSCOPY AND CELLS BIO 171 WEEK 3
MICROSCOPY AND CELLS BIO 171 WEEK 3 MICROSCOPY THE COMPOUND LIGHT MICROSCOPE System of lenses arranged to produce an enlarged, focusable image of a specimen. MICROSCOPY THE MICROSCOPE Illuminating System
More informationClass IX: Biology Chapter 5: The fundamental unit of life. Chapter Notes. 1) In 1665, Robert Hooke first discovered and named the cells.
Class IX: Biology Chapter 5: The fundamental unit of life. Key learnings: Chapter Notes 1) In 1665, Robert Hooke first discovered and named the cells. 2) Cell is the structural and functional unit of all
More informationFeeding Behaviour of Didinium nasutum on Paramecium bursaria with Normal or Apochlorotic Zoochlorellae
Journaf of General Microbiology (1980), 118, 397-404. Printed in Great Britain 397 Feeding Behaviour of Didinium nasutum on Paramecium bursaria with Normal or Apochlorotic Zoochlorellae By JACQUES BERGER
More informationRange of Competencies
BIOLOGY Content Domain Range of Competencies l. Nature of Science 0001 0003 20% ll. Biochemistry and Cell Biology 0004 0005 13% lll. Genetics and Evolution 0006 0009 27% lv. Biological Unity and Diversity
More information