Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics

Size: px
Start display at page:

Download "Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics"

Transcription

1 Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety... Laboratory of Microbiology Pragmatic towards diagnostics A classification that is of little use to microbiologists no matter how fine a scheme or who devised it, will soon be ignored or significantly modified The ultimate goal in taxonomy An objective delineation of species based upon the natural relationships of organisms, i.e. based upon evolutionary evidence E. Stackebrandt Classification of strains into recognizable functional units never static as new info is constantly being generated current practice DDH Polyphasic description of species observation 2 observation 3 observation 1 16S rrna gene sequencing initial grouping using a polyphasic approach 1

2 mic taxono d n quicksa Landscaping the microbial diversity How many bacteria Which bacteria Seazonal influence Location dependency om Taxon P. Dawyndt y Within a timespan of weeks, not years Future is easier to invent than to predict Whole genome sequencing is the future Future needs Fast (large biodiversity to explore) Although whole genome sequences are the blueprint of the organism and clearly contains detailed taxonomic information on the strain, it is not realistic to think that we will have whole genome sequences for all new strains in the near future. Portable ( online taxonomy ) For now, 16S rrna gene sequencing is the standard in environmental studies and a more pragmatic alternative could be provided by a multi locus sequencing approach, providing: Resolution (1) An increase in phylogenetic signal/accuracy Robust (study populations) Functional (2) Multiple genes provide a buffer against the distorting phylogenetic signals at a single locus, such as effects of recombination, gene conversion, and horizontal gene transfer What is MLSA? Sequencing of multiple protein-coding genes (loci) and subsequent phylogenetic analysis of the(se) (concatenated) sequence alignment(s) to characterize the genetic relationships among the strains analyzed. MLST is for genotypic characterization of prokaryotes at the infraspecific level using only the allelic mismatches of usually 7 housekeeping genes (typing, epidemiology). In order to be applicable for more diverse groups of strains, the use of simple clustering procedures based on the number of allelic mismatches is invalidated. 2

3 current future practice genotype vs. phenotype DDH 16S multilocus rrna gene sequencing...classification must be a reflection of the natural relationships of bacteria, i. e. their degree of DNA similarity... Wayne et al., 1987 In the end we want biological meaningful groups, i.e. groups that reflect phenotype and the evolutionary process that have been shaping their genotype initial grouping using a polyphasic approach A 3-step process (1) 16S rrna sequencing to assign an unknown strain to a group (genus or family). (2) This defines which genes and primers are to be used for MLSA to assign the strain to a species (3) Polyphasic approach for a valid description of species How does a few genes correlate with the whole-genome-based relatedness? Konstantinidis, unpublished Konstantinidis et al., AEM (in press) 3

4 Which genes to sequence? Bacterial core genes (universal, house keeping) Which genes to select? Not duplicated Sufficient length Congruent with the overall genome phylogeny With universally conserved regions for primers Unlinked in the genome (e.g. to avoid hitch-hiking of (Zeigler, 2003) DNA exchange (Santos and Ochman, 2004) selection and recombination events) Which genes to sequence? Group specific approach Not duplicated Sufficient length Congruent with the overall genome phylogeny With universally conserved regions for primers Unlinked in the genome (e.g. to avoid hitch-hiking of Combining gene sequences? How to combine data from a different taxonomic range? 0 true biological distance (Zeigler, 2003) (Santos and Ochman, 2004) DNA exchange clonal level species level genus level... selection and recombination events) gene 1 gene 2 16S rrna intra- vs interspecies diversity interspp. intrasp. 0 4

5 intra- vs interspecies diversity interspp. intrasp. 0 MLSA is attractive... Objective method for classification Allows a more natural species definition Fast (large biodiversity to explore) Portable ( online taxonomy ) Increased resolution = solution to the burden of routine species identification MLSA has its uncertainties and flaws... Link between species and level of similarity? (lack of theory-based concept) A single definition possible for groups in which different biological processes have caused speciation (Neisseria vs. Mycobacterium) Link with the phenotype will always be important MLSA has its uncertainties and flaws... MLSA has its uncertainties and flaws... Link between species and level of similarity? (lack of theory-based concept) A single definition possible for groups in which different biological processes have caused speciation (Neisseria vs. Mycobacterium) Link with the phenotype will always be important It ignores the variable part, potentially the genetic basis of ecological differentiation On a larger scale it might not be possible to delineate groups as a result of a continuous spectrum of genotypic variation How to apply to uncultured material? 5

6 an MLSA platform! Acces to all sequences and analysis tools Suggest genes and enforce the use of the same genes in order to obtain an unprecedented scale enlargement (necessary to evaluate robustness, study concept,...) Incorporate organisms biology (ecological data, source, phenotype,...) connectivity Landscaping the bacterial diversity understanding relationships experimental data understanding patterns classification methods understanding principles Reflection - 1 Reflection - 2 Should we calibrate each new method to yield the clusters previously determined by phenotypic criteria? - How to tackle the lack of theory-based concept? Should the complete genome be used as the reference standard? DDH is a measure for genomic relatedness, but is it a measure for evolutionary relationship... and thus... is there a core that represents organismal phylogeny... is there a true phylogeny possible Kunin GR 2005 Not all genes in the genome tell the same phylogenetic history How to determine true organismal phylogeny? DNA exchange 6

7 - Laboratory of Microbiology - Reflection - 3 What with our nomenclature - named species are not meaningful from an evolutionary standpoint Em. Prof. Dr. ir. Jean Swings Prof. Dr. Peter Vandamme Prof. Dr. Paul De Vos Prof. Dr. Anne Willems Dr. Peter Dawyndt Dr. Marc Vancanneyt Dr. Sabri Naser 7

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; fast- clock molecules for fine-structure. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Microbial Taxonomy and Phylogeny: Extending from rrnas to Genomes

Microbial Taxonomy and Phylogeny: Extending from rrnas to Genomes Microbial Taxonomy and Phylogeny: Extending from rrnas to Genomes Dr. Kostas Konstantinidis Department of Civil and Environmental Engineering & Department of Biology (Adjunct), Center for Bioinformatics

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Introduction to polyphasic taxonomy

Introduction to polyphasic taxonomy Introduction to polyphasic taxonomy Peter Vandamme EUROBILOFILMS - Third European Congress on Microbial Biofilms Ghent, Belgium, 9-12 September 2013 http://www.lm.ugent.be/ Content The observation of diversity:

More information

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Chapter 26 Phylogeny and the Tree of Life

Chapter 26 Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin

More information

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek

More information

Microbiology Helmut Pospiech

Microbiology Helmut Pospiech Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition

More information

Concepts of bacterial biodiversity for the age of genomics

Concepts of bacterial biodiversity for the age of genomics Wesleyan University WesScholar Division III Faculty Publications Natural Sciences and Mathematics January 2004 Concepts of bacterial biodiversity for the age of genomics Frederick M. Cohan Wesleyan University,

More information

Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer

Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

What are bacterial species?

What are bacterial species? Wesleyan University WesScholar Division III Faculty Publications Natural Sciences and Mathematics January 2002 What are bacterial species? Frederick M. Cohan Wesleyan University, fcohan@wesleyan.edu Follow

More information

4/4/2017. Extrinsic Isolating Barriers. 1. Biological species concept: 2. Phylogenetic species concept:

4/4/2017. Extrinsic Isolating Barriers. 1. Biological species concept: 2. Phylogenetic species concept: Chapter 13 The origin of species 13.1 What Is a Species? p. 414 Ways to identify species 1. Biological species concept: 1. There are many different concepts of species 2. Species are important taxonomic

More information

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics. Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary

More information

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus

More information

Processes of Evolution

Processes of Evolution 15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection

More information

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic

More information

Microbial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy 1. Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eucaryote, is in a mess we are stuck with it for traditional

More information

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics: Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

A. Incorrect! In the binomial naming convention the Kingdom is not part of the name.

A. Incorrect! In the binomial naming convention the Kingdom is not part of the name. Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific

More information

ADVANCED PLACEMENT BIOLOGY

ADVANCED PLACEMENT BIOLOGY ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week

More information

11/5/2018. Update on Modern Bacterial Taxonomy for Bench Microbiologists. Why is Taxonomy Important? Bacterial Taxonomy for Clinical Microbiologists

11/5/2018. Update on Modern Bacterial Taxonomy for Bench Microbiologists. Why is Taxonomy Important? Bacterial Taxonomy for Clinical Microbiologists Update on Modern Bacterial Taxonomy for Bench Microbiologists J. Michael Janda Kern County Public Health Laboratory Bakersfield CA The Name Game Which Ones Different? Why is Taxonomy Important? Bacterial

More information

Outline. Classification of Living Things

Outline. Classification of Living Things Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics

More information

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes

More information

SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together

SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups

More information

Introduction to the SNP/ND concept - Phylogeny on WGS data

Introduction to the SNP/ND concept - Phylogeny on WGS data Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny

More information

Taxonomy and Biodiversity

Taxonomy and Biodiversity Chapter 25/26 Taxonomy and Biodiversity Evolutionary biology The major goal of evolutionary biology is to reconstruct the history of life on earth Process: a- natural selection b- mechanisms that change

More information

PHYLOGENY AND SYSTEMATICS

PHYLOGENY AND SYSTEMATICS AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study

More information

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,

More information

Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder

Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder nrpace@colorado.edu Outline What is the Tree of Life? -- Historical Conceptually

More information

Evolutionary Genetics: Part 0.2 Introduction to Population genetics

Evolutionary Genetics: Part 0.2 Introduction to Population genetics Evolutionary Genetics: Part 0.2 Introduction to Population genetics S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Population genetics Evolution = changes

More information

Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse

Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse Tutorial Outline Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse exams. Biology Tutorials offer targeted instruction,

More information

8. Population genetics of prokaryotes

8. Population genetics of prokaryotes 8. Population genetics of prokaryotes Henrik Christensen, Department of Veterinary Disease Biology Faculty of Health Sciences, Copenhagen University hech@life.ku.dk 21-1-13 8.1. Prokaryotic populations.

More information

OCR (A) Biology A-level

OCR (A) Biology A-level OCR (A) Biology A-level Topic 4.2: Biodiversity Notes Biodiversity is the variety of living organisms, over time the variety of life on Earth has become more extensive but now it is being threatened by

More information

Evolution Problem Drill 09: The Tree of Life

Evolution Problem Drill 09: The Tree of Life Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate

More information

Quantitative Genetics & Evolutionary Genetics

Quantitative Genetics & Evolutionary Genetics Quantitative Genetics & Evolutionary Genetics (CHAPTER 24 & 26- Brooker Text) May 14, 2007 BIO 184 Dr. Tom Peavy Quantitative genetics (the study of traits that can be described numerically) is important

More information

Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology. Evolutionary Biology

Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology. Evolutionary Biology Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology rigorous models of molecules... in organisms Modeling Evolutionary Biology rigorous models

More information

Chapter 19: Taxonomy, Systematics, and Phylogeny

Chapter 19: Taxonomy, Systematics, and Phylogeny Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand

More information

The practice of naming and classifying organisms is called taxonomy.

The practice of naming and classifying organisms is called taxonomy. Chapter 18 Key Idea: Biologists use taxonomic systems to organize their knowledge of organisms. These systems attempt to provide consistent ways to name and categorize organisms. The practice of naming

More information

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: https://digitalcontentmarket.org/download/test-bank-formicrobiology-a-systems-approach-3rd-edition-by-cowan Chapter

More information

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH INTRODUCTION The aim of this document is to explain the role of biodiversity research in the delivery of the BBSRC mission, and thereby to provide guidance to

More information

Unit 7: Evolution Guided Reading Questions (80 pts total)

Unit 7: Evolution Guided Reading Questions (80 pts total) AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Unit 7: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent

More information

Taming the Beast Workshop

Taming the Beast Workshop Workshop and Chi Zhang June 28, 2016 1 / 19 Species tree Species tree the phylogeny representing the relationships among a group of species Figure adapted from [Rogers and Gibbs, 2014] Gene tree the phylogeny

More information

Ledyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005

Ledyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005 Ledyard Public Schools Science Curriculum Biology Level-2 1422 Instructional Council Approval June 1, 2005 Suggested Time: Approximately 9 weeks Essential Question Cells & Cell Processes 1. What compounds

More information

Modern Evolutionary Classification. Section 18-2 pgs

Modern Evolutionary Classification. Section 18-2 pgs Modern Evolutionary Classification Section 18-2 pgs 451-455 Modern Evolutionary Classification In a sense, organisms determine who belongs to their species by choosing with whom they will mate. Taxonomic

More information

Alternative tools for phylogeny. Identification of unique core sequences

Alternative tools for phylogeny. Identification of unique core sequences Alternative tools for phylogeny Identification of unique core sequences Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Learning objective: After this lecture you should be able to account

More information

Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species.

Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species. AP Biology Chapter Packet 7- Evolution Name Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species. 2. Define the following terms: a. Natural

More information

Unit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities.

Unit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities. KEY CONCEPT Organisms can be classified based on physical similarities. Linnaeus developed the scientific naming system still used today. Taxonomy is the science of naming and classifying organisms. White

More information

belonging to the Genus Pantoea

belonging to the Genus Pantoea Emerging diseases of maize and onion caused by bacteria belonging to the Genus Pantoea by Teresa Goszczynska Submitted in partial fulfilment of the requirements for the degree Philosophiae Doctoriae in

More information

Why Philosophy of Microbiology?

Why Philosophy of Microbiology? Why Philosophy of Microbiology? 1 Philosophy of science Philosophy of biology Philosophy of microbiology What is any philosophy of science? Not just ethics, nor even mostly ethics Not wild speculation

More information

West Windsor-Plainsboro Regional School District AP Biology Grades 11-12

West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels

More information

Comparing Prokaryotic and Eukaryotic Cells

Comparing Prokaryotic and Eukaryotic Cells A prokaryotic cell Basic unit of living organisms is the cell; the smallest unit capable of life. Features found in all cells: Ribosomes Cell Membrane Genetic Material Cytoplasm ATP Energy External Stimuli

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Rapid Learning Center Chemistry :: Biology :: Physics :: Math

Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/37 *AP is a registered trademark of the College Board, which does not

More information

doi: / _25

doi: / _25 Boc, A., P. Legendre and V. Makarenkov. 2013. An efficient algorithm for the detection and classification of horizontal gene transfer events and identification of mosaic genes. Pp. 253-260 in: B. Lausen,

More information

1 Errors in mitosis and meiosis can result in chromosomal abnormalities.

1 Errors in mitosis and meiosis can result in chromosomal abnormalities. Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal

More information

Unit Two: Biodiversity. Chapter 4

Unit Two: Biodiversity. Chapter 4 Unit Two: Biodiversity Chapter 4 A. Classifying Living Things (Ch.4 - page 100) Scientific knowledge is constantly evolving ( changing ): new evidence is discovered laws and theories are tested and possibly

More information

Which species concept for bacteria? An E- debate

Which species concept for bacteria? An E- debate Wesleyan University From the SelectedWorks of Frederick M. Cohan 2005 Which species concept for bacteria? An E- debate S. Godreuil Frederick M Cohan, Wesleyan University H. Shah M. Tibayrenc Available

More information

A. Incorrect! Form is a characteristic used in the morphological species concept.

A. Incorrect! Form is a characteristic used in the morphological species concept. CLEP Biology - Problem Drill 23: Evolutionary Processes No. 1 of 10 The biological-species concept is based on. (A) Form. (B) Similar size. (C) Similar appearance to all other individuals in the population.

More information

Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms

Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral

More information

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and

More information

Unit 9: Evolution Guided Reading Questions (80 pts total)

Unit 9: Evolution Guided Reading Questions (80 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Unit 9: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent

More information

Phylogeny and the Tree of Life

Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

R.S. Kittrell Biology Wk 10. Date Skill Plan

R.S. Kittrell Biology Wk 10. Date Skill Plan Day of Wee k Date Skill Plan M 11/10/14 Unit 3:DNA, Protein Synthesis, Genetics and Biotechnology ALL Obj. #= 3.2.2 Unit? = # 1,3, 'I will' = # 6,7 Obj = Individual Focus Opening: Discuss Ghost in your

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Week 7.2 Ch 4 Microevolutionary Proceses

Week 7.2 Ch 4 Microevolutionary Proceses Week 7.2 Ch 4 Microevolutionary Proceses 1 Mendelian Traits vs Polygenic Traits Mendelian -discrete -single gene determines effect -rarely influenced by environment Polygenic: -continuous -multiple genes

More information

Biology Scope and Sequence Student Outcomes (Objectives Skills/Verbs)

Biology Scope and Sequence Student Outcomes (Objectives Skills/Verbs) C-4 N.12.A 1-6 N.12.B.1-4 Scientific Literacy/ Nature of (embedded throughout course) Scientific Inquiry is the process by which humans systematically examine the natural world. Scientific inquiry is a

More information

Miller & Levine Biology 2014

Miller & Levine Biology 2014 A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades

More information

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever. CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains

More information

Phylogeny and the Tree of Life

Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Chapter 17. Organizing Life's Diversity

Chapter 17. Organizing Life's Diversity Chapter 17 Organizing Life's Diversity Key Concepts: Chapter 17 1. List the 3 domains and the 6 kingdoms. 2. Our current system of classification was originally based on structures; scientists now base

More information

Microbiome: 16S rrna Sequencing 3/30/2018

Microbiome: 16S rrna Sequencing 3/30/2018 Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics

More information

SPRING GROVE AREA SCHOOL DISTRICT. Course Description. Instructional Strategies, Learning Practices, Activities, and Experiences.

SPRING GROVE AREA SCHOOL DISTRICT. Course Description. Instructional Strategies, Learning Practices, Activities, and Experiences. SPRING GROVE AREA SCHOOL DISTRICT PLANNED COURSE OVERVIEW Course Title: Advanced Placement Biology Grade Level(s): 12 Units of Credit: 1.50 Classification: Elective Length of Course: 30 cycles Periods

More information

9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification

9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification

More information

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012 Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based

More information

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think

More information

Biology 211 (2) Week 1 KEY!

Biology 211 (2) Week 1 KEY! Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Bio 119 Bacterial Genomics 6/26/10

Bio 119 Bacterial Genomics 6/26/10 BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis

More information

Taxonomy and Clustering of SSU rrna Tags. Susan Huse Josephine Bay Paul Center August 5, 2013

Taxonomy and Clustering of SSU rrna Tags. Susan Huse Josephine Bay Paul Center August 5, 2013 Taxonomy and Clustering of SSU rrna Tags Susan Huse Josephine Bay Paul Center August 5, 2013 Primary Methods of Taxonomic Assignment Bayesian Kmer Matching RDP http://rdp.cme.msu.edu Wang, et al (2007)

More information

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms 1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic

More information

Introduction to Biosystematics - Zool 575

Introduction to Biosystematics - Zool 575 Introduction to Biosystematics Lecture 8 - Modern Taxonomy Outline - 1. Tools - digital imaging, databases 2. Dissemination - WWW 3. Tools - Molecular data, species demarcation, phylogeography 1 2 Prognosis

More information

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying

More information

Biology Massachusetts

Biology Massachusetts Tutorial Outline Massachusetts Tutorials are designed specifically for the Learning Standards found in the Massachusetts Curriculum Frameworks to prepare students for the MCAS tests. Biology Tutorials

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure

More information

BIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:

BIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description: Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding

More information

Microbiology and the species problem

Microbiology and the species problem Biol Philos (2010) 25:553 568 DOI 10.1007/s10539-010-9211-9 Microbiology and the species problem Marc Ereshefsky Published online: 4 May 2010 Ó Springer Science+Business Media B.V. 2010 Abstract This paper

More information

What is Phylogenetics

What is Phylogenetics What is Phylogenetics Phylogenetics is the area of research concerned with finding the genetic connections and relationships between species. The basic idea is to compare specific characters (features)

More information