Timescales of Protein Dynamics
|
|
- Britton Chase
- 6 years ago
- Views:
Transcription
1 Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007
2 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen
3 Transverse Relaxation Ensemble of Nuclear Spins Loss of NMR Signal T 2 Random Phase Phase Synchronization No NMR Signal NMR Signal!
4 Tranverse Relaxation Affects Resonance Linewidth FWHM= 1 π T 2 T2 is short (rapid dephasing) T2 is long (slow dephasing) Transverse Relaxation Rate Constant : R 2 =1/T 2
5 Relaxation of After 180 deg pulse Energy Time constant for return to equilibrium is T1
6 A Major Source of Relaxation is Brownian Rotational Diffusion! τ m θ H N d NH B local (t) t! τ m : rotational correlation time--the time to rotate through one radian B 0
7 The Frequency Dependence of Relexation Rates, R1 example! τ m θ H N After 180 ω B 0 Efficient relaxation if!! ω = 1 / τ m
8 Stokes-Einstein Equation for Rotational Diffusion And dependence of T1 and T2 on tumbling τ m = 4πηr3 3kT where: r = radius k = Boltzman constant h = viscosity coefficient Rule of thumb: For 20 kd at 298 K τ m (s) = 10ns! τ m (s)
9 Relaxation Rates Depend on Amplitude and Frequency of Local Field Fluctuations! R 1 (N) = c 2 J(ω) Square of fluctuating local field! Spectral Density Function! Note-the Spectral Density Function, J, is the Fourier Transform of the C rot (t), the correlation function for rotational diffusion J(ω) = τ m 1+ ( ωτ m )2
10 15 N- 1 H spin pair has four energy states N H! ω H ββ! ω N βα αβ! ω N αα! ω H
11 ( ) ( ) ( ) [ ] ( ) N N H N N H J c J J J d R ω ω ω ω ω ω = ( ) ( ) ( ) ( ) ( ) [ ] ( ) ( ) [ ] J J c J J J J J d R N N H H N N H = ω ω ω ω ω ω ω NH H N r h d = π γ γ µ = Δ 3 N c ω where Farrow et.al, (1995) J. Biomol. NMR 6, 153 Relaxation rates for spin-1/2 nucleus that has a dipolar interaction and chemical shift anisotropy Dipolar Coupling Chemical Shift Anisotropy
12 The spin echo to measure R T T FT Resonance intensity weighted by exp(-r 2 2T)
13 Spin Echo Spectra at Variable t Delay T=40 ms T=20 ms 0 T=0
14 Extracting R2 from Spin-Echo Data Remember: R 2 =1/T 2 I(t)! I(T)!=!exp(*R 2 2T) T
15 The Inversion Recovery Experiment to measure R1 90y T t
16 Inversion Recovery Data
17 Analysis of Inversion Recovery Data Mz eq M z (t) Mz = Mz eq ( 1-2 e -R1*T ) -Mz eq
18 T1 and T2 inform on dynamics for each residue!
19 Model Free formalism accounts for internal motions J Lipari-Szabo (Model Free) ( ω) ( 2 S τ 1 S ) τ ( ) ( ) m ω τ m 1+ ω τ = 2! τ m! τ e H θ N where 1 τ 1 1 = + τ e τ m B 0
20 Heteronuclear NOE measurements Measure saturated and unsaturated experiments and take the intensity ratio for each peak Farrow and Kay, Biochemistry, 1993
21 The heteronuclear NOE N H R 1H ββ R 1N M N (N αα - N βα ) + (N αβ - N ββ ) βα αβ M H (N αα - N αβ ) + (N βα - N ββ ) R 1N R 1H αα Saturation equalizes ββ and βα, αβ and αα à M H = 0 R 1 transitions are an independent return to equilibrium
22 N H The heteronuclear NOE ββ W 2NH M N (N αα - N βα ) + (N αβ - N ββ ) βα W 0NH αβ αα W 2 transitions increase N αα and decrease N ββ à M increases (positive NOE) M N decreases (negative NOE) W 0 transitions increase N βα and decrease N αβ à M decreases (negative NOE) M N increases (positive NOE) NOE= I(sat) I(unsat) =1+( γ H I(unsat) γ )d2 6J(ω +ω ) J(ω ω ) N N H N H /R 1 (N)
23 15 N-{ 1 H} Heteronuclear NOE versus rotational correlation time! I sat I unsat! τ m (s)
24 Model Free formalism accounts for internal motions J Lipari-Szabo (Model Free) ( ω) ( 2 S τ 1 S ) τ ( ) ( ) m ω τ m 1+ ω τ = 2! τ m! τ e H θ N where 1 τ 1 1 = + τ e τ m!s 2 and! τ m and! τ e obtained by fitting against R1, R2 and heteronuclear NOE B 0
25 Determining Structures by NMR
26
27 A Real 2D NOE Experiment of a Small Peptide A projection through both dimensions gives a 1D spectrum HN-Haliph crosspeaks HN-Ha crosspeaks 1H, ppm HN-HN crosspeaks 1H, ppm
28 Interpretation of NOESY Spectra Crosspeaks are a measure of NOE between two spins. Intensity proportional to The intensity of the crosspeak is used to quantify the interaction. 1H ppm 1H ppm
29 Higher Dimensionality 3 and 4D Heteronuclear Experiments on Isotopically Labeled (15N-13C) Proteins 2D NOESY of a 76 residue protein homodimer (effectively 18kD) in D2O 1H, ppm 1H, ppm In practice, even small proteins have very crowded 2D spectra making assignment very difficult. In this case the fact that it is in D2O simplifies the spectra because the amide protons exchange for deuterium and are not visible.
30 Benefit of C13 and N15 labeling of Proteins for NMR Higher Dimensionality (3 and 4D) Experiments Reduce Overlap Compared to 2D Experiments 1H! 15N! 1H! 1H! 1H! 2D noe Expt. on unlabeled protein 3D noe Expt. on N15-labeled protein Many More Types of Experiments Can be Done on Isotopically Labeled Protein 15N-1H! 1H-13C! noes between Protons Attached to N15 and Protons Attached to 13C 13C-1H! 1H-13C! noes between Protons Attached to 13C and Protons and Attached to 13C
31 Side-chain protein assignments R H-C-H H-C-H R N--C--C--N--C--C-- H H O H H O R H-C-H R H-C-H --N--C--C--N--C--C-- H H O H H O H(CCO)NH i - 1 res. All Carbon s H s at i-1 to N-H pair. 15N-TOCSY i res. All H s at i to N-H pair.
32 Close interatomic distances in secondary structures alpha-helix parallel beta-sheet antiparallel beta-sheet type I turn type II turn
33 H a chemical shifts and secondary structure the figure at right shows distributions of H a chemical shifts observed in sheets (lighter bars) and helices (darker bars). H a chemical shifts in a-helices are on average 0.39 ppm below random coil values, while b-sheet values are 0.37 ppm above random coil values. Wishart, Sykes & Richards J Mol Biol (1991) 222, 311.
34 Chemical shift index (CSI) trends like these led to the development of the concept of the chemical shift index* as a tool for assigning secondary structure using chemical shift values. one starts with a table of reference values for each aminoacid type, which is essentially a table of random coil H a values CSI s are then assigned as follows: exp tl H a shift rel. to reference assigned CSI within ± 0.1 ppm 0 >0.1 ppm lower -1 >0.1 ppm higher +1 *Wishart, Sykes & Richards Biochemistry (1992) 31,
35 Chemical shift indices CSI residue # any dense grouping of four or more -1 s, uninterrupted by 1 s is assigned as a helix, while any dense grouping of three or more 1 s, uninterrupted by -1 s, is assigned as a sheet. a dense grouping means at least 70% nonzero CSI s. other one regions are assigned as coil this simple technique assigns 2ndary structure w/90-95% accuracy similar useful relationships exist for 13 C a, 13 C C=O shifts
36 NMR provides information about structure chemical shifts <=> local electronic environment coupling constants <=> torsion angles NOE, ROE <=> interproton distances residual dipolar couplings <=> bond orientation and dynamics relaxation times NOE, ROE Most of the data describe local environment of the protons relative to each other not the global conformation of the molecule
37 Distance NOE: The distance between i and j is a function of the NOE intensity D ij ~ C(NOE ij ) -6 H-bonds: Identified by slowly exchanging amide H N protons Angles Side Chain and backbone torsion angles identified from J-coupling experiments Chemical Shift also gives Angular Information Residual Dipolar Couplings Bond Orientations Relative to an Alignment Tensor
38 Molecular Dynamics with Simulated Annealing starting from random coordinates Goal is to minimize the hybrid energy function Additional Unambiguous Experimental Restraints E-ForceField E-NOEs E-Angles E-H_bonds E-Chemical_shift E-Dipolar_couplings
39
40
41 Key problem is ambiguity in NOE assignments Need for higher dimensional data: 3D & 4D Need for heteronuclear data Need for better calculational strategies that can deal with ambiguous data
42
43 # residues # restraints/residue
44 Paper Discussion
45 P21 RAS(1-166) GDP structure determined by NMR Poorly Defined Loop Ensemble of structures: backbone RMSD in Switch 2
46 Loop containing critical residues for catalysis poorly defined
47 Disorder from lack of restraints or mobility?
48 What does T2 tell us about the Switch 2 loop containing Q61?! τ m (s)
49 Is the heteronuclear NOE consistent with fast ps-ns motions in active site?! τ m (s)
50 T1/T2 Proportional to! τ m for each resid
51 Mapping relaxation data onto structure S 2
52 Dynamic Switches as a handle for regulatory factors GEF Catalyzes product release Sondek and coworkers Nature, 2000
53 Order-disorder transitions accompany GEF activation Paper for Friday Aghazadeh et al, Cell 2000
Timescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationIntroduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D.
Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions John Gross, Ph.D. Nuclear Spins: Microscopic Bar Magnets H µ S N N + Protein Fragment Magnetic Moment Bar Magnet
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informationBiophysical Chemistry: NMR Spectroscopy
Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationSlow symmetric exchange
Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More informationNMR Spectroscopy: A Quantum Phenomena
NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)
More informationIntroduction to Relaxation Theory James Keeler
EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationNMR Relaxation and Molecular Dynamics
Ecole RMN Cargese Mars 2008 NMR Relaxation and Molecular Dynamics Martin Blackledge IBS Grenoble Carine van Heijenoort ICSN, CNRS Gif-sur-Yvette Solution NMR Timescales for Biomolecular Motion ps ns µs
More informationIntroduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research
Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationT 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationQuantification of Dynamics in the Solid-State
Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid
More informationPRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS
PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian
More informationThe Physical Basis of the NMR Experiment
The Physical Basis of the NMR Experiment 1 Interaction of Materials with Magnetic Fields F F S N S N Paramagnetism Diamagnetism 2 Microscopic View: Single Spins an electron has mass and charge in addition
More informationK ex. Conformational equilibrium. equilibrium K B
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any yprocess in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationNMR-spectroscopy of proteins in solution. Peter Schmieder
NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture
More information5th CCPN Matt Crump. Thermodynamic quantities derived from protein dynamics
5th CCPN 2005 -Matt Crump Thermodynamic quantities derived from protein dynamics Relaxation in Liquids (briefly!) The fluctuations of each bond vector can be described in terms of an angular correlation
More informationStructurele Biologie NMR
MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans
More informationCHEM / BCMB 4190/6190/8189. Introductory NMR. Lecture 10
CHEM / BCMB 490/690/889 Introductory NMR Lecture 0 - - CHEM 490/690 Spin-Echo The spin-echo pulse sequence: 90 - τ - 80 - τ(echo) Spins echoes are widely used as part of larger pulse sequence to refocus
More informationLecture #7 In Vivo Water
Lecture #7 In Vivo Water Topics Hydration layers Tissue relaxation times Magic angle effects Magnetization Transfer Contrast (MTC) CEST Handouts and Reading assignments Mathur-De Vre, R., The NMR studies
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationLecture #6 (The NOE)
Lecture #6 (The OE) 2/18/15 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distance
More informationLecture #6 (The NOE)
Lecture #6 (The OE) 2/24/17 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distances
More informationNMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins
Elisar Barbar Department of Chemistry and Biochemistry, Ohio University, Athens, OH 45701 NMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins Abstract: Studies of
More informationIntroduction to NMR Product Operators. C. Griesinger. Max Planck Institute for Biophysical Chemistry. Am Faßberg 11. D Göttingen.
ntroduction to NMR Product Operato C. Griesinger Max Planck nstitute for Biophysical Chemistry Am Faßberg 11 D-3777 Göttingen Germany cigr@nmr.mpibpc.mpg.de http://goenmr.de EMBO Coue Heidelberg Sept.
More informationModel-Free Approach to Internal Motions in Proteins
Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.
More informationNMR BMB 173 Lecture 16, February
NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks
More informationChemistry 431. Lecture 23
Chemistry 431 Lecture 23 Introduction The Larmor Frequency The Bloch Equations Measuring T 1 : Inversion Recovery Measuring T 2 : the Spin Echo NC State University NMR spectroscopy The Nuclear Magnetic
More informationUNIVERSITY OF CINCINNATI
UNIVERSITY OF CINCINNATI Date: I,, hereby submit this work as part of the requirements for the degree of: in: It is entitled: This work and its defense approved by: Chair: Nuclear Magnetic Resonance Studies
More informationProtein Dynamics, Allostery and Function
Protein Dynamics, Allostery and Function Lecture 2. Protein Dynamics Xiaolin Cheng UT/ORNL Center for Molecular Biophysics SJTU Summer School 2017 1 Functional Protein Dynamics Proteins are dynamic and
More informationPRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS
PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: (Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian
More informationMidterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017
Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017 INSTRUCTIONS: You will have 50 minute to work on this exam. You can use any notes or books that you bring with you to assist you in answering
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationProtein Dynamics, Allostery and Function
Protein Dynamics, Allostery and Function Lecture 3. Protein Dynamics Xiaolin Cheng UT/ORNL Center for Molecular Biophysics SJTU Summer School 2017 1 Obtaining Dynamic Information Experimental Approaches
More informationNMR course at the FMP: NMR of organic compounds and small biomolecules - II -
NMR course at the FMP: NMR of organic compounds and small biomolecules - II - 16.03.2009 The program 2/76 CW vs. FT NMR What is a pulse? Vectormodel Water-flip-back 3/76 CW vs. FT CW vs. FT 4/76 Two methods
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationRelaxation, Multi pulse Experiments and 2D NMR
Relaxation, Multi pulse Experiments and 2D NMR To Do s Read Chapter 6 Complete the end of chapter problems; 6 1, 6 2, 6 3, 6 5, 6 9 and 6 10. Read Chapter 15 and do as many problems as you can. Relaxation
More informationPractical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationSolid state and advanced NMR
Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical
More informationSpin-spin coupling I Ravinder Reddy
Spin-spin coupling I Ravinder Reddy Spin-interactions External interactions Magnetic field Bo, RF field B1 Internal Interactions Molecular motions Exchange Chemical shifts J-coupling Spin Diffusion Dipolar
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationIntroduction to biomolecular NMR spectroscopy
Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More information8 NMR Interactions: Dipolar Coupling
8 NMR Interactions: Dipolar Coupling 8.1 Hamiltonian As discussed in the first lecture, a nucleus with spin I 1/2 has a magnetic moment, µ, associated with it given by µ = γ L. (8.1) If two different nuclear
More informationMore NMR Relaxation. Longitudinal Relaxation. Transverse Relaxation
More NMR Relaxation Longitudinal Relaxation Transverse Relaxation Copyright Peter F. Flynn 2017 Experimental Determination of T1 Gated Inversion Recovery Experiment The gated inversion recovery pulse sequence
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationRelaxation. Ravinder Reddy
Relaxation Ravinder Reddy Relaxation What is nuclear spin relaxation? What causes it? Effect on spectral line width Field dependence Mechanisms Thermal equilibrium ~10-6 spins leads to NMR signal! T1 Spin-lattice
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More information8.2 The Nuclear Overhauser Effect
8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used
More informationCitation for published version (APA): Feenstra, K. A. (2002). Long term dynamics of proteins and peptides. Groningen: s.n.
University of Groningen Long term dynamics of proteins and peptides Feenstra, Klaas Antoni IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationELECTRON PARAMAGNETIC RESONANCE
ELECTRON PARAMAGNETIC RESONANCE = MAGNETIC RESONANCE TECHNIQUE FOR STUDYING PARAMAGNETIC SYSTEMS i.e. SYSTEMS WITH AT LEAST ONE UNPAIRED ELECTRON Examples of paramagnetic systems Transition-metal complexes
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationSpin Dynamics Basics of Nuclear Magnetic Resonance. Malcolm H. Levitt
Spin Dynamics Basics of Nuclear Magnetic Resonance Second edition Malcolm H. Levitt The University of Southampton, UK John Wiley &. Sons, Ltd Preface xxi Preface to the First Edition xxiii Introduction
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationSUPPLEMENTARY ONLINE DATA
SUPPLEMENTARY ONLINE DATA Secreted Isoform of Human Lynx1 (SLURP-2): Spatial Structure and Pharmacology of Interaction with Different Types of Acetylcholine Receptors E.N. Lyukmanova 1,2,*, M.A. Shulepko
More informationSupplementary Materials belonging to
Supplementary Materials belonging to Solution conformation of the 70 kda E.coli Hsp70 complexed with ADP and substrate. Eric B. Bertelsen 1, Lyra Chang 2, Jason E. Gestwicki 2 and Erik R. P. Zuiderweg
More informationNMR Spectroscopy of Polymers
UNESCO/IUPAC Course 2005/2006 Jiri Brus NMR Spectroscopy of Polymers Brus J 1. part At the very beginning the phenomenon of nuclear spin resonance was studied predominantly by physicists and the application
More informationAnalysis of MD trajectories in GROMACS David van der Spoel
Analysis of MD trajectories in GROMACS David van der Spoel What does MD produce? Energy terms E(t) Coordinates x(t) Velocities v(t) Forces f(t) Managing your files trjcat - merging trajectories concatenating
More informationBiophysical Chemistry: NMR Spectroscopy
Spin Dynamics & Vrije Universiteit Brussel 25th November 2011 Outline 1 Pulse/Fourier Transform NMR Thermal Equilibrium Effect of RF Pulses The Fourier Transform 2 Symmetric Exchange Between Two Sites
More informationThe Effect of Motional Averaging on the Calculation of NMR-Derived Structural Properties
PROTEINS: Structure, Function, and Genetics 6:542 555 (1999) The Effect of Motional Averaging on the Calculation of NMR-Derived Structural Properties Xavier Daura, 1 Iris Antes, 1,2 Wilfred F. van Gunsteren,
More informationPROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationH B. θ = 90 o. Lecture notes Part 4: Spin-Spin Coupling. θ θ
Lecture notes Part 4: Spin-Spin Coupling F. olger Försterling October 4, 2011 So far, spins were regarded spins isolated from each other. owever, the magnetic moment of nuclear spins also have effect on
More informationMagnetisation Transfer Schemes
Magnetisation Transfer Schemes P. K. Madhu Department of Chemical Sciences Tata Institute of Fundamental Research Homi Bhabha Road Colaba Mumbai 400 005, India Sensitivity of NMR Spectroscopy S/N Nγ exc
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More information