Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Size: px
Start display at page:

Download "Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A"

Transcription

1 Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A " J.A. 12/11/13

2 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy Theory and Practice 3. Protein NMR & Resonance Assignment 4. NMR Structure Determination & " "Biological NMR Applications "

3 " Lecture #3 Overview" " 1. Protein NMR Structure Determination i. NMR data -> Restraints ii. Structure Calculation & Validation 2. Some Biological NMR Applications i. Residual Dipolar Couplings ii. NMR of large proteins iii. Relaxation and Dynamics

4 Protein NMR Structure Determination" OVERVIEW "" 13 C, 15 N-protein 2D, 3D, 4D NMR Spectral Analysis / Assignment Structure Calculation / Refinement

5 Protein NMR Structure Determination" THE LEVELS OF PROTEIN STRUCTURE "" 1 o" 2 o" 3 o" 4 o"

6 Protein NMR Structure Determination" Experimental NMR Constraints" "NMR ensemble " Distance - NOE - H-bonds Dihedral Angle - 13 C δ - J-couplings Orientational - RDCs Other - PRE/PCS Structure" Program" CYANA XPLOR UNIO ARIA CNS AMBER Rosetta

7 NMR Observable: NOE (d) - a through space correlation (<5 Å) distance restraint Coupling Constant (J) - through bond correlation dihedral angle restraint 1 H- 1 H NOE 4.1Å 2.9Å 3 J HNHα NH Hα Chemical Shift (δ) - very sensitive to local changes in environment dihedral angle restraint Residual Dipolar Coupling Constant (D) - X-Y bond vector orientation in weak alignment medium orientational restraint Hα D XY NH

8 I. Distance Restraints: 1 H- 1 H NOEs" Nuclear Overhauser Effect: change is intensity of 1 NMR signal is " another is irradiated" NOE depends on motion" Through-space dipole-dipole interaction" η" η i = (I-I o )/I o { 1 H}- 15 N NOE 2D noe 1 6 r ab 3Dʼs Estrada et al (2011)

9 I. Distance Restraints: 1 H- 1 H NOEs" through-space < 5Å" noe " 1 r ab 6 H N d αn O N A A 2 d αα Hα H N d NN O N d Nβ, d Nγ, A A 1 Hα H O A A 3 Hα H d αβ, d αγ, d αα i+4 d αβ(i, i+3) d αn(i, i+3) d NN(i, i+3) d αn (i, i+4) i-1 i i+3 i+2 i+1 C C N N d α(i)n(j) N N C C

10 I. Distance Restraints: 1 H- 1 H NOEs" Nomenclature Distances & 2 0 structure K. Wüthrich (1986) NOE patterns & 2 0 structure <5Å weak <4Å medium <2.5Å strong 3 J HNHα

11 I. Distance Restraints: 1 H- 1 H NOEs" 1 H- 1 H Distances & 2 0 structure i. α-helix H-bond " Diagnostics: 3D 15 N-NOESY 3D HNHA" - big sequential H N -H N NOEs" small 3 J HNHα " - H α -H N (i,i+2), (i,i+3), (i,i+4) " d NN" α-helix

12 I. Distance Restraints: 1 H- 1 H NOEs" 1 H- 1 H Distances & 2 0 structure ii. β-strands β-strands antiparallel parallel Diagnostics: 3D 15 N-NOESY 3D 13 C-NOESY 3D HNHA" - big sequential H α -H N NOEs" big cross-strand large 3 J HNHα " " " " " " H α -H α NOEs"

13 I. Distance Restraints: 1 H- 1 H NOEs" 1 H- 1 H Distances & 2 0 structure iii. β-turns β-turns Diagnostics: 3D 15 N-NOESY 3D HNHA" - specific sequential " " " specific 3 J HNHα " H N -H N and H α -H N NOEs " " pattern"

14 II. Dihedral Angle Restraints:" Protein chemical shifts depend on fold" " " Unfolded " " " " "" " " random " coil " " " " "" " " δ s Folded " " " " " "Local Environment" " " " " " "Secondary Structure"

15 II. Dihedral Angle Restraints:" 3 J HNHα & backbone dihedral angles" " " " " H " " " " "" α " 3 " " " " "" J HNHα " " " " " "" H N" 3D HNHA" β- ~8-10 Hz " J(φ-60) = 6.51cos 2 (φ-60) cos(φ-60) α ~3-4 Hz " Vuister & Bax (1993) J. Am. Chem. Soc. 115, 7772

16 II. Dihedral Angle Restraints:" Chemical shifts & backbone dihedral angles" IFNγ " Cα and Cβ CSI " " " " " +1, 0, -1 vs. random coil δ ± range α-helix: ΔCα ~ +3 ppm ΔCβ ~ -1 ppm β-strand: ΔCα ~ -2 ppm ΔCβ ~ +3 ppm Spera & Bax (1991) J. Am. Chem. Soc. 113, 5490 Wishart & Sykes (1994) J. Biomol. NMR 4, 171

17 II. Dihedral Angle Restraints:" TALOS+: Φ,ψ restraints from δʼs "" Φ,ψ space using δʼs, residue type, neighbors " L8" INPUT: 13 C α, 13 C β, 13 C, 1 H α, 1 H N, 15 N "" OUTPUT: Φ,ψ; +/-; S 2 " Ex. Ubq" S 2 " Shen et al (2009) J. Biomol. NMR 44, 213 CSI "

18 Structure Determination:" Manual" Automated: CYANA, AutoStructure, ARIA, UNIO,." "Input Files: assignments (δʼs), NOE spectral peak lists" " " TALOS+ Φ/ψ, stereospecific assignments" " " (Other: H-bonds, Jʼs, RDCs, etc.)" " " " " " "" FGF-2 Montelione et al (2000) Nat Struct Mol Biol 7, 982

19 Iterative NMR Structure Refinement:" " " " " " "" Convergence" Constraints Convergence"

20 Structure Quality & Validation: Many Programs & Metrics " "" NMR Assignment & Restraint Stats Restraint Violations RMSD stats Rama- Global NOE chandran Quality Agreement

21 III. Residual Dipolar Couplings:" Global structural restraints" Weak alignment" "" RDC (D in Hz)" Dipole-Dipole Interaction"

22 III. Residual Dipolar Couplings:" Many alignment methods" i. Bicelles" " ii. Filamentous phage" iii. PAGE" Measure " ΔJ free aligned J NH J NH + D NH

23 III. Residual Dipolar Couplings:" RDC Theory" " 1 H" 15 N"

24 III. Residual Dipolar Couplings: Applications" Global Structural Information " " Structure Refinement" Helical Curvature Angle between 2 o Structural Elements IgG-binding domain of protein A no RDC" + RDC" Relative Orientation of Domains no RDC" + RDC" Zheng et al (2004) Protein Sci. 13, 549

25 NMR of Large Proteins / Complexes" Techniques for raising the MW Limit in Biomolecular NMR" TROSY TRansverse Optimized Deuteration/Selective Protonation SpectroscopY [ 2 H, 13 C, 15 N, 1 H-Ile-δ1,Leu-δ,Val-γ] Pervushin et al (1997) PNAS 94, select narrow " sub-peak" Goto et al (1999) J Biol NMR 13, CAP Tzeng & Kalodimos (2012) Nature 488, 236

26 NMR Relaxation and Dynamics" Insights into a broad range of molecular motions" Boehr et al. (2006)

27 NMR Relaxation Analysis of Proteins" T 1, T 2, CPMG relaxation dispersion experiments T 1 inversion recovery T 2 CPMG CPMG relaxation dispersion I(τ) = I(0) (1 2e -τ/t 1) [ ] n I(T) = I(0) e -T/T 2 Baldwin & Kay (2009)

28 NMR Relaxation Analysis of Proteins" ns motion " " "ns - μs - ms motion" " Backbone Dynamics Conformational Entropy & Molecular Recognition Oligomerization State 13 CH 3 Relaxation Aramini et al (2010 & 2011) Tzeng & Kalodimos (2012) Nature 488, 236

29 THANK YOU" &" GOOD LUCK"

PROTEIN'STRUCTURE'DETERMINATION'

PROTEIN'STRUCTURE'DETERMINATION' PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1

More information

Useful background reading

Useful background reading Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns

More information

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

Sequential Assignment Strategies in Proteins

Sequential Assignment Strategies in Proteins Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei

More information

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of

More information

HSQC spectra for three proteins

HSQC spectra for three proteins HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein

More information

Supporting Information

Supporting Information Supporting Information German Edition: DOI: Sampling of Glycan-Bound Conformers by the Anti-HIV Lectin Oscillatoria agardhii agglutinin in the Absence of Sugar** Marta G. Carneiro, Leonardus M. I. Koharudin,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin

More information

1. 3-hour Open book exam. No discussion among yourselves.

1. 3-hour Open book exam. No discussion among yourselves. Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear

More information

NMR in Structural Biology

NMR in Structural Biology NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?

More information

A topology-constrained distance network algorithm for protein structure determination from NOESY data

A topology-constrained distance network algorithm for protein structure determination from NOESY data University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network

More information

T 1, T 2, NOE (reminder)

T 1, T 2, NOE (reminder) T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

Guided Prediction with Sparse NMR Data

Guided Prediction with Sparse NMR Data Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

Experimental Techniques in Protein Structure Determination

Experimental Techniques in Protein Structure Determination Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2

More information

NMR Assay of Purity and Folding

NMR Assay of Purity and Folding NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research 2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th

More information

Resonance assignments in proteins. Christina Redfield

Resonance assignments in proteins. Christina Redfield Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function

More information

Introduction to biomolecular NMR spectroscopy

Introduction to biomolecular NMR spectroscopy Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev

Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR Dmitry M. Korzhnev Department of Molecular, Microbial and Structural Biology University of Connecticut Health Center 263 Farmington

More information

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens

More information

Structure determination

Structure determination Structure determination NMR Structural Constraints 1. Internuclear distances (Nuclear Overhauser Effect) NOE R -6 2. Dihedral angles (J-coupling): 3 J NHα = 6.4 cos 2 (Φ -60) 1.4cos(Φ -60) + 1.9 3. C hem

More information

Spin Relaxation and NOEs BCMB/CHEM 8190

Spin Relaxation and NOEs BCMB/CHEM 8190 Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations

More information

Biophysical Chemistry: NMR Spectroscopy

Biophysical Chemistry: NMR Spectroscopy Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously

More information

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07 NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each

More information

Residual Dipolar Couplings BCMB/CHEM 8190

Residual Dipolar Couplings BCMB/CHEM 8190 Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)

More information

Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07

Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07 Where do we stand on Projection NMR Spectroscopy? Definition: Projection Mapping an N dimensional vector space onto an N-K dimensional sub-space Associated Definitions Specify field over which vector space

More information

Secondary and sidechain structures

Secondary and sidechain structures Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.

More information

Model-Free Approach to Internal Motions in Proteins

Model-Free Approach to Internal Motions in Proteins Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.

More information

- Basic understandings: - Mapping interactions:

- Basic understandings: - Mapping interactions: NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis

More information

Nuclear Magnetic Resonance

Nuclear Magnetic Resonance Nuclear Magnetic Resonance Lectures for CCB 538 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu J.A.! 04/21/14! April 21!!!!April 23!! April 28! Outline 1. Introduction / Spectroscopy Overview! 2. NMR

More information

Origin of Scalar Couplings BCMB/CHEM 8190

Origin of Scalar Couplings BCMB/CHEM 8190 Origin of Scalar Couplings BCMB/CHEM 8190 Traditional View of Scalar Coupling Splitting of NMR signals due to through-bond interactions between nuclei is called scalar coupling (or J coupling or through-bond

More information

Protein NMR spectroscopy

Protein NMR spectroscopy Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding

More information

Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example

Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

Labelling strategies in the NMR structure determination of larger proteins

Labelling strategies in the NMR structure determination of larger proteins Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Chemical Shift Restraints Tools and Methods. Andrea Cavalli

Chemical Shift Restraints Tools and Methods. Andrea Cavalli Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods

More information

Chittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2,

Chittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2, Extracting Structural Information from Residual Chemical Shift Anisotropy: Analytic Solutions for Peptide Plane Orientations and Applications to Determine Protein Structure Chittaranjan Tripathy 1, Anthony

More information

SUPPLEMENTARY ONLINE DATA

SUPPLEMENTARY ONLINE DATA SUPPLEMENTARY ONLINE DATA Secreted Isoform of Human Lynx1 (SLURP-2): Spatial Structure and Pharmacology of Interaction with Different Types of Acetylcholine Receptors E.N. Lyukmanova 1,2,*, M.A. Shulepko

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Origin of Chemical Shifts BCMB/CHEM 8190

Origin of Chemical Shifts BCMB/CHEM 8190 Origin of Chemical Shifts BCMB/CHEM 8190 Empirical Properties of Chemical Shift υ i (Hz) = γb 0 (1-σ i ) /2π The Larmor frequencies of nuclei depend on the electronic structure of the molecule and the

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

Supporting Information

Supporting Information Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban

More information

Structure determination through NMR

Structure determination through NMR Structure determination through NMR Protein Sample NMR data acquisition Sequential resonance assignment Collection of conformational constraints 3D structure calculations Structure refinement and Analysis

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity

More information

Quantification of Dynamics in the Solid-State

Quantification of Dynamics in the Solid-State Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid

More information

Photochemical and Structural Studies on Cyclic Peptide Models

Photochemical and Structural Studies on Cyclic Peptide Models Article Photochemical and Structural Studies on Cyclic Peptide Models Tamás Milán Nagy 1, Krisztina Knapp 2, Eszter Illyés 3, István Timári 1, Gitta Schlosser 4, Gabriella Csík 5, Attila Borics 6, *, Zsuzsa

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use

More information

Slow symmetric exchange

Slow symmetric exchange Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks

More information

NMR BMB 173 Lecture 16, February

NMR BMB 173 Lecture 16, February NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks

More information

NMR Spectroscopy: A Quantum Phenomena

NMR Spectroscopy: A Quantum Phenomena NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)

More information

Protein dynamics from NMR Relaxation data

Protein dynamics from NMR Relaxation data Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing

More information

Application of automated NOE assignment to three-dimensional structure refinement of a 28 kda single-chain T cell receptor

Application of automated NOE assignment to three-dimensional structure refinement of a 28 kda single-chain T cell receptor Journal of Biomolecular NMR, 5: 0, 999. KLUWER/ESCOM 999 Kluwer Academic Publishers. Printed in the Netherlands. 0 Application of automated NOE assignment to three-dimensional structure refinement of a

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

PDB Composition (2003)

PDB Composition (2003) Biomolecular NMR Dr. Kiattawee hoowongkomon Dept. of Biochemistry Faculty of Science Kasetsart University Email: fsciktc@ku.ac.th Phone: 02-9428281 ext. 121 PDB omposition (2003) Proteins Protein/DNA complexes

More information

Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain,

Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, 026 Biochemistry 2003, 42, 026-039 Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, Shashank Deep, Kerfoot P. Walker, III, Zhanyong Shu, and Andrew P. Hinck*,

More information

Fast High-Resolution Protein Structure Determination by Using Unassigned NMR Data**

Fast High-Resolution Protein Structure Determination by Using Unassigned NMR Data** NMR Spectroscopic Methods DOI: 10.1002/anie.200603213 Fast High-Resolution Protein Structure Determination by Using Unassigned NMR Data** Jegannath Korukottu, Monika Bayrhuber, Pierre Montaville, Vinesh

More information

Julia Audrey Barette. Copyright by Julia Audrey Barette, 2011

Julia Audrey Barette. Copyright by Julia Audrey Barette, 2011 Cross Validation of the Structure of a Transiently Formed and Low Populated FF Domain Folding Intermediate Determined by Relaxation Dispersion NMR and CS- Rosetta by Julia Audrey Barette A thesis submitted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10657 Supplementary Text Introduction. All retroviruses contain three genes: namely, gag, pol and env, which code for structural, enzymatic and glycoprotein receptor proteins, respectively.

More information

Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts

Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts 202 Bulletin of Magnetic Resonance Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts Brian J. Stockman, Terrence A. Scahill, Annica Euvrard,

More information

Supplementary Figures:

Supplementary Figures: Supplementary Figures: Supplementary Figure 1: The two strings converge to two qualitatively different pathways. A) Models of active (red) and inactive (blue) states used as end points for the string calculations

More information

Presenter: She Zhang

Presenter: She Zhang Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native

More information

Solving the three-dimensional solution structures of larger

Solving the three-dimensional solution structures of larger Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of

More information

Structural Basis of Multivalent Binding to Wheat Germ Agglutinin

Structural Basis of Multivalent Binding to Wheat Germ Agglutinin Structural Basis of Multivalent Binding to Wheat Germ Agglutinin David Schwefel, Caroline Maierhofer, Johannes G. Beck, Sonja Seeberger, Kay Diederichs, Heiko M. Möller,*, Wolfram Welte,*, and Valentin

More information

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic

More information

NMR Spectroscopy of Polymers

NMR Spectroscopy of Polymers UNESCO/IUPAC Course 2005/2006 Jiri Brus NMR Spectroscopy of Polymers Brus J 1. part At the very beginning the phenomenon of nuclear spin resonance was studied predominantly by physicists and the application

More information

Study of conformational rearrangement and refinement of structural homology models by the use of heteronuclear dipolar couplings

Study of conformational rearrangement and refinement of structural homology models by the use of heteronuclear dipolar couplings Journal of Biomolecular NMR, 18: 217 227, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 217 Study of conformational rearrangement and refinement of structural homology

More information

Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations

Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field

More information

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted

More information

Origin of Chemical Shifts BCMB/CHEM 8190

Origin of Chemical Shifts BCMB/CHEM 8190 Origin of Chemical Shifts BCMB/CHEM 8190 Empirical Properties of Chemical Shift υ i (Hz) = γb 0 (1-σ i ) /2π σ i, shielding constant dependent on electronic structure, is ~ 10-6. Measurements are made

More information

Connecting NMR data to biomolecular structure and dynamics

Connecting NMR data to biomolecular structure and dynamics Connecting NMR data to biomolecular structure and dynamics David A. Case Chem 538, Spring, 2014 Basics of NMR All nuclei are characterized by a spin quantum number I, which can be 0, 1/2, 1, 3/2, 2...

More information

Structurele Biologie NMR

Structurele Biologie NMR MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans

More information

The Physical Basis of the NMR Experiment

The Physical Basis of the NMR Experiment The Physical Basis of the NMR Experiment 1 Interaction of Materials with Magnetic Fields F F S N S N Paramagnetism Diamagnetism 2 Microscopic View: Single Spins an electron has mass and charge in addition

More information

HADDOCK: High Ambiguity

HADDOCK: High Ambiguity Determination of Protein-Protein complexes HADDOCK: High Ambiguity Driven DOCKing A protein-protein docking approach based on biochemical and/or biophysical data In PDB: >15000 protein structures but

More information

BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE

BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE "Biomolecular Nuclear Magnetic Resonance" is a course intended for all graduate students with an interest in applications

More information

Solid-State NMR Structural Studies of Proteins Using Paramagnetic Probes

Solid-State NMR Structural Studies of Proteins Using Paramagnetic Probes Solid-State NMR Structural Studies of Proteins Using Paramagnetic Probes Christopher Jaroniec Department of Chemistry & Biochemistry The Ohio State University Protein Structure by MAS Solid-State NMR D

More information

Intermediates Detection and Hydrogen Exchange

Intermediates Detection and Hydrogen Exchange Intermediates Detection and Hydrogen Exchange NMR methods for detecting intermediates and excited states Amide exchange Methods for detecting Amide Exchange Application of Amide Exchange to proteins NMR

More information

Introduction to Relaxation Theory James Keeler

Introduction to Relaxation Theory James Keeler EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives

More information

Supplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus

Supplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Supplemental Information for Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Andrew J. Baldwin 1, Gillian R. Hilton 2, Hadi Lioe 2, Claire

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

More information

Practical Manual. General outline to use the structural information obtained from molecular alignment

Practical Manual. General outline to use the structural information obtained from molecular alignment Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,

More information

Peptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526

Peptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526 Peptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526 Watson and Crick DNA Model Given what was known about molecular geometry, hydrogen bonding etc Watson and Crick could build

More information