Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190
|
|
- Annabelle Hodge
- 5 years ago
- Views:
Transcription
1 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190
2 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve, R. W.; Jiang, J. S.; Kuszewski, J.; Nilges, M.; Pannu, N. S.; Read, R. J.; Rice, L. M.; Simonson, T.; Warren, G. L. Acta Cryst. D 1998, 54, 905. XPLOR-NIH - Schwieters, C. D.; Kuszewski, J. J.; Tjandra, N.; Clore, G. M. J. Magn. Reson. 2003, 160, 65. DYANA - Guntert, P.; Mumenthaler, C.; Wuthrich, K. J. Mol. Biol. 1997, 273, 283. ARIA - Linge JP, Habeck M, Rieping W, et al. Bioinformatics 2003, 19, JAN
3 NOE data from 2D and 3D experiments are a primary source of information I cp = C{exp(-ρT) (1 exp(-2σt)} ρ = 2W 1 + W 2 + W 0, σ = (W 2 -W 0 ) I cp di cp /dt 1/r 6 T
4 NOESY Spectrum of ACP
5 Potential NOE Interactions In an Idealized α-helix Some can be used as a distance calibration
6 Long range NOEs (sidechain to sidechain) are among the most important in structure determination
7 Getting an Initial Structure - Embedding Metric Matrix producing an approximate fold from an extended chain View as a set of products of vectors in N dimensional hyperspace W. Braun, Quart. Rev. Biophys. 19, (1987) M = r i r j 0 r j r i D ij r i r j can be written in terms of distances D 2 ij = r i 2 + r j 2-2r i r j
8 Solving for positions in Cartesian space Fill in matrix with inter-atom distances some from NOEs a lot from covalent geometry - Diagonalize M; λ = A M A -1 ; M = A -1 λ A A diagonal matrix corresponds to vectors in real space Only 3 λ should be finite and equal (r i r i finite only for x x, etc) r i r i = Σ k λ k A -1 ik A jk = A -1 j1 A i1 +A -1 j2 A i2 +A -1 j3 A i3 = x i x i +y i y i +z i z i Hence, elements of A are x,y,z coordinates of atoms In practice often use upper and lower bounds and fill in matrix by random number selection within bounds Solution is only approximate
9 Structures Using Error Functions and Simulated Annealing E = E bond + E vdw + E angle E NMR E NMR = Σ I (r obs r trial ) I 2 (or use r min,max for r obs ) x new = x old + t v x = x old + t a x dt, y new = a x = F x /m= - (1/m) de/dx + a rand (T), a y = T t
10 20 NMR Structures of DnaJ
11
12
13
14
15
16
17
18
19
20
21 Validation of Structures R factor for NOEs: n ~ 1/6 R = Σ NOEs [(I obs ) n (I calc ) n ] / Σ NOEs (I obs ) n Other statistics: rmsd of backbone and all atoms. NOE violations Molecular energy Procheck output
22
23
24 Structure Refinement Using RDCs Write RDCs in principal alignment frame: D = (D a /r 3 ){(3cos 2 θ 1)/r 3 + (3/2)Rsin 2 θcos(2φ)} Write error function in terms of D meas and D calc E RDC = (D meas D calc ) 2 Seek minimum in E RDC to refine structure Need to float alignment axes during search
25 REsidual Dipolar Coupling Analysis Tool (REDCAT) Valafar, H., & J.H. Prestegard (2004), J. Mag. Res. 167: Dosset, Hus, Marion & Blackledge (2001), JBNMR, 20: Given a proposed structure and RDCs, calculates order tensor solutions. Finds best order tensor solution. Gives principal elements and Euler angles. Back-calculates RDCs. Estimates errors and helps identify problematic data.
26 Access Prepare Input From File menu
27 Input from file menu is pdb file and rdc list HEADER METAL BINDING PROTEIN 1BQ8.pdb ATOM 1 N MET A ATOM 2 CA MET A ATOM 3 C MET A ATOM 4 O MET A # Pf-Fe-Rubredoxin residues 2-54 # H-N RDCs from field induced orientation
28 Loaded Coordinates and Couplings
29 A List of Possible Solutions is Generated by Monte Carlo Sampling
30 Problematic Data Identification by Numbers of Rejections Caused
31 Error Analysis with Error < 1.0 Green: Acceptable error, Red: Small indicated error, Gray: Excluded from analysis.
32 Best Solution After the Adjustment of Errors
PROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More informationRESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190
RESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190 Long-Range Structural NMR Restraints Traditional NOE-based protein structure determination methods suffer from the lack of long-range structural restraints - in
More informationPeptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526
Peptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526 Watson and Crick DNA Model Given what was known about molecular geometry, hydrogen bonding etc Watson and Crick could build
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationSupporting Information
Supporting Information German Edition: DOI: Sampling of Glycan-Bound Conformers by the Anti-HIV Lectin Oscillatoria agardhii agglutinin in the Absence of Sugar** Marta G. Carneiro, Leonardus M. I. Koharudin,
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationSolving the three-dimensional solution structures of larger
Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of
More informationAccurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings
Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Jose Luis Ortega-Roldan, Malene Ringkjøbing Jensen*, Bernhard Brutscher, Ana I. Azuaga, Martin
More informationResidual Dipolar Couplings Measured in Multiple Alignment Media.
Residual Dipolar Couplings Measured in Multiple Alignment Media. We have already seen that the orientational degeneracy inherent to a single measured coupling can be raised by measuring different directions
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationPractical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
More informationDipolar Couplings in Partially Aligned Macromolecules - New Directions in. Structure Determination using Solution State NMR.
Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. Recently developed methods for the partial alignment of macromolecules in dilute
More informationGuided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
More informationStructural principles of RNA catalysis in a 2-5 lariat forming ribozyme
Structural principles of RNA catalysis in a 2-5 lariat forming ribozyme Teresa Carlomagno*, Irene Amata, Luca Codutti, Melanie Falb, Jörg Fohrer, Pawel Masiewicz, Bernd Simon Structural and Computational
More informationMacrocyclization of Peptide Side Chains by Ugi Reaction: Achieving Peptide
Macrocyclization of Peptide Side Chains by Ugi Reaction: Achieving Peptide Folding and Exocyclic N-Functionalization in One Shot Aldrin V. Vasco,, Carlos S. Pérez, Fidel E. Morales, Hilda E. Garay, ǁ Dimitar
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More informationAssessment of molecular structure using frame-independent orientational restraints derived from residual dipolar couplings
Journal of Biomolecular NMR, 18: 239 252, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 239 Assessment of molecular structure using frame-independent orientational restraints
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationISD A Bayesian Software for NMR Structure Determination
ISD A Bayesian Software for NMR Structure Determination Wolfgang Rieping Michael Habeck Abstract Structure determination by NMR is often perceived as being less objective than x-ray crystallography. The
More informationA new method for protein structure reconstruction from NOESY
A new method for protein structure reconstruction from NOESY distances Z. Li, S. Li, X. Wei, X. Peng*, Q. Zhao* ABSTRACT Protein structure reconstruction from Nuclear Magnetic Resonance (NMR) experiments
More information7.91 Amy Keating. Solving structures using X-ray crystallography & NMR spectroscopy
7.91 Amy Keating Solving structures using X-ray crystallography & NMR spectroscopy How are X-ray crystal structures determined? 1. Grow crystals - structure determination by X-ray crystallography relies
More informationAn Exhaustive Search Algorithm to Aid NMR-Based Structure Determination of Rotationally Symmetric Transmembrane Oligomers
www.nature.com/scientificreports Received: 14 September 2017 Accepted: 15 November 2017 Published: xx xx xxxx OPEN An Exhaustive Search Algorithm to Aid NMR-Based Structure Determination of Rotationally
More informationSupporting Information
Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,
More informationChittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2,
Extracting Structural Information from Residual Chemical Shift Anisotropy: Analytic Solutions for Peptide Plane Orientations and Applications to Determine Protein Structure Chittaranjan Tripathy 1, Anthony
More informationSupplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release
Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section
More informationA.D.J. van Dijk "Modelling of biomolecular complexes by data-driven docking"
Chapter 3. Various strategies of using Residual Dipolar Couplings in NMRdriven protein docking: application to Lys48-linked di-ubiquitin and validation against 15 N-relaxation data. Aalt D.J. van Dijk,
More informationFast High-Resolution Protein Structure Determination by Using Unassigned NMR Data**
NMR Spectroscopic Methods DOI: 10.1002/anie.200603213 Fast High-Resolution Protein Structure Determination by Using Unassigned NMR Data** Jegannath Korukottu, Monika Bayrhuber, Pierre Montaville, Vinesh
More informationHADDOCK: High Ambiguity
Determination of Protein-Protein complexes HADDOCK: High Ambiguity Driven DOCKing A protein-protein docking approach based on biochemical and/or biophysical data In PDB: >15000 protein structures but
More informationComputational aspects of structure determination by NMR
Computational aspects of structure determination by NMR Alexandre Bonvin Utrecht University EMBO course Il Ciocco 2002 With contributions from - Michael Nilges and Jens Linge (Institut Pasteur, Paris)
More informationA new approach for applying residual dipolar couplings as restraints in structure elucidation
Journal of Biomolecular NMR, 16: 245 252, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 245 A new approach for applying residual dipolar couplings as restraints in structure
More informationNumbat: an interactive software tool for fitting Dv-tensors to molecular coordinates using pseudocontact shifts
J Biomol NMR (2008) 41:179 189 DOI 10.1007/s10858-008-9249-z ARTICLE Numbat: an interactive software tool for fitting Dv-tensors to molecular coordinates using pseudocontact shifts Christophe Schmitz Æ
More informationParamagnetic Effects BCMB/CHEM
Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti
More informationStructure determination through NMR
Structure determination through NMR Protein Sample NMR data acquisition Sequential resonance assignment Collection of conformational constraints 3D structure calculations Structure refinement and Analysis
More informationAn Algebraic Geometry Approach to Protein Structure Determination from NMR Data
IEEE Computational Systems Bioinformatics (CSB) Conference. Stanford, CA 2005; pp. 235 246. An Algebraic Geometry Approach to Protein Structure Determination from NMR Data Lincong Wang Ramgopal R. Mettu
More informationresearch papers Detecting outliers in non-redundant diffraction data 1. Introduction Randy J. Read
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Detecting outliers in non-redundant diffraction data Randy J. Read Department of Haematology, University of Cambridge, Cambridge
More informationTheoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins
Published on Web 09/8/003 Theoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins Alessandro Mascioni and Gianluigi Veglia* Contribution from the Department
More informationAnalysis of protein dynamics using local-dme calculations
Biochemistry, Biophysics and Molecular Biology Publications Biochemistry, Biophysics and Molecular Biology 2011 Analysis of protein dynamics using local-dme calculations Di Wu Western Kentucky University
More informationProtein Structure by Semidefinite Facial Reduction
Protein Structure by Semidefinite Facial Reduction Babak Alipanahi 1, Nathan Krislock 2, Ali Ghodsi 3, Henry Wolkowicz 4, Logan Donaldson 5, and Ming Li 1 1 David R. Cheriton School of Computer Science,
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/312/5771/273/dc1 Supporting Online Material for Conformational Switches Modulate Protein Interactions in Peptide Antibiotic Synthetases Alexander Koglin, Mohammad R.
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationNew applications of simulated annealing in X-ray crystallography and solution NMR Axel T Brünger*, Paul D Adams and Luke M Rice
Ways & Means 325 New applications of simulated annealing in X-ray crystallography and solution NMR Axel T Brünger*, Paul D Adams and Luke M Rice Address: The Howard Hughes Medical Institute and Department
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationCrystal Structures of the Two Isomorphous A-DNA Decamers d(gtacgcgtac) and d(ggccgcggcc)
568 Bull. Korean Chem. Soc. 2006, Vol. 27, No. 4 Taegyun Kim et al. Crystal Structures of the Two Isomorphous A-DNA Decamers d(gtacgcgtac) and d(ggccgcggcc) Taegyun Kim, Taek Hun Kwon, Hyesun Jung, Ja
More informationApplication of automated NOE assignment to three-dimensional structure refinement of a 28 kda single-chain T cell receptor
Journal of Biomolecular NMR, 5: 0, 999. KLUWER/ESCOM 999 Kluwer Academic Publishers. Printed in the Netherlands. 0 Application of automated NOE assignment to three-dimensional structure refinement of a
More informationPhase Improvement by Multi-Start Simulated Annealing Re nement and Structure-Factor Averaging
798 J. Appl. Cryst. (1998). 31, 798±805 Phase Improvement by Multi-Start Simulated Annealing Re nement and Structure-Factor Averaging Luke M. Rice, a Yousif Shamoo a and Axel T. BruÈ nger a,b * a Department
More informationStudy of conformational rearrangement and refinement of structural homology models by the use of heteronuclear dipolar couplings
Journal of Biomolecular NMR, 18: 217 227, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 217 Study of conformational rearrangement and refinement of structural homology
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationSupplementary Information
Supplementary Information Molecular Cloning. The DNA sequence corresponding to the UBZ domain of human DNA Y-polymerase η (residues 628-662) was synthesized using three primers 5 -GGG AGC CCA TAT GGC TGC
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSANE (Structure Assisted NOE Evaluation): An automated model-based approach for NOE assignment
Journal of Biomolecular NMR, 19: 321 329, 2001. KLUWER/ESCOM 2001 Kluwer Academic Publishers. Printed in the Netherlands. 321 SANE (Structure Assisted NOE Evaluation): An automated model-based approach
More informationDihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769
Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral
More informationModel building of a protein-protein complexed structure using saturation transfer and residual dipolar coupling without paired intermolecular NOE
Journal of Biomolecular NMR 29: 325 338, 2004. 2004 Kluwer Academic Publishers. Printed in the Netherlands. 325 Model building of a protein-protein complexed structure using saturation transfer and residual
More informationEvaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
More informationChemical Shift Restraints Tools and Methods. Andrea Cavalli
Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods
More informationA topology-constrained distance network algorithm for protein structure determination from NOESY data
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network
More informationAlpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University
Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and
More informationBayesian estimation of Karplus parameters and torsion angles from three-bond scalar couplings constants
Journal of Magnetic Resonance xxx (2005) xxx xxx Communication Bayesian estimation of Karplus parameters and torsion angles from three-bond scalar couplings constants Michael Habeck 1, Wolfgang Rieping
More informationPrediction and refinement of NMR structures from sparse experimental data
Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk
More informationDipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR.
Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. NMR spectroscopy is now established as the most effective method for the determination
More informationDetermination of NMR Solution Structure of a Branched Nucleic Acid from Residual Dipolar Couplings using Isotope Labeled Nucleotides
Determination of NMR Solution Structure of a Branched Nucleic Acid from Residual Dipolar Couplings using Isotope Labeled Nucleotides Bernd N.M. van Buuren, Jürgen Schleucher, Valentin Wittmann, Christian
More information9. Nuclear Magnetic Resonance
9. Nuclear Magnetic Resonance Nuclear Magnetic Resonance (NMR) is a method that can be used to find structures of proteins. NMR spectroscopy is the observation of spins of atoms and electrons in a molecule
More informationGeometry, Energetics, and Dynamics of Hydrogen Bonds in Proteins: Structural Information Derived from NMR Scalar Couplings
Published on Web 11/07/2006 Geometry, Energetics, and Dynamics of Hydrogen Bonds in Proteins: Structural Information Derived from NMR Scalar Couplings Joerg Gsponer, Harri Hopearuoho, Andrea Cavalli, Christopher
More informationCourse Notes: Topics in Computational. Structural Biology.
Course Notes: Topics in Computational Structural Biology. Bruce R. Donald June, 2010 Copyright c 2012 Contents 11 Computational Protein Design 1 11.1 Introduction.........................................
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationSolution structure of Ca 2+ -free rat a-parvalbumin
Solution structure of Ca 2+ -free rat a-parvalbumin MICHAEL T. HENZL 1 AND JOHN J. TANNER 1,2 1 Department of Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211, USA 2 Department of
More informationAuthor's personal copy
Methods 52 (2010) 168 172 Contents lists available at ScienceDirect Methods journal homepage: www. elsevier. com/ locate/ ymeth Review Article Solving novel RNA structures using only secondary structural
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationAutomated Assignment of Simulated and Experimental NOESY Spectra of Proteins by Feedback Filtering and Self-correcting Distance Geometry
J. Mol. Biol. (1995) 254, 465 480 Automated Assignment of Simulated and Experimental NOESY Spectra of Proteins by Feedback Filtering and Self-correcting Distance Geometry Ch. Mumenthaler 1 and W. Braun
More informationConnecting NMR data to biomolecular structure and dynamics
Connecting NMR data to biomolecular structure and dynamics David A. Case Chem 538, Spring, 2014 Basics of NMR All nuclei are characterized by a spin quantum number I, which can be 0, 1/2, 1, 3/2, 2...
More informationHomology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationproteins Systematic solution to homo-oligomeric structures determined by NMR Jeffrey W. Martin, 1 Pei Zhou, 2 and Bruce R. Donald 1,2 * INTRODUCTION
proteins STRUCTURE O FUNCTION O BIOINFORMATICS Systematic solution to homo-oligomeric structures determined by NMR Jeffrey W. Martin, 1 Pei Zhou, 2 and Bruce R. Donald 1,2 * 1 Department of Computer Science,
More informationSupporting Information for: Antiparallel Coiled Coil Interactions Mediate Homodimerization of the. DNA Damage Repair Protein, PALB2
Biochemistry Supporting Information for: Antiparallel Coiled Coil Interactions Mediate Homodimerization of the DNA Damage Repair Protein, PALB2 Fei Song,, Minxing Li, Gaohua Liu,, G.V.T. Swapna,, Nourhan
More informationElectronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/309/5743/2054/dc1 Supporting Online Material for Structure of PTB Bound to RNA: Specific Binding and Implications for Splicing Regulation Florian C. Oberstrass, Sigrid
More informationHigh-Throughput 3D Homology Detection via NMR Resonance Assignment
High-Throughput 3D Homology Detection via NMR Resonance Assignment Christopher James Langmead Bruce Randall Donald,,, September 3, 2003 Abstract One goal of the structural genomics initiative is the identification
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationApril, The energy functions include:
REDUX A collection of Python scripts for torsion angle Monte Carlo protein molecular simulations and analysis The program is based on unified residue peptide model and is designed for more efficient exploration
More informationAutomated analysis of NMR assignments and structures for proteins Hunter NB Moseley* and Gaetano T Montelione
635 Automated analysis of NMR assignments and structures for proteins Hunter NB Moseley* and Gaetano T Montelione Recent developments in protein NMR technology have provided spectral data that are highly
More informationAdvances in the REDCAT Software Package
University of South Carolina Scholar Commons Faculty Publications Computer Science and Engineering, Department of 10-7-2013 Advances in the REDCAT Software Package Chris Schmidt Stephanie J. Irausquin
More informationApplications of the NOE in Molecular Biology
CHAPTER 3 Applications of the NOE in Molecular Biology Mike P. Williamson Contents 1. Introduction 78 2. The Basics 78 2.1. NOE theory 78 2.2. Macromolecular structure determination 83 2.3. Dynamics from
More informationAb initio molecular-replacement phasing for symmetric helical membrane proteins
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Editors: E. N. Baker and Z. Dauter Ab initio molecular-replacement phasing for symmetric helical membrane proteins Pavel Strop,
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationSupporting Information
Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationNature Structural & Molecular Biology: doi: /nsmb
Supplementary Table 1 Mean inclination angles a of wild-type and mutant K10 RNAs Base pair K10-wt K10-au-up K10-2gc-up K10-2gc-low K10-A-low 1-44 2.8 ± 0.7 4.8 ± 0.8 3.2 ± 0.6 4.3 ± 1.9 12.5 ± 0.4 2 43-2.5
More informationAn Improved Nuclear Vector Replacement Algorithm for Nuclear Magnetic Resonance Assignment
An Improved Nuclear Vector Replacement Algorithm for Nuclear Magnetic Resonance Assignment Christopher James Langmead Bruce Randall Donald,,,, September 3, 2003 Abstract We report an improvement to the
More informationresearch papers Development of a force field for conditional optimization of protein structures
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Development of a force field for conditional optimization of protein structures Sjors H. W. Scheres and Piet Gros* Department
More informationresearch papers Iterative-build OMIT maps: map improvement by iterative model building and refinement without model bias 1.
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Iterative-build OMIT maps: map improvement by iterative model building and refinement without model bias Thomas C. Terwilliger,
More informationProtein-protein interactions by NMR
Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off
More informationProtein NMR spectroscopy
Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding
More informationProcheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.
Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond
More informationComputer simulations of protein folding with a small number of distance restraints
Vol. 49 No. 3/2002 683 692 QUARTERLY Computer simulations of protein folding with a small number of distance restraints Andrzej Sikorski 1, Andrzej Kolinski 1,2 and Jeffrey Skolnick 2 1 Department of Chemistry,
More information