Supplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release
|
|
- Logan Stephens
- 5 years ago
- Views:
Transcription
1 Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section 1
2
3 Representative isothermal calorimetry data used to determine binding constants for the protein and peptide interactions discussed in the text. The interaction corresponding to each data set is noted on each figure. Data was acquired and analyzed as described in Experimental Procedures.
4 Section 2 Heteronuclear single quantum correlation (HSQC) spectra for (A) 15 N labeled RbC , (B) 15 N labeled E2F1 CM alone and (C) 15 N labeled E2F1 CM -unlabeled DP1 CM. The lack of 15 N and particularly 1 H chemical shift dispersion in (A) and (B) are consistent with polypeptides lacking significant structure (Dyson and Wright, 2004). The fact that the NMR data suggests that E2F1 CM is unstructured in the absence of DP1 CM is consistent with the structural and biochemical studies presented in this study, which indicate that the stability of E2F1 CM requires heterodimerization. Proteins were expressed and purified as described in Experimental Procedures except E2F and DP were expressed separately and E. coli were grown using M9 minimal media with 1 g/l 15 N ammonium chloride as the sole nitrogen source. HSQC spectra were acquired with a 600 MHz Varian spectrometer at 30 C using a gradient-enhanced pulse sequence (Kay et al., 1992). Samples consisted of mm protein in a buffer containing 50 mm sodium phosphate, 100 mm NaCl, 2 mm DTT, ph 6.1.
5 Section 3 Most of the intermolecular interactions in the coiled-coil involve non-interchangeable residues of E2F1 and DP1. In the canonical portion of the coiled coil, E2F residues 203 to 224 have a sequence reminiscent of the leucine zipper hydrophobic repeat, with leucine residues at the d position (Leu206, Leu213 and Leu220) and generally hydrophobic residues at the a position (Leu203, Leu210 and Glu217) (Lupas, 1996). By contrast, the sequence of DP1 is significantly different from that of a leucine zipper. The d position is occupied by Leu205, Arg212 and Lys219, and the a position has Cys202, Arg209 and Leu216. In addition, the acidic and basic residues that form stabilizing salt bridges are segregated to E2F1 and DP1 respectively (salt bridges between Asp209 (g), Glu217 (a), and Asp221 (e) of E2F1 and Arg209 (a), Arg215 (g), and Lys219 (d) of DP1). Section 4 Sequence alignment of p107 and p130 orthologs. The sequences used in the alignment are p107 human (hs), p107 mouse (mm), p107 chicken (gg), p130 human (hs), p130 mouse (mm), p130 rat (rn), p130 chicken (gg), and p130 fugu (fr). Conservation is indicated in cyan, and putative phosphorylation sites are also marked. The predicted secondary structure was determined using the PredictProtein Server and software therein (Rost et al., 2003). Section 5 The study of Dick et al. assayed for RbC binding in the presence of extracts from cells transfected with HA-E2F-DP (Dick and Dyson, 2003). It is thus conceivable that their E2F-DP or GST-RbC proteins might have been differentially phosphorylated or associated with endogenous factors that affected their ability to interact. It is also possible that the boundaries of the various protein fragments used contribute to the differences in the two studies. We note that the RbC Dick et al. used starts at residue 792 and is thus missing half of the RbC nter motif that is required for high affinity E2F-DP binding, although our data shows that the RbC core, which is intact in their experiments, has comparable affinity for both E2F1 and E2F4. Conversely, the E2F1(1-374) fragment used in the Dick et al. study contains ~74 additional residues C-terminal to the E2F1 CC-MB structure, which ends at residue 300, raising the possibility that the region contains a third Rb-binding element that is indeed unique to E2F1. In this respect, we note that this region has two evolutionarily conserved sequence blocks embedded in an otherwise low-complexity and lowconservation sequence. Section 6 E2F1 CM -DP1 CM -RbC crystals form in space group C222 1 with a = 146.8, b = 168.6, and c = 48.3 Å and contain one ternary complex in the asymmetric unit. The selenomethionine-substituted complex was expressed using an E. coli methionine auxotroph (B834[DE3] Novagen) in minimal media supplemented with 50 mg/l selenomethionine. Crystals were flash frozen in liquid nitrogen for data collection in crystallization buffer containing 25% v/v ethylene glycol. Multiwavelength anomalous diffraction (MAD) data sets were collected at the X4A beamline of the National Synchrotron Light Source (Brookhaven National Laboratories), and a final high-resolution native data set was collected at the ID-24 beamline of the Advance Photon Source (Argonne National Laboratories). Data were processed with DENZO and SCALEPACK (Otwinowski and Minor, 1997) and MAD phases were calculated at 3.0 Å using SHARP (Bricogne et al., 2003). The model was built with O (Jones et al., 1991) and refined with CNS (Brunger et al., 1998) and REFMAC using TLS refinement (CCP4, 1994).
6 Supplemental References CCP4 (Collaborative Computational Project 4). (1994). The CCP4 suite: programs for protein crystallography. Acta Cryst D 50, Bricogne, G., Vonrhein, C., Flensburg, C., Schiltz, M., and Paciorek, W. (2003). Generation, representation and flow of phase information in structure determination: recent developments in and around SHARP 2.0. Acta Cryst D 59. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J.-S., Kuszewski, J., Nilges, N., Pannu, N. S., et al. (1998). Crystallography and NMR system (CNS): A new software system for macromolecular structure determination. Acta Cryst, D 54. Dick, F. A., and Dyson, N. (2003). prb contains an E2F1-specific binding domain that allows E2F1-induced apoptosis to be regulated separately from other E2F activities. Mol Cell 12, Dyson, H. J., and Wright, P. E. (2004). Unfolded proteins and protein folding studied by NMR. Chem Rev 104, Jones, T. A., Zou, S. W., Cowan, S. W., and Kjeldgaard, M. (1991). Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystal D 54, Kay, L., Keifer, E. P., and Saarinen, T. (1992). Pure absorption gradient enhanced heteronuclear single quantum correlation spectroscopy with improved sensitivity. J Am Chem Soc 114. Lupas, A. (1996). Coiled coils: new structures and new functions. Trends Biochem Sci 21, Otwinowski, Z., and Minor, W. (1997). Processing of X-ray Diffraction Data Collected in Oscillation Model. In Methods in Enzymology, J. Carter, C.W., and R. M. Sweet, eds. (Academic Press), pp Rost, B., Yachdav, G., and Liu, J. (2003). The PredictProtein Server. Nuc Acids Res 32, W321-W326.
Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationSupporting Information
Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,
More informationtype GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
More informationSupporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study
Supporting Information Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Gabriel Birrane, Balaji Bhyravbhatla, and Manuel A. Navia METHODS Crystallization. Thermolysin (TLN) from Calbiochem
More informationStructure of a bacterial multi-drug ABC transporter
1 Structure of a bacterial multi-drug ABC transporter Roger J. P. Dawson and Kaspar P. Locher Institute of Molecular Biology and Biophysics, ETH Zurich, 8093 Zurich, Switzerland Supplementary Information
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More informationWeb-based Auto-Rickshaw for validation of the X-ray experiment at the synchrotron beamline
Web-based Auto-Rickshaw for validation of the X-ray experiment at the synchrotron beamline Auto-Rickshaw http://www.embl-hamburg.de/auto-rickshaw A platform for automated crystal structure determination
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationMarcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando, Susana M. Cerritelli, Robert J. Crouch, and Wei Yang
Molecular Cell, Volume 28 Supplemental Data Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription Marcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando,
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationPathogenic C9ORF72 Antisense Repeat RNA Forms a Double Helix with Tandem C:C Mismatches
Supporting Information Pathogenic C9ORF72 Antisense Repeat RNA Forms a Double Helix with Tandem C:C Mismatches David W. Dodd, Diana R. Tomchick, David R. Corey, and Keith T. Gagnon METHODS S1 RNA synthesis.
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationX-ray Crystallography. Kalyan Das
X-ray Crystallography Kalyan Das Electromagnetic Spectrum NMR 10 um - 10 mm 700 to 10 4 nm 400 to 700 nm 10 to 400 nm 10-1 to 10 nm 10-4 to 10-1 nm X-ray radiation was discovered by Roentgen in 1895. X-rays
More informationCrystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model.
I. Solving Phases II. Model Building for CHEM 645 Purified Protein Solve Phase Build model and refine Crystal lattice Real Space Reflections Reciprocal Space ρ (x, y, z) pronounced rho F hkl 2 I F (h,
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationSodium 3,5-dinitrobenzoate
metal-organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Helen P. Jones,* Amy L. Gillon and Roger J. Davey Colloids, Crystals and Interfaces Group, School of Chemical
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationSupplementary Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2017 Supplementary Information Probing the excited-state chemical shifts and exchange
More informationSupporting Information
Supporting Information The Mode of Action of Anticancer Gold-Based Drugs:a Structural Perspective Luigi Messori, Federica Scaletti, Lara Massai, Maria A. Cinellu, Chiara Gabbiani, Alessandro Vergara, and
More informationSUPPLEMENTARY INFORMATION
Structure of an ABC transporter-binding protein complex Kaspar Hollenstein, Dominik C. Frei, and Kaspar P. Locher Institute of Molecular Biology and Biophysics, ETH Zurich, 8093 Zurich, Switzerland Supplementary
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationStructural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More informationExam I Answer Key: Summer 2006, Semester C
1. Which of the following tripeptides would migrate most rapidly towards the negative electrode if electrophoresis is carried out at ph 3.0? a. gly-gly-gly b. glu-glu-asp c. lys-glu-lys d. val-asn-lys
More informationSupplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information Anion clamp allows flexible protein to impose coordination geometry on
More informationSupporting Information
Supporting Information Structural Analysis of the Binding of Type I, I 1/2, and II Inhibitors to Eph Tyrosine Kinases Jing Dong, *1 Hongtao Zhao, 1 Ting Zhou, 1 Dimitrios Spiliotopoulos, 1 Chitra Rajendran,
More informationSupporting Information. Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets
Supporting Information Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets Steven L. Swann, Danying Song, Chaohong Sun, Philip J. Hajduk, and Andrew M. Petros Global Pharmaceutical
More informationMavis Agbandje-McKenna, Robert McKenna* Department of Biochemistry and Molecular Biology and Department of
Ultra-High Resolution X-Ray Diffraction from Crystals of the Kinetic Mutant of Human Carbonic Anhydrase II, His 64 Ala, and its Complexes with Proton Acceptor/Donors. David Duda, Chingkuang Tu, David.
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationCrystal Structures of the Two Isomorphous A-DNA Decamers d(gtacgcgtac) and d(ggccgcggcc)
568 Bull. Korean Chem. Soc. 2006, Vol. 27, No. 4 Taegyun Kim et al. Crystal Structures of the Two Isomorphous A-DNA Decamers d(gtacgcgtac) and d(ggccgcggcc) Taegyun Kim, Taek Hun Kwon, Hyesun Jung, Ja
More informationStructural Basis for Methyl Transfer by a Radical SAM Enzyme
www.sciencemag.org/cgi/content/full/science.1205358/dc1 Supporting Online Material for Structural Basis for Methyl Transfer by a Radical SAM Enzyme Amie K. Boal, Tyler L. Grove, Monica I. McLaughlin, Neela
More informationSupporting Information
Supporting Information Horne et al. 10.1073/pnas.0902663106 SI Materials and Methods Peptide Synthesis. Protected 3 -amino acids were purchased from PepTech. Cyclically constrained -residues, Fmoc-ACPC
More informationelectronic reprint 3,5-Di-p-toluoyl-1,2-dideoxy-fi-1-(imidazol-1-yl)-D-ribofuranose Nicole Düpre, Wei-Zheng Shen, Pablo J. Sanz Miguel and Jens Müller
Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Editors: W. Clegg and D. G. Watson 3,5-Di-p-toluoyl-1,2-dideoxy-fi-1-(imidazol-1-yl)-D-ribofuranose Nicole Düpre, Wei-Zheng Shen,
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationNew Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition
Supporting Information New Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition Dustin T. King, Liam J. Worrall, Robert Gruninger, Natalie C.J. Strynadka* AUTHOR ADDRESS:
More informationWhere are the protons? Measuring and modelling proton equilibria in complex macromolecular systems.
Frans Mulder PhD course Jyväskylä 2017 Where are the protons? Measuring and modelling proton equilibria in complex macromolecular systems. Frans Mulder Lecture 3 Application of NMR spectroscopy to study
More informationDistinguishing Multiple Chemotaxis Y Protein Conformations with Laser-Polarized 129 Xe NMR
Distinguishing Multiple Chemotaxis Y Protein Conformations with Laser-Polarized 129 Xe NMR Thomas J. Lowery *, Michaeleen Doucleff *, E. Janette Ruiz *, Seth M. Rubin 1*, Alexander Pines *, David E. Wemmer
More informationresearch papers Single-wavelength anomalous diffraction phasing revisited 1. Introduction Luke M. Rice, a Thomas N. Earnest b and Axel T.
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Single-wavelength anomalous diffraction phasing revisited Luke M. Rice, a Thomas N. Earnest b and Axel T. Brunger c * a Department
More informationSupporting Information
Supporting Information Allosteric communication disrupted by small molecule binding to the Imidazole glycerol phosphate synthase protein-protein interface. Ivan Rivalta*,#, George P. Lisi #, Ning-Shiuan
More informationPROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationDetection and Characterization of Xenon-binding Sites in Proteins by 129 Xe NMR Spectroscopy
doi:10.1016/s0022-2836(02)00739-8 available online at http://www.idealibrary.com on Bw J. Mol. Biol. (2002) 322, 425 440 Detection and Characterization of Xenon-binding Sites in Proteins by Xe NMR Spectroscopy
More informationresearch papers Protein crystal structure solution by fast incorporation of negatively and positively charged anomalous scatterers
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Protein crystal structure solution by fast incorporation of negatively and positively charged anomalous scatterers Ronaldo A.
More informationMethyl acetoacetate at 150 K. The crystal structure of methyl acetoacetate, C 5 H 8 O 3, at 150 K contains discrete molecules.
organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Methyl acetoacetate at 150 K Howard A. Shallard-Brown,* David J. Watkin and Andrew R. Cowley Chemical Crystallography
More informationProtein crystallography. Garry Taylor
Protein crystallography Garry Taylor X-ray Crystallography - the Basics Grow crystals Collect X-ray data Determine phases Calculate ρ-map Interpret map Refine coordinates Do the biology. Nitrogen at -180
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More information4. The Michaelis-Menten combined rate constant Km, is defined for the following kinetic mechanism as k 1 k 2 E + S ES E + P k -1
Fall 2000 CH 595C Exam 1 Answer Key Multiple Choice 1. One of the reasons that enzymes are such efficient catalysts is that a) the energy level of the enzyme-transition state complex is much higher than
More informationSUPPLEMENTARY INFORMATION
doi: 10.108/nature0608 a c pmol L-[ H]Leu / mg LeuT pmol L-[ H]Leu / min / mg LeuT 900 50 600 450 00 150 200 150 100 0 0.0 2.5 5.0.5 10.0.5 50 N Cl CMI IMI DMI H C CH N N H C CH N Time (min) 0 0 100 200
More informationprotein structure communications Structure of Drosophila Mad MH2 domain 986 doi: /s Acta Cryst. (2008).
Acta Crystallographica Section F Structural Biology and Crystallization Communications ISSN 1744-3091 Structure of Drosophila Mad MH2 domain Rui Hao, a Lei Chen, b Jia-Wei Wu b and Zhi-Xin Wang a,b * a
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/318/5857/1744/dc1 Supporting Online Material for The Structure of a Human p110α/p85α Complex Elucidates the Effects of Oncogenic PI3Kα Mutations Chuan-Hsiang Huang,
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/310/5751/1159/dc1 Supporting Online Material for Structure of the Quaternary Complex of Interleukin-2 with Its α, β, and γ c Receptors Xinquan Wang, Mathias Rickert,
More information1228 Biophysical Journal Volume 84 February
1228 Biophysical Journal Volume 84 February 2003 1228 1237 The Refined Crystal Structure of an Eel Pout Type III Antifreeze Protein RD1 at 0.62-Å Resolution Reveals Structural Microheterogeneity of Protein
More informationBCH 4053 Exam I Review Spring 2017
BCH 4053 SI - Spring 2017 Reed BCH 4053 Exam I Review Spring 2017 Chapter 1 1. Calculate G for the reaction A + A P + Q. Assume the following equilibrium concentrations: [A] = 20mM, [Q] = [P] = 40fM. Assume
More informationStructurale, Université Grenoble Alpes, CNRS, CEA, Grenoble, France
Supplementary Information to Lysine relay mechanism coordinates intermediate transfer in vitamin B6 biosynthesis Matthew J. Rodrigues 1,2, Volker Windeisen 1,3, Yang Zhang 4, Gabriela Guédez 3, Stefan
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationNature Structural and Molecular Biology: doi: /nsmb.2783
Supplementary Figure 1: Crystallized chimera construct (mhv1cc). (a) Sequence alignment between mhv1cc and other VSDs. These sequences (mhv1cc, Kv1.2 Kv2.1; shaker family voltage gated potassium channel
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationorganic papers 2-[(Dimethylamino)(phenyl)methyl]benzoic acid
organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 2-[(Dimethylamino)(phenyl)methyl]benzoic acid Yvette L. Dann, Andrew R. Cowley and Harry L. Anderson* University
More informationFRAGMENT SCREENING IN LEAD DISCOVERY BY WEAK AFFINITY CHROMATOGRAPHY (WAC )
FRAGMENT SCREENING IN LEAD DISCOVERY BY WEAK AFFINITY CHROMATOGRAPHY (WAC ) SARomics Biostructures AB & Red Glead Discovery AB Medicon Village, Lund, Sweden Fragment-based lead discovery The basic idea:
More informationAccurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings
Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Jose Luis Ortega-Roldan, Malene Ringkjøbing Jensen*, Bernhard Brutscher, Ana I. Azuaga, Martin
More informationSynthesis and Diels Alder Reactivity of Substituted [4]Dendralenes. Table of Contents
Supporting Information for: Synthesis and Diels Alder Reactivity of Substituted [4]Dendralenes Mehmet F. Saglam, Ali R. Alborzi, Alan D. Payne, Anthony C. Willis,, Michael N. Paddon- Row and Michael S.
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationSupplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
More informationproteins Structural origins of ph-dependent chemical shifts in the B1 domain of protein G
proteins STRUCTURE O FUNCTION O BIOINFORMATICS Structural origins of ph-dependent chemical shifts in the B1 domain of protein G Jennifer H. Tomlinson, Victoria L. Green, Patrick J. Baker, and Mike P. Williamson*
More informationCentral Dogma. modifications genome transcriptome proteome
entral Dogma DA ma protein post-translational modifications genome transcriptome proteome 83 ierarchy of Protein Structure 20 Amino Acids There are 20 n possible sequences for a protein of n residues!
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1397 Crystal structures of Λ-[Ru(phen) 2 dppz] 2+ with oligonucleotides containing TA/TA and AT/AT steps show two intercalation modes Hakan Niyazi a, 1 James P. Hall a, Kyra O Sullivan
More informationCoordination Behaviour of Calcocene and its Use as a Synthon for Heteroleptic Organocalcium Compounds
Supporting Information Coordination Behaviour of Calcocene and its Use as a Synthon for Heteroleptic Organocalcium Compounds Reinald Fischer, Jens Langer, Sven Krieck, Helmar Görls, Matthias Westerhausen*
More informationViewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationThree-dimensional structure of a viral genome-delivery portal vertex
Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationCrystal structures of the DsbG disulfide isomerase reveal an unstable disulfide
Crystal structures of the DsbG disulfide isomerase reveal an unstable disulfide Begoña Heras*, Melissa A. Edeling*, Horst J. Schirra*, Satish Raina, and Jennifer L. Martin* *Institute for Molecular Bioscience
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationresearch papers Detecting outliers in non-redundant diffraction data 1. Introduction Randy J. Read
Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Detecting outliers in non-redundant diffraction data Randy J. Read Department of Haematology, University of Cambridge, Cambridge
More informationSupporting Information
Supporting Information Boehr et al. 10.1073/pnas.0914163107 SI Text Materials and Methods. R 2 relaxation dispersion experiments. 15 NR 2 relaxation dispersion data measured at 1 H Larmor frequencies of
More informationChristopher Pavlik Bioanalytical Chemistry March 2, 2011
Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces
More informationAuthor's personal copy
Methods 52 (2010) 168 172 Contents lists available at ScienceDirect Methods journal homepage: www. elsevier. com/ locate/ ymeth Review Article Solving novel RNA structures using only secondary structural
More informationorganic papers 2-Iodo-4-nitro-N-(trifluoroacetyl)aniline: sheets built from iodo nitro and nitro nitro interactions
organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 2-Iodo-4-nitro-N-(trifluoroacetyl)aniline: sheets built from iodo nitro and nitro nitro interactions Simon J. Garden,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
More informationStructural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
More informationLikelihood and SAD phasing in Phaser. R J Read, Department of Haematology Cambridge Institute for Medical Research
Likelihood and SAD phasing in Phaser R J Read, Department of Haematology Cambridge Institute for Medical Research Concept of likelihood Likelihood with dice 4 6 8 10 Roll a seven. Which die?? p(4)=p(6)=0
More informationBIOCHEMISTRY Course Outline (Fall, 2011)
BIOCHEMISTRY 402 - Course Outline (Fall, 2011) Number OVERVIEW OF LECTURE TOPICS: of Lectures INSTRUCTOR 1. Structural Components of Proteins G. Brayer (a) Amino Acids and the Polypeptide Chain Backbone...2
More informationLETTERS. Crystal structure of the heterotrimer core of Saccharomyces cerevisiae AMPK homologue SNF1
Vol 449 27 September 2007 doi:0.038/nature0627 LETTE rystal structure of the heterotrimer core of Saccharomyces cerevisiae K homologue SF Gabriele A. Amodeo *, Michael J. Rudolph * & Liang Tong -activated
More informationProtein Structures: Experiments and Modeling. Patrice Koehl
Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:
More informationAnion binding vs deprotonation in colorimetric pyrrolylamido(thio)urea based anion sensors
Anion binding vs deprotonation in colorimetric pyrrolylamido(thio)urea based anion sensors Louise S. Evans, ilip A. Gale *, Mark E. Light and Roberto Quesada * School of Chemistry, University of Southampton,
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationA rapid and rational approach to generating isomorphous heavy-atom phasing derivatives
REVIEW ARTICLE A rapid and rational approach to generating isomorphous heavy-atom phasing derivatives Jinghua Lu and Peter D. Sun Structural Immunology Section, Laboratory of Immunogenetics, National Institute
More informationSupporting Information
Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationSupporting Information
Supporting Information Design and Synthesis of Potent HIV-1 Protease Inhibitors Containing Bicyclic Oxazolidinone Scaffold as the P2-Ligands: Structure-Activity Studies, Biological and X-ray Structural
More informationProtein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013
Protein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013 The presentation is based on the presentation by Professor Alexander Dikiy, which is given in the course compedium:
More informationN-[(Diphenylamino)methyl]acetamide
Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Editors: W. Clegg and D. G. Watson N-[(Diphenylamino)methyl]acetamide Ganesan Venkatesa Prabhu, Nagarajan Vembu, Loganathan Muruganandam
More informationNature Structural & Molecular Biology: doi: /nsmb.3194
Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-
More informationBiochemistry Quiz Review 1I. 1. Of the 20 standard amino acids, only is not optically active. The reason is that its side chain.
Biochemistry Quiz Review 1I A general note: Short answer questions are just that, short. Writing a paragraph filled with every term you can remember from class won t improve your answer just answer clearly,
More information