Structural characterization of NiV N 0 P in solution and in crystal.
|
|
- Patience Neal
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1, 1.6 and 2.4 mg.ml -1 shows no evidence for aggregation or intermolecular interactions. The averaged intensity at zero angle corrected for protein concentration (I(0)/C) value of 46 ± 1 kda is in good agreement with the theoretical molecular mass of the heterodimeric complex (45,613 Da). (b) Superposition of the experimental SAXS curve in black (2.4 mg.ml -1 ) with the theoretical curve (in red) back calculated for the averaged ab initio bead model (20 independent models; normalized spatial discrepancy (NSD) < 1.0) generated with DAMMIN 28 and DAMAVER 29. (c) The heterodimeric N P 50 complex has a bean shape in solution. The ab initio bead model generated from SAXS data (in grey) accommodates a single N P 50 copy from the crystal. (d) Comparison of the 2D 1 H- 15 N heteronuclear single-quantum coherence (HSQC) NMR spectra of free P 100 (in red) and of P 100 bound to N (in blue). (e) Electrostatic surface potential of NiV and RSV N (PDB code 2WJ8; ref. 5) proteins at ± 5 kte -1 : blue (basic), white (neutral) and red (acidic). The hypothetical RNA binding
2 site is indicated in NiV N, and bound RNA in the RSV complex is shown in orange. (f) Western blot using inhouse henipavirus specific rabbit anti-n antibody with cell lysates from Nipah infected Vero E6 cells lysed 48h post-infection (NiV, left lane) compared to uninfected cells (NI, right lane). Theoretical molecular mass of the NiV N protein is 58,168 Da.
3 Supplementary Figure 2 NiV P 100 is globally disordered in solution but contains fluctuating α-helical elements. (a,b). Molecular size. The hydrodynamic radius of 2.6 ± 0.5 nm measured by SEC (a) and the radius of gyration of 3.1 ± 0.5 nm measured by SAXS (b) are larger than expected for a compact domain of this size. SAXS profiles were recorded at 0.3, 0.5 and 0.6 mg.ml -1. (c) NMR spectroscopy. The poor chemical shift dispersion of amide 1 H resonances in the heteronuclear single quantum coherence (HSQC) NMR spectrum (Supplementary Fig. 1d) is typical of disordered proteins. The secondary structure propensity (SSP) parameter calculated from C α and C β secondary chemical shifts indicates the presence of fluctuating helices (red boxes). The position of helices in the N-terminal region of P in the crystal structure of the N P 50 complex is shown below. (d) The N 0 -binding region of Paramyxovirinae P contains two conserved motifs (Soyuz1 and Soyuz2) 23. Conserved residues are colored according to their properties: acidic residues in violet, basic in red, hydrophobic in blue, polar in green and glycine in orange. G10 and I17 (larger letters) were mutated into arginine in order to destabilize the N 0 -P complex.
4 Supplementary Figure 3 The crystallographic asymmetric unit contains three copies of the N P50 complex. (a) Initial plate cluster used for microseeding. (b) Typical crystal obtained for the N P50 from microseeding and used for data collection. (c) Overall view of crystal packing of the N P50 complex. The three copies of the complex in the asymmetric unit are colored in blue and red. The packing shows no indication of specific oligomerization of N in the crystal. (d,e). Experimental selenium SAD phased density map of P50 (d) and N0 (e) in the N P50 complex. The final model after refinement is superposed on the map at contour level 1 σ. Only one N0-P copy from the asymmetric unit is represented. (f,g) Final 2Fo-Fc difference electron density map of P50 (f) and N0 (g) in the N P50 complex contoured at 1 σ. (h). Comparison of the different copies of the N P50 complex present in the asymmetric unit. Two copies are well defined in the SAD phased map, whereas NNTD of the third one is less densely packed in the crystal and the corresponding electron density is ill-defined. (i) Structural overlay of the three copies of N. Slightly different orientations of secondary structure elements in NNTD suggest that this region of the protein is dynamic, at least in the absence of RNA.
5
6 Supplementary Figure 4 Comparison of NNVs N 3D fold. (a) Conserved architecture of the N proteins: NiV, Nipah virus (Paramyxoviridae - Paramyxovirinae); RSV, respiratory syncytial virus (Paramyxoviridae - Pneumovirinae) (PDB code 2WJ8; ref 5); BDV, Borna disease virus (Bornaviridae) (PDB code 1N93; ref 19); VSV, vesicular stomatitis virus (Rhabdoviridae) (PDB code 2GIC; ref 7). Pairwise structural alignments led us to define four subdomains in the N core, namely N NTD1, N NTD2, N NTD3 and N CTD. The structures are similarly oriented and colored according to subdomains. VSV N contains an additional C-terminal subdomain (N CTD2 in purple) comprising three α-helices, which form the surface of binding of the C-terminal domain of P. (b-d). Superpositions of subdomains from the different proteins. The NiV N subdomains are shown in the same colors as in panel a and the corresponding subdomains from the other viruses are shown in grey: N NTD1 (b), N NTD3 (c) and N CTD (d). NNV N proteins differ mainly in the relative orientations of these three domains and the structure of the variable N NTD2 region. (e) Pairwise comparison of NiV N and human RSV N. Structure-based sequence alignment of NiV N (PDB code 4CO6) and RSV N (PDB code 2WJ8; ref 5). Secondary structure elements and residue numbering of NiV N are indicated above and secondary structure elements of RSV are indicated below.
7 Supplementary Figure 5 RNA grasp and hinge motions. (a) Normal mode analysis (NMA) and hypothetical hinge motion in NiV N. Elastic network NMA was carried out on the N 0 molecule to explore its motions 45. Representative models of the two lowest-frequency modes show motions of N NTD relative to N CTD with a hinge at the junction between the two domains (red circle) in agreement with a mechanism of closure of the RNA binding cavity. (b) The second lowest mode (mode 8) captures a rotation of N NTD, which agrees with the hypothetical closure of the protein around the RNA. The initial model (in grey) superposes with the crystal structure of NiV N 0 in blue. (c) After displacement along mode 8, the model (in wheat) superposes with RSV N structure taken from the N-RNA complex (in light blue). (d) Close-up of RSV N-RNA complex showing that helices α N6a and α N9 pack against the RNA molecule. G241 and G245 are shown in yellow. (e) Close-up of NiV N in the N 0 -P crystal structure (left panel) and in a hypothetical closed conformation (right panel). The RNA molecule (in grey) is positioned against N CTD as in RSV NC. Several residues of conserved motif 3 and conserved D 254 interfere with base 1 binding in the closed form.
8 Supplementary Table 1. Summary of conserved sequence motifs and their roles in the structure and function Motifs Residues Functional or structural roles Helix α N2 Hydrophobic core of NTD C-terminal of Helix α N5 (K178) Hydrophobic core of NTD ; Loop α N5/ α N6 RNA binding RNA binding and interaction (Arg192, Arg193, motif KYxQqxrx) Helix α N8 Hydrophobic packing against NTD core and with helix η C2 (Arg228) Helix α N9 Hinge region (Gly263) and RNA binding interaction (Tyr258) Helices α C1, η C1 and α C2 P binding Helix η C2 Interactions with helices α N8 and α N9 (contact between CTD and NTD) Loop η C2 /α C3 and helix α C3 Hydrophobic core of CTD Loop α C3 /α C4 RNA binding Helix α C3 Hydrophobic core of CTD and P binding
9 Supplementary Table 2. Summary of domain and subdomain localization in NiV N sequence Subdomains Residues NT ARM 1-45 N NTD N NTD N NTD N CTD CT ARM N TAIL
10
Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationSUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationSOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition SUPPLEMENTARY INFORMATION
SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition Nadia J. Kershaw 1,2, James M. Murphy 1,2, Nicholas P.D. Liau 1,2, Leila N. Varghese 1,2, Artem Laktyushin
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationSUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
More informationThe Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationStructure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
More informationImpact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
More informationSI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
More informationBacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
More informationPurification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples.
Supplementary Figure 1 Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. (a-b) SDS-PAGE analysis of the hexamer and heptamer samples. The eluted hexamer
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationProtein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
More informationRNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
More informationThree-dimensional structure of a viral genome-delivery portal vertex
Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationSupplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes
Supplementary Information The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Xuesong Shi, a Lin Huang, b David M. J. Lilley, b Pehr B. Harbury a,c and Daniel Herschlag
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationSupplementary information
Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar
More informationStructural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationNature Structural & Molecular Biology: doi: /nsmb.3194
Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-
More informationSupplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationPhysiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
More informationStructural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationSupplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary
More informationSupplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
More informationSUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
More informationHIV protease inhibitor. Certain level of function can be found without structure. But a structure is a key to understand the detailed mechanism.
Proteins are linear polypeptide chains (one or more) Building blocks: 20 types of amino acids. Range from a few 10s-1000s They fold into varying three-dimensional shapes structure medicine Certain level
More informationUse of SEC-MALS. (Size Exclusion Chromatography - Multi Angle. Light Scattering) for protein quality and characterization
Use of SEC-MALS (Size Exclusion Chromatography - Multi Angle Light Scattering) for protein quality and characterization Methods for protein characterization Analytical SEC is a common method to characterize
More informationCH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationSolutions and Non-Covalent Binding Forces
Chapter 3 Solutions and Non-Covalent Binding Forces 3.1 Solvent and solution properties Molecules stick together using the following forces: dipole-dipole, dipole-induced dipole, hydrogen bond, van der
More informationSUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationBM29 biosaxs data processing tutorial
HERCULES 2014 BM29 biosaxs data processing tutorial Page 2 OUTLINE Sample Changer Primary Data Processing Model Validation HPLC-SAXS Primary Data Processing Model Validation Ab Initio Model Software in
More informationDiphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
More informationNMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins
Elisar Barbar Department of Chemistry and Biochemistry, Ohio University, Athens, OH 45701 NMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins Abstract: Studies of
More informationCryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
More informationPotassium channel gating and structure!
Reading: Potassium channel gating and structure Hille (3rd ed.) chapts 10, 13, 17 Doyle et al. The Structure of the Potassium Channel: Molecular Basis of K1 Conduction and Selectivity. Science 280:70-77
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationNature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
More informationIntroduction to Computational Structural Biology
Introduction to Computational Structural Biology Part I 1. Introduction The disciplinary character of Computational Structural Biology The mathematical background required and the topics covered Bibliography
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationUsing Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell
Using Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell Mathematics and Biochemistry University of Wisconsin - Madison 0 There Are Many Kinds Of Proteins The word protein comes
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC
More informationExpanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
More informationStructure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein
Supporting information Volume 71 (2015) Supporting information for article: Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein Julian Kellner
More informationSupplementary material
Supplementary material Phosphorylation of the mitochondrial autophagy receptor Nix enhances its interaction with LC3 proteins Vladimir V. Rogov 1,*, Hironori Suzuki 2,3,*, Mija Marinković 4, Verena Lang
More informationSupplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two
Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for
More informationApo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor
Published as: Nat Struct Mol Biol. ; 18(10): 1172 1174. Apo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor Chun-Chi Lin 1,2, Kyuwon Baek 1,2, and Zhe Lu 1 1 Department
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationNature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
More informationDetails of Protein Structure
Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationThe Structure and Functions of Proteins
Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science and Engineering 2003 The Structure and Functions of Proteins Dan E. Krane Wright State University
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationViewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
More informationβ1 Structure Prediction and Validation
13 Chapter 2 β1 Structure Prediction and Validation 2.1 Overview Over several years, GPCR prediction methods in the Goddard lab have evolved to keep pace with the changing field of GPCR structure. Despite
More information