The wonderful world of NUCLEIC ACID NMR!
|
|
- Lawrence Logan Harmon
- 6 years ago
- Views:
Transcription
1 Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically essential pseudoknot in human telomerase RNA Telomere repeat DNA quadruplex with bound and free cations Double-strand RNA binding domain of yeast RNase III in complex with RNA target
2 Why do NMR of nucleic acids? More than a simple double helix!! Unusual DNA structures triplexes quadruplexes bent DNA Drug-DNA complexes Chemically modified DNA, e.g. cis-t (anti-cancer drug) Cation localization rotein-dna complexes plus, the wonderful world of RNA! Ribozymes seudoknots viral RNAs snrnas snornas & scarnas Aptamers Riboswitches mirnas, sirnas Telomerase RNA lncrnas and lincrnas HIV RNA RNA-protein complexes Etc! Nucleic acids different problem than proteins! Only four bases, one sugar Simpler! Lower proton density nucleotide is 3X MW of aa For helices, no long range constraints No through-bond connectivity from nucleotide to nucleotide (except through ) More difficult!
3 1 H NMR of Nucleic Acids: Assignments 1) roton resonances Non-exchangeable DNA Base AH8, GH8 AH2 TH6, CH6 CH5, TMe Deoxyribose 1, 2, 2, 3, 4, 5, 5 RNA same, except UH5, UH6 (like CH5, CH6) ribose, no 2 (2 only) Exchangeable (only seen in H 2 O) iminos amino 2) roton spin systems - D2O only; no coupled labile spin systems (except aminos) CH5-CH6, UH5-UH6 ~7 Hz TMe-TH6 4 bond coupling ~1.5 Hz deoxyribose ribose aromatic 5, 5 HCH O base H3 H2 H4 H1 ~1.5 Hz H2 DNA deoxyribose TMe-TH6 ~1.5 Hz (long range coupling) RNA: UH5-UH6 RNA ribose ~7 Hz Minor groove: sugar, AH2, G amino Major groove: H8, TMe, CH5, A & C aminos Also, 31, proton attached 13 C and 15 N And 13 C- 1 H, 15 N- 1 H, C, and 31-1 H J coupling CH5-CH6 ~7 Hz
4 3) 1D spectra of a DNA dodecamer with N 6 A mod. A. Non-exchangeable 1) intensities Me 3x aromatics 2) chemical shifts -- see regions on spectrum 3) coupling constants -- CH5-CH6 -- all sugar protons are coupled *! ! C G C G A A T T C G C G! G C G C T T A A G C G C! ! *! * = m 6! Exchangeable proton resonances: iminos and aminos *! ! C G C G A A T T C G C G! G C G C T T A A G C G C! ! *! * = m 6! Strange appearance of aromatic region [attenuated intensities] is due to water suppression (sample in 95% H 2 O). resence of imino resonances between ppm indicates stable base pairing, important monitors of folded structure. Each Watson-Crick base pair gives rise to one imino resonance. Terminal iminos may be exchange broadened due to breathing. Imino region is free of protein resonances, good for monitoring complex formation with proteins and drugs.
5 Assignment of spin systems COSY -- can identify all CH5-CH6 TMe-TH6 H1 -H2, H2, etc. Theoretically, can isolate each deoxyribose spin system but 5, 5 usually difficult or impossible due to overlap with 4 TOCSY -- connects whole spin system, so can resolve more xpeaks, e.g. 2, 2-5, 5 ; 1-3 aromatic H1, CH5 1 [d( C 2 G 3 C 4 G 5 A 6! *A 7 T 8 T 9 C ! G C G )]2!
6 *! ! C G C G A A T T C G C G! G C G C T T A A G C G C! ! *! * = m 6! H1 H1, CH5 2, 2 Me aromatic 1) Base-sugar interactions Sequential Assignment of A- or B-DNA Helices! rimarily relies on NOESY spectra (next page) (vs NOESY and COSY for 1 H sequential assign. of proteins) [For DNA, most of COSY information is also in NOESY since coupled protons generally also show NOEs] The H6 (pyr) & H8 (pur) protons are close (within 4Å) to 1, 2, 2 protons on own base (intranucleotide NOE) and to 1, 2, 2, protons on 5 neighboring base (internucleotide NOE)! 3 5 base H1, 2, 2 base H1, 2, 2 base H1, 2, 2 Intensities of xpeaks will depend on sugar conformation B-DNA with anti glycosidic conformation closest to intra 2 inter 2 next page but also directly (and indirectly) to others. Can assign DNA sequentially by xpeaks from base to sugar to base... NOEs expected base - H1 base - H2, H2 2 each H1 - H2, H2 like COSY xpeaks
7 Sequential assignments of DNA (& RNA) A T A Sequential assignments of DNA (& RNA) A T A
8 H1 C 1 H6, H8 AH2 AH2 T7 C 1 C3 C11 T8 C9 G2, G12 G10 G4 A6 A5 *Note: This is two peaks. Can also do same thing via base - H2, H2 (as in schematic) but now have 4 xpeaks base more complicated. Useful to double-check assignments (and exclude AH2s). Assigned H1 can be connected to rest of sugar spin system via COSY, TOCSY, and/or NOESY. Have now assigned all H8, H6, H5, TMe, and sugar resonances (except 5, 5 usually). Note: NOEs to H1 usually only show up clearly at long τ m and are partially spin diffusion, so after assignments are made may want to use shorter τ m for structure determination. 2) The AH2 protons are usually far from any other protons and have few or no NOEs in D 2 O. Often (usu. weak) NOEs to H1 or AH2-AH2: these give information on local structure (minor groove width, propellering). Assignment to specific base is done via NOE from iminos in H 2 O. Also, 1 H- 13 C HSQC
9 3) Base-base interactions Most interactions in DNA are along strand, very few cross strand NOEs - pyr (CH5, TMe) - pur (H8) and pyr (H6) Directional - goes 3 5 only in N 6 MeA Dickerson dodecamer ! C G C G A A T T C G C G! 5 See NOESY spectrum strong weaker T 8 Me-T 7 Me T 8 Me-T 7 H6 C 3 H5 -G 2 H8 T 7 Me-A 6 H8 C 11 H5-G 10 H8 C 9 H5 -T 8 H6 in base-h1 region Note that if both strands were not symmetrical, would have to assign along each strand. *! ! C G C G A A T T C G C G! G C G C T T A A G C G C! ! *! * = m 6! T7 T8 H1 H1, CH5 2, 2 Me aromatic fingerprint
10 DNA conformation 1) a) Appearance of sequential base-sugar NOEs and base-base interactions indicates a right handed strand conformation. b) Strong base-h2, H2 and weaker base-h1 NOEs indicates anti conformation of bases. c) Intensity of base-base and base-sugar NOEs indicative of local conformation s.a. base tilt, twist, sugar pucker, groove width, etc. 2) Since there are few xstrand NOEs, double strand relies on: a) appearance of H-bonded imino resonances in H 2 O b) melting studies c) direct detection of H-bonds via scalar coupling (requires labeled sample) ~ -88 Hz ~2.5 Hz 15N H 15 N ~6-10 Hz DNA conformation 3) Sugar conformation a) Measure coupling constants via DQF-COSY b) Deduce sugar conformation from NOE intensities 5, 5 HCH C2 endo J 1, 2 ~ 10 Hz (S-type) B-DNA short distance intra nucleotide H6,H8 H2 inter nucleotide H6,H8 H2 5, 5 HCH A-DNA (or RNA) intra nucleotide H6,H8-H3 ; H4 -H2 inter nucleotide H6,H8-H2 ; H6,H8-H3 C3 endo J 1, 2 ~ Hz (N-type) If use short enough τ m, can distinguish.
11 Why is RNA harder to study than DNA? Overlap of ribose H2, H3, H4, H5, H5! C and U base protons not distinguishable by J-coupling or chemical shift (since no Me on U) aromatic H1, UH5 CH5 H2, H3, H4, H5, H5! Hairpin Ribozyme Loop B: An irregular underwound helix with 7 non-watson Crick base pairs A40 A23 U39! Butcher, Allain, Feigon, Nature Struct. Biol. 6, (1999)!
NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationNMR of Nucleic Acids. K.V.R. Chary Workshop on NMR and it s applications in Biological Systems November 26, 2009
MR of ucleic Acids K.V.R. Chary chary@tifr.res.in Workshop on MR and it s applications in Biological Systems TIFR ovember 26, 2009 ucleic Acids are Polymers of ucleotides Each nucleotide consists of a
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationNUCLEIC ACIDS. Basic terms and notions. Presentation by Eva Fadrná adapted by Radovan Fiala
UCLEIC ACIDS Basic terms and notions Presentation by Eva Fadrná adapted by Radovan Fiala RA vs DA Single strand A-RA B-DA duplex Length of A Total length of DA in a human cell 1 m (1000 km) DA in typical
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Resonance assignment and NMR spectra for hairpin and duplex A 6 constructs. (a) 2D HSQC spectra of hairpin construct (hp-a 6 -RNA) with labeled assignments. (b) 2D HSQC or SOFAST-HMQC
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationDNA Structure. Voet & Voet: Chapter 29 Pages Slide 1
DNA Structure Voet & Voet: Chapter 29 Pages 1107-1122 Slide 1 Review The four DNA bases and their atom names The four common -D-ribose conformations All B-DNA ribose adopt the C2' endo conformation All
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationSolution Structure of a Pyrimidine Purine Pyrimidine Triplex Containing the Sequence-specific Intercalating Non-natural Base D 3
J. Mol. Biol. (1996) 257, 1052 1069 Solution Structure of a Pyrimidine Purine Pyrimidine Triplex Containing the Sequence-specific Intercalating Non-natural Base D 3 Edmond Wang 1, Karl M. Koshlap 1, Paul
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationCOSY type experiments exploring through-bond homonuclear correlations
COSY type experiments exploring through-bond homonuclear correlations Assistant Professor Kenneth Kongstad Bioanalytical Chemistry and Metabolomics Research Group Section for Natural Products and Peptides
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10657 Supplementary Text Introduction. All retroviruses contain three genes: namely, gag, pol and env, which code for structural, enzymatic and glycoprotein receptor proteins, respectively.
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationJ. Isaksson, E. Zamaratski, T. V. Maltseva, P. Agback, A. Kumar, and J. Chattopadhyaya*
Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 18, Issue Number 6, (2001) Adenine Press (2001) The First Example of a Hoogsteen Basepaired DNA Duplex in Dynamic Equilibrium with a
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationBerg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1:
Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Biochemistry: An Evolving Science Tips on note taking... Remember copies of my lectures are available on my webpage If you forget to print them
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationThe NMR Structure of an Internal Loop from 23S Ribosomal RNA Differs from Its Structure in Crystals of 50S Ribosomal Subunits,
11776 Biochemistry 2006, 45, 11776-11789 The NMR Structure of an Internal Loop from 23S Ribosomal RNA Differs from Its Structure in Crystals of 50S Ribosomal Subunits, Neelaabh Shankar, Scott D. Kennedy,
More informationChapter 9 DNA recognition by eukaryotic transcription factors
Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationNucleic Acid NMR. Part II
Nucleic Acid NMR Part II Resonance Assignment DNA/RNA (Homonuclear) Resonance Assignmnent DNA/RNA (Homonuclear) NOESY Connectivity (e.g. α C Decamer) ppm 7.2 7.4 7.6 T6 C2 T7 C10 αc8 G1-H8 7.8 8.0 8.2
More informationAssignment of Heme Resonances and. High- and Low-Spin Nitrophorin 2 by 1 H and. Order of Heme Methyl Resonances in High- Spin Ferriheme Proteins
Supplementary Material for: Assignment of Heme Resonances and Determination of the Electronic Structures of High- and Low-Spin Nitrophorin 2 by 1 H and 13 C NMR Spectroscopy: An Explanation of the Order
More informationInfluence of the 2 0 -Hydroxyl Group Conformation on the Stability of A-form Helices in RNA
doi:10.1016/j.jmb.2005.11.043 J. Mol. Biol. (2006) 356, 280 287 COMMUNICATION Influence of the 2 0 -Hydroxyl Group Conformation on the Stability of A-form Helices in RNA Jörg Fohrer 1, Mirko Hennig 2 *
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationHelix (H)27 is centrally located within the decoding
Solution Structure of an Alternate Conformation of Helix 27 from Solution Escherichia Structure coli 16S of anrrna Alternate Conformation of Helix 27 from Escherichia coli 16S rrna Meredith Newby Spano,*
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationELECTRONIC SUPPLEMENTARY INFORMATION
This journal is The Royal Society of Chemistry 1 ELECTRONIC SUPPLEMENTARY INFORMATION More than one non-canonical phosphodiester bond into the G-tract: formation of unusual parallel G-quadruplex structures
More informationNature Structural & Molecular Biology: doi: /nsmb
Supplementary Table 1 Mean inclination angles a of wild-type and mutant K10 RNAs Base pair K10-wt K10-au-up K10-2gc-up K10-2gc-low K10-A-low 1-44 2.8 ± 0.7 4.8 ± 0.8 3.2 ± 0.6 4.3 ± 1.9 12.5 ± 0.4 2 43-2.5
More informationPredicting RNA structures: the model of the RNA element binding Rev meets the NMR structure Fabrice Leclerc, Jayashree Srinivasan and Robert Cedergren
Research Paper 141 Predicting RNA structures: the model of the RNA element binding Rev meets the NMR structure Fabrice Leclerc, Jayashree Srinivasan and Robert edergren Background: How accurate are the
More informationStructural and Biophysical Studies of Nucleic Acids
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 349 Structural and Biophysical Studies of Nucleic Acids WIMAL PATHMASIRI ACTA UNIVERSITATIS UPSALIENSIS
More informationCBMB2008. Nucleic Acid NMR. Yuan-Chao Lou 羅元超. Institute of Biomedical Sciences Academia Sinica 2011/04/27
CBMB2008 ucleic Acid MR Yuan-Chao Lou 羅元超 Institute of Biomedical Sciences Academia Sinica 2011/04/27 Outline I. ucleic acids hold diverse structures and functions a. In vitro SELEX b. Diverse structures
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More informationDepartment of Chemistry and Biochemistry and Molecular Biology Institute, University of California, Los Angeles, CA 90095, USA
3018 3028 Nucleic Acids Research, 1999, Vol. 27, No. 15 1999 Oxford University Press The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha
More informationA Dimeric DNA Interface Stabilized by Stacked A(GGGG)A Hexads and Coordinated Monovalent Cations
doi:10.1006/jmbi.2000.3524 available online at http://www.idealibrary.com on J. Mol. Biol. (2000) 297, 627±644 A Dimeric DNA Interface Stabilized by Stacked A(GGGG)A Hexads and Coordinated Monovalent Cations
More informationRNA Catalysis, Structure and Folding Chair: E. Westhof RNA Meeting 2008 Berlin. Density courtesy David Shechner
RNA Catalysis, Structure and Folding Chair: E. Westhof RNA Meeting 2008 Berlin Density courtesy David Shechner Catalysis implies very precise chemistry: Bringing several atoms at the correct distances
More informationNucleic Acids NMR Spectroscopy. Markus W. Germann Departments of Chemistry and Biology Georgia State University
2012 ucleic Acids MR Spectroscopy Markus W. Germann Departments of Chemistry and Biology Georgia State University Sometimes a picture helps! o animals were hurt!! MR of ucleic Acids 1! 1) MR Spectroscopy
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationCircular dichroism spectroscopic studies on structures formed by telomeric DNA sequences in vitro
Circular dichroism spectroscopic studies on structures formed by telomeric DNA sequences in vitro ZHANG Xiaoyan 1, CAO Enhua 1, SUN Xueguang 1 & BAI Chunli 2 1. Institute of Biophysics, Chinese Academy
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationQuantum Chemistry Study of NMR Parameters of cis Watson-Crick/Sugar Edge RNA Base Pair Family
WDS'06 Proceedings of Contributed Papers, Part III, 64 69, 2006. ISBN 80-86732-86-X MATFYZPRESS Quantum Chemistry Study of NMR Parameters of cis Watson-Crick/Sugar Edge RNA Base Pair Family Z. Vokáčová
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationStructural principles of RNA catalysis in a 2-5 lariat forming ribozyme
Structural principles of RNA catalysis in a 2-5 lariat forming ribozyme Teresa Carlomagno*, Irene Amata, Luca Codutti, Melanie Falb, Jörg Fohrer, Pawel Masiewicz, Bernd Simon Structural and Computational
More informationNucleic Acids NMR Spectroscopy. Markus W. Germann Departments of Chemistry and Biology Georgia State University
ucleic Acids MR Spectroscopy Markus W. Germann Departments of Chemistry and Biology Georgia State University MR of ucleic Acids 1 1) MR Spectroscopy for Structural Studies 2) Primary Structure of DA and
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More informationSTRUCTURAL ELUCIDATION OF GUANOSINE SELF- ASSEMBLIES USING SPECTROSCOPIC AND COMPUTATIONAL METHODS
STRUCTURAL ELUCIDATION OF GUANOSINE SELF- ASSEMBLIES USING SPECTROSCOPIC AND COMPUTATIONAL METHODS by Irene Ching Man Kwan A thesis submitted to the Department of Chemistry In conformity with the requirements
More informationIn Genomes, Two Types of Genes
In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns
More informationBiophysics Lectures Three and Four
Biophysics Lectures Three and Four Kevin Cahill cahill@unm.edu http://dna.phys.unm.edu/ 1 The Atoms and Molecules of Life Cells are mostly made from the most abundant chemical elements, H, C, O, N, Ca,
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationHigh-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE
High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE Foreword Preface Acknowledgements V VI I X Chapter 1. Introduction 1.1. The development of high-resolution NMR 1 1.2. Modern
More informationOrigin of Scalar Couplings BCMB/CHEM 8190
Origin of Scalar Couplings BCMB/CHEM 8190 Traditional View of Scalar Coupling Splitting of NMR signals due to through-bond interactions between nuclei is called scalar coupling (or J coupling or through-bond
More informationFoundations in Microbiology Seventh Edition
Lecture PowerPoint to accompany Foundations in Microbiology Seventh Edition Talaro Chapter 2 The Chemistry of Biology Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationIntroduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research
Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens
More informationChapter 25 Organic and Biological Chemistry
Chapter 25 Organic and Biological Chemistry Organic Chemistry The chemistry of carbon compounds. Carbon has the ability to form long chains. Without this property, large biomolecules such as proteins,
More informationSupplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27
Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27 A40 non-canonical pair stacked over the A41 (G1-C26) three-base
More informationLesson Overview The Structure of DNA
12.2 THINK ABOUT IT The DNA molecule must somehow specify how to assemble proteins, which are needed to regulate the various functions of each cell. What kind of structure could serve this purpose without
More informationRanjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013
Hydration of protein-rna recognition sites Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India 1 st November, 2013 Central Dogma of life DNA
More informationSequence context effect on the structure of nitrous acid induced DNA interstrand cross-links
Published online May 20, 2004 Sequence context effect on the structure of nitrous acid induced DNA interstrand cross-links N. B. Fredrik Edfeldt*, Eric A. Harwood, Snorri Th. Sigurdsson, Paul B. Hopkins
More informationExtended description of the rigid base model (Supplement to Section 2.1: Model)
Supplementary material for cgdna: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA by D. Petkevičiūtė, M. Pasi, O. Gonzalez and J.H. Maddocks S Extended
More information1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.
Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the
More informationDissecting ligand recognition and folding of a structurally complex aptamer-gtp-complex by solution NMR Copyright edited version
Dissecting ligand recognition and folding of a structurally complex aptamer-gtp-complex by solution NMR Copyright edited version Antje Wolter AK Wöhnert, Institute for Molecular Biosciences and BMRZ, Goethe-University
More informationIntroduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations
Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informationLecture 10. Assignment and Structure Determination in Proteins.
Macromolecular MR Spectroscopy B 5886 Lecture 10. Assignment and Structure Determination in Proteins. We have presented several experiments over the past few lectures, and haven t spent any time really
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationChapter 25. Organic and Biological Chemistry. Organic and
Chapter 25 Calculate grade: (Add exam1 - exam 4 scores)x1.5 Add 7 best quizzes (each quiz is worth 29) Gives you the # points you have so far. Final (worth 200 points) Grades: 800-4 750-3.5 700-3 650-2.5
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationAnalysis of NMR Spectra Part 2
Analysis of NMR Spectra Part 2-1- Analysis of NMR Spectra Part 2 "Things should be made as simple as possible, but not any simpler." Albert Einstein 1.1 Review of Basic NMR Concepts NMR analysis is a complex
More informationNMR course at the FMP: NMR of organic compounds and small biomolecules - II -
NMR course at the FMP: NMR of organic compounds and small biomolecules - II - 16.03.2009 The program 2/76 CW vs. FT NMR What is a pulse? Vectormodel Water-flip-back 3/76 CW vs. FT CW vs. FT 4/76 Two methods
More informationChapter 2 The Chemistry of Biology. Dr. Ramos BIO 370
Chapter 2 The Chemistry of Biology Dr. Ramos BIO 370 2 Atoms, Bonds, and Molecules Matter - all materials that occupy space and have mass Matter is composed of atoms. Atom simplest form of matter not divisible
More informationSupplementary Information. Glycosylation of a model proto-rna nucleobase with non-ribose sugars: Implications o the prebiotic synthesis of nucleosides
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supplementary Information Glycosylation of a model proto-rna nucleobase
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationNMR at UNC: Tips, Tricks, and Techniques
NMR at UNC: Tips, Tricks, and Techniques Laura Adduci UNC-Chapel Hill Graduate student Gagné Lab NMR Assistant Chemistry Department Topics and Examples 1. 2D spectra 2. Selective 1D spectra 3. Homonuclear
More informationBiophysical Chemistry: NMR Spectroscopy
Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously
More informationReceived January 12, 2017; Revised March 06, 2017; Editorial Decision March 08, 2017; Accepted March 17, 2017
5586 5601 Nucleic Acids Research, 2017, Vol. 45, No. 9 Published online 21 March 2017 doi: 10.1093/nar/gkx186 Insights into Watson Crick/Hoogsteen breathing dynamics and damage repair from the solution
More informationAdvanced Cell Biology. Lecture 7
Advanced Cell Biology. Lecture 7 Alexey Shipunov Minot State University January 25, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 7 January 25, 2013 1 / 43 Outline Questions and answers Structure
More informationYour Name: Answer Key
Question 1. NMR Basics. (20 points) (a) Indicate schematically the magnetic moments of individual nuclear spins (at least 10) as arrows for the following situations. Assume as always that the external
More informationNMR Spectroscopy. Alexej Jerschow, NYU Chemistry
NMR Spectroscopy Alexej Jerschow, NYU Chemistry 1 Overview Larmor Eq Chemical Shift J-coupling 1D NMR spectra 2D NMR spectra (Imaging) Alexej Jerschow, NYU 2 Alexej Jerschow, NYU 3 For further reading:
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationHow to study the structure and dynamics of protein-rna complexes by NMR spectroscopy
Biomolecular NMR Spectroscopy A.J. Dingley and S.M. Pascal (Eds.) IOS Press, 2011 2011 The authors and IOS Press. All rights reserved. doi:10.3233/978-1-60750-695-9-249 249 How to study the structure and
More informationNMR-spectroscopy in solution - an introduction. Peter Schmieder
NMR-spectroscopy in solution - an introduction 2/92 Advanced Bioanalytics NMR-Spectroscopy Introductory session (11:00 12:30) Basic aspects of NMR-spectroscopy NMR parameter Multidimensional NMR-spectroscopy
More informationProtein NMR spectroscopy
Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationOrganic Chemistry Option II: Chemical Biology
Organic Chemistry Option II: Chemical Biology Recommended books: Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: stuart.conway@chem.ox.ac.uk Teaching
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More information