Introduction to Biosystematics - Zool 575

Transcription

1 Introduction to Biosystematics Lecture 8 - Modern Taxonomy Outline - 1. Tools - digital imaging, databases 2. Dissemination - WWW 3. Tools - Molecular data, species demarcation, phylogeography 1 2 Prognosis Some numbers on the decline of alpha taxonomy Acarology : 41, : 9 (Taxacom, 3/01, #192) 71 museums - invertebrate curators 1980:364, 2001: 315 Authors of 6 + plant taxa : 44% deceased or emeritus Ann. Missouri Bot. Gard. 87: , % of curators of Diptera lost since mid-1970 s C. Thompson Taxonomy old fashioned The Problem Tower of Babel : each taxon has its own language (terminology) No single, on-line, depository of species names No accurate compilation of all described species 2,300 new beetle species named per year 3 Taxonomic impediment or Bottleneck 4 The Problem The Problem Loss of traditional skills 5 Types Catalogs of types: Nicrophorus - Location unknown For types of 67 of 236 names. ZMHB: Berlin? Moscow, Leningrad, or Dresden? unknown; not ZMAS? (Gusarov in litt.) HNHM: Budapest? [not found] Moscow, Leningrad, or Dresden? NMPC: Praha? [not found] HNHM: Budapest? [not found] NMPC: Praha? [not found] ZMHB: Berlin? ZMHB: Berlin? ZMUC: Kobenhavn (Kiel?) Hamburg [destroyed?] MNHN: Paris? [not found]; not DEIC: Eberswalde [L. Zerche in litt.] MNHN: Paris? [not found] NMPC: Praha [not found; lost?] [lost?] unknown, not MZHF: Helsinki, lost? [Silfverberg in litt.] 6 1

2 Tools - digital imaging, databases - The toolbox of the alpha taxonomist grows with the advances of technology - Printing press, c.1450 AD - Microscope, c.1590 AD - Photography, color images, audio recordings - Scanning Electron Microscopy character: Heritable trait possessed by an organism e.g. Tail color character state: different conditions of a character e.g. Tail color blue e.g. Tail color red Phenotypic data 7 8 Recall that alpha taxonomy seeks unique character states to diagnose taxa Is this population/species/genus unique? Is it diagnosable? How can one identify this species? What is different about it from all other species? Phylogenetics seeks shared character states to infer relationships among taxa Phenotypic data management - morphology - behavior - pheromones - songs etc. Identification keys, guides - more & more online (e.g. lab web exercise) 9 10 Digitization of phenotypic data - Databases of biogeographic data - export material examined - Morphology: SEM, Auto-montage songs etc. - identification keys - multi-entry keys e.g. Scarab key Tools - digital imaging, databases Important point - Modernization of traditional, alpha taxonomy is being done by taxonomists - many are becoming skilled web & database designers In contrast - Molecular Biology is driven by many fields of research including the commercial sector

3 Most alpha taxonomy is done with morphology - Molecular data - Proteins: Isozyme electrophoresis isozymes = functionally similar forms of enzymes - Chromosomes: Cytogenetics chromosome banding, karyotyping - RFLPs: Restriction Fragment Length Polymorphisms - fragments of various size cut with restriction enzymes 13 When enzyme cuts - site is present When enzyme doesn t cut = a mutation has changed that site No information on the DNA sequence 14 Tools - digital imaging, databases PCR: - Molecular data - PCR: Polymerase Chain Reaction DNA sequence data becoming the standard method to assess genetic characters (aka markers ) - amplifies trace amounts of DNA by multiple cycles of heating (denaturation) and cooling (annealing) - new DNA is built with a heat stable enzyme (TAQ polymerase) 15 - named TAQ after Thermus aquaticus - a heat loving bacterium 16 PCR Requires Primers -short nucleotide sequences that match the template DNA Mitochondrial genome - circular 13 protein coding genes 2 rrna genes 22 trna genes

4 DNA Sequence data e.g. mtdna - COII gene N. americanus ATGATAACATGAAAAACACTTATATCACCAGATAGAGCTTCACCATTAATAGAACAATTAT N. concolor ATGATAACATGAAAAACATTAATGTCTCCTGACAGTGCCTCTCCATTGATAGAACAACTTA 61 base-pairs (nucleotides) - each site is a character 12 differences between these 2 species (19.7%) This is the uncorrected distance between these sequences 19 N. americanus ATGATAACATGAAAAACACTTATATCA N. concolor ATGATAACATGAAAAACATTAATGTCT 61 base-pairs (nucleotides) - each site is a character Each nucleotide is a character state Advantages - some: 1. All living organisms have DNA 2. Sequence is most basic level of biological information 3. We understand much about the processes of sequence evolution 20 Problems - some 1. Sample size issues - costly to obtain large sample sizes Species demarcation using DNA Haplotype: A set of closely linked alleles (genes or DNA polymorphisms) inherited as a unit. A contraction of the phrase "haploid genotype." Different combinations of polymorphisms are known as haplotypes. 2. Lack of information or too much information (+misinformation) [same problem for morphology] 3. Multiple substitutions at one site overwrite prior substitutions 21 Flow chart from Wiens, J. J. & T. A. Penkrot (2002) Delimiting Species Using DNA and Morphological Variation and Discordant Species Limits in Spiny Lizards (Sceloporus). Systematic Biology 51: Wiens & Penkrot 2002 Species demarcation Johnson et al Neglected taxonomy of rare desert fishes: Congruent evidence for two species of Leatherside chub. Systematic Biology 53(6): Identification of species is challenging because 1) differences of opinion on whether species are real 2) differences of opinion on what concept to use - Conservation biologists require reliable, unambiguous classifications - Legal protection of species - Used fish, Leatherside chub, - approached species question as a testable hypothesis 24 4

5 Species demarcation Johnson et al Neglected taxonomy of rare desert fishes: Congruent evidence for two species of Leatherside chub. Systematic Biology 53(6): Currently classified as 1 species, Gila copei - Genetic data suggested there might be 2 species Allopatric - Used data applicable to 3 different species concepts: - Phylogenetic - Phenotypic similarity - Ecological Phylogeography Ecology Examined taxonomic boundaries with 3 species concepts: 1) phylogenetic - reciprocal monophyly & fixed diagnostic character states (mtdna & ndna) 2) Similarity - statistical differences in cranial shape 3) Ecology - local adaptation in growth & foraging rates Conclusion: there are 2 species

6 Changed the classification - often not done in such studies (left for a taxonomist to do ) - Moved the Northern leatherside chub to another genus to make Lepidomeda copei - because the type specimen of copei is from the north - The Southern leatherside chub would need a new name, however, there already exists a junior synonym for the southern population: L aliciae (Jouy, 1881) 31 New tools in the taxonomist s toolbox: For phenotypic, traditional data - digitization - databases - web dissemination For molecular data - phylogeography & species demarcations - DNA sequence data 32 Terms - from lecture & readings You should be able to Taxonomic impediment / bottleneck Phenotypic data Character Character state Molecular data Proteins, Isozymes Cytogenetics Karyotyping RFLPs PCR Primers TAQ polymerase Nucleotides Base-pairs Uncorrected sequence difference haplotype 33 Describe the taxonomic impediment - what are some key problems? What are some solutions? Be able to list different aspects of the new digitized alpha taxonomy, e.g. web databases, on-line multi-access identification keys etc. (& what are some advantages of multi -entry keys) Be able to briefly describe how PCR works Be able to describe pros & cons of DNA data for alpha taxonomy (including DNA bar-coding). Describe what steps you think are best to identify a new species (data types, methods, etc). 34 6