Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
|
|
|
- Phillip Fowler
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments. Input and eluted (His pull-down) samples were analyzed on 15% SDS-PAGE and Coomassie Blue staining.
2 Supplementary Figure 2 Experimental and anomalous electron density maps. A. Experimental electron density map (contour: 1σ) obtained by Se-MAD. The m 7 GDP molecule bound to Dcp2 active site is shown in red sticks. Color code is the same as for Fig.1A. B. Anomalous difference electron density map (contour: 4σ) calculated from the dataset collected at the energy corresponding to the peak of Se absorption spectra, showing the location of Se atoms from selenomethionines. The methionine side chains as built in the final model are shown as sticks, validating side chain assignment in our structure.
3 Supplementary Figure 3 m 7 GDP-binding site. A. The molecule bound to KlDcp1-Dcp2-Edc3 active site in the crystals is m 7 GDP. Several crystals were harvested and dissolved in water. Upon addition of nucleoside diphosphate kinase (NDPK) and ATP-ɣP 32 to dissolved crystals, the formation of m 7 GTP confirms the presence of m 7 GDP in the crystals (Lane 3). As negative and positive controls, NDPK and ATP-ɣP 32 were incubated with water (Lane 1) or m 7 GDP (Lane 2). The content of the reaction was analyzed by TLC and the nature of the m 7 GTP product was confirmed by migration in a different TLC buffer (data not shown). B. Alignment of Dcp2 sequences. For the sake of clarity, only Dcp2 regions corresponding to NRD and Nudix are shown. Strictly conserved residues are in white on a black background. Partially conserved residues are boxed. Residues involved in m 7 GDP binding are indicated by black stars below the alignment. Secondary structure elements as observed in our structure of KlDcp1-Dcp2-Edc3 and in SpDcp1-Dcp2 compact form (PDB code: 2QKM, chain B) are indicated. This panel was generated using the ESPript server (Robert, X. & Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res 42, W320, (2014)). C. Representation of the sequence conservation score at the surface of KlDcp1-Dcp2-Edc3 complex. The m 7 GDP is shown as red sticks. Coloring is from gray (low conservation) to cyan (highly conserved). D. Stereo view representation of m 7 GDP binding mode.
4 Supplementary Figure 4 Superimposition of Dcp2 and bound ligands with E. coli RppH and associated RNA. Superimposition of ligands bound to KlDcp1-Dcp2-Edc3, SpDcp1-Dcp2 and E. coli RppH. m 7 GDP bound to KlDcp1-Dcp2-Edc3 (grey), ATP bound to the compact form of SpDcp1-Dcp2 (yellow sticks ; She, M. et al. Structural basis of dcp2 recognition and activation by dcp1. Mol Cell 29, 337, (2008)) and RNA fragment bound to RppH (magenta ; Vasilyev, N. & Serganov, A. Structures of RNA complexes with the Escherichia coli RNA pyrophosphohydrolase RppH unveil the basis for specific 5'-end-dependent mrna decay. J Biol Chem 290, 9487, (2015)) are shown as sticks. This figure was generated by superimposing Nudix domains from our structure of KlDcp1-Dcp2-Edc3-m 7 GDP complex and from E. coli RppH onto the compact form of the SpDcp1-Dcp2 complex. SpDcp1-Dcp2 and E. coli RppH are not shown. For the sake of clarity, neither SpDcp1-Dcp2 nor E. coli RppH are shown as ribbons. SpY220 (KlF223 or ScY222), which stacks with adenine ring in SpDcp1-Dcp2 compact form, is shown as cyan sticks.
5 Supplementary Figure 5 KlDcp2-Edc3 interface. A. Sequence alignment of the Sp, Sc and KlDcp2 region involved in Edc3 binding. Strictly conserved residues are in white on a black background. Partially conserved residues are boxed. Residues involved in Edc3 binding are indicated by black stars below the
6 alignment. B. Sequence alignment of Sp, Sc and KlEdc3 LSm domain. Strictly conserved residues are in white on a black background. Partially conserved residues are boxed. Residues involved in Dcp2 binding are indicated by black stars below the alignment. Panels A and B were generated using the ESPript server. C. Detailed representation of KlDcp2-Edc3 interface. Some side chain residues from the interface are shown as sticks. D. Superimposition of SpDcp2-Edc3 complex determined by NMR (SpDcp2 and SpEdc3 LSm are in yellow and grey, respectively) onto KlDcp2-Edc3 as observed in our structure. Some side chain residues from both Dcp2 proteins are shown as sticks. E. Comparison of Edc3 LSm residues involved in Dcp2 binding. The superimposition shown in panel E is viewed from a different angle as panel D using the same color code. Some side chains from SpEdc3 and KlEdc3 involved in Dcp2 binding are shown as sticks.
7 Supplementary Figure 6 KlEdc3 LSm stimulates KlDcp1 Dcp2 enzymatic activity and RNA binding. A. Fluorescence quenching analyses of RNA binding to KlDcp1-Dcp2 or KlDcp1-Dcp2-Edc3. FAM-labeled RNA (10 nm) was incubated with increasing amount of purified recombinant complexes. The graph represents the difference in fluorescence ( F) between the free fluorescent RNA and the reaction mix as a function of complex concentration. The curves obtained after fitting of the experimental data with equation (A) from the materials and methods section, are shown as a solid line. Error bars were calculated from triplicate experiments. Kd values determined for KlDcp1-Dcp2 or KlDcp1-Dcp2-Edc3 complexes are 3.8 µm ± 0.4 and 1.9 µm ± 0.1, respectively. B. Specific activation of KlDcp1-Dcp2 by KlEdc3 LSm domain. 32 P cap-labeled RNA was incubated with equimolar amounts of KlDcp1- Dcp2, KlDcp1-Dcp2-Edc3 or KlDcp1-Dcp2 supplemented with BSA as a non-specific carrier. Left: Formation of m 7 GDP as a result of decapping was monitored after 0, 10, 30 and 90 minutes by TLC analysis and autoradiography. Right: Results of three biochemical reactions were quantified and the amount of m 7 GDP formation as a function of time and standard deviations from triplicate experiments were plotted.
8 Supplementary Figure 7 Model of Edc1 bound to the KlDcp1 Dcp2 Edc3 ternary complex. Model of Edc1 binding to Dcp1 in the KlDcp1-Dcp2-Edc3-m 7 GDP complex. This representation has been generated by superimposing the Dcp1 EVH1 domains from SpDcp1-Dcp2-Edc1 (Valkov, E. et al. Structure of the Dcp2-Dcp1 mrna-decapping complex in the activated conformation. Nature Structural & Molecular Biology 23, , (2016)) and KlDcp1-Dcp2-Edc3 structures. The SpEdc1 peptide is shown in magenta with the YAG conserved motif shown as sticks. For the sake of clarity, SpDcp1-Dcp2 complex as bound to SpEdc1 has been omitted in this representation.
9 Table S1: Rmsd values (Å) calculated between structures of K. lactis protein domains and those of corresponding domains from S. pombe and S. cerevisiae proteins. The PDB code used for structure comparison is indicated in brackets below the name of the domain. Sequence identity is indicated in bracket. SpDcp1 EVH1 (2QKM) ScDcp1 (1Q67) SpDcp2 NRD (2A6T) ScDcp2 Nudix (4KG3) SpDcp2 Nudix (2A6T) SpDcp1- Dcp2 NRD (5J3Y) SpEdc3 LSm (4A54) KlDcp1 EVH (27%) 1.37 (78%) KlDcp2 NRD 1.6 (43%) KlDcp2 Nudix 0.8 (64%) 1.2 (40%) KlDcp1- Dcp2 NRD 1.8 (30%) KlEdc3 LSm 1.6 (22%) 1
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples.
Supplementary Figure 1 Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. (a-b) SDS-PAGE analysis of the hexamer and heptamer samples. The eluted hexamer
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
The Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Cryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
SUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
SUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state
SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary
Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
SUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
Supplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release
Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section
Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
Supplementary Figure 1
Supplementary Figure 1 The correlation of n-score cutoff and FDR in both CID-only and CID-ETD fragmentation strategies. A bar diagram of different n-score thresholds applied in the search, plotted against
Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Information
Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
SUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
Supporting Information. UV-induced ligand exchange in MHC class I protein crystals
Supporting Information for the article entitled UV-induced ligand exchange in MHC class I protein crystals by Patrick H.N. Celie 1, Mireille Toebes 2, Boris Rodenko 3, Huib Ovaa 3, Anastassis Perrakis
Expanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
Supporting Information
Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Online Supplementary Material. Messenger RNA Interactions in the Decoding Center Control the Rate of Translocation
Online Supplementary Material Messenger RNA Interactions in the Decoding Center Control the Rate of Translocation Prashant K. Khade and Simpson Joseph Supplementary Figure 1 Dissociation of the f[ 35 S]Met-Phe-tRNA
Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase
SUPPLEMENTARY INFORMATION Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase Louise C Briggs, Geoff S Baldwin, Non Miyata, Hisao Kondo, Xiaodong Zhang, Paul S
Supplemental Materials and Methods
Supplemental Materials and Methods Time-resolved FRET (trfret) to probe for changes in the Box A/A stem upon complex assembly U3 MINI was folded and the decay of Fl fluorescence was measured at 20 ºC (see
Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
Three-dimensional structure of a viral genome-delivery portal vertex
Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500511/dc1 Supplementary Materials for Contractility parameters of human -cardiac myosin with the hypertrophic cardiomyopathy mutation R403Q show loss of
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Quantitation of the binding of pro53 peptide to sorla Vps10p measured by the AP reporter assay. The graph shows tracings of the typical chromogenic AP reaction observed with AP-pro53
Supplemental Information. Expanded Coverage of the 26S Proteasome. Conformational Landscape Reveals. Mechanisms of Peptidase Gating
Cell Reports, Volume 24 Supplemental Information Expanded Coverage of the 26S Proteasome Conformational Landscape Reveals Mechanisms of Peptidase Gating Markus R. Eisele, Randi G. Reed, Till Rudack, Andreas
type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
Supporting information
Supporting information Fluorescent derivatives of AC-42 to probe bitopic orthosteric/allosteric binding mechanisms on muscarinic M1 receptors Sandrine B. Daval, Céline Valant, Dominique Bonnet, Esther
Supplemental Methods. Protein expression and purification
Supplemental Methods Protein expression and purification The isolated collagen-binding domain of hlair-1, amino acid 22-122, was cloned into pet3xa using introduced BamHI and NotI sites at the 5 and 3
Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy),
Supporting Information 1. Constructing the starting structure Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), we find that: the RMSD of overall structure and
SUPPLEMENTARY INFORMATION
Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department
Supporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Comparing rotated- and nonrotated-state lifetimes among mrna m 6 A modifications in different codon contexts. a. mrna sequences used for each experiments, as same as shown in Figure
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
Tex 25mer ssrna Binding Stoichiometry
Figure S. Determination of Tex:2nt ssrna binding stoichiometry using fluorescence polarization. Fluorescein labeled RNA was held at a constant concentration 2-fold above the K d. Tex protein was titrated
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10162 Architecture of the Mediator Head module Tsuyoshi Imasaki, Guillermo Calero, Gang Cai, Kuang-Lei Tsai, Kentaro Yamada, Francesco Cardelli, Hediye Erdjument-Bromage, Paul Tempst,
Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
Structural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
Structural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
Supplementary Information for
Supplementary Information for Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains Hyoun Sook Kim
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
The structural basis of Edc3- and Scd6-mediated activation of the Dcp1:Dcp2 mrna decapping complex
The EMO Journal (2012) 31, 279 290 & 2012 European Molecular iology Organization ll Rights Reserved 0261-4189/12 www.embojournal.org The structural basis of - and Scd6-mediated activation of the Dcp1:
Hydrophobicity-Induced Prestaining for Protein Detection in Polyacrylamide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Hydrophobicity-Induced Prestaining for Protein Detection in Polyacrylamide Gel Electrophoresis
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10244 a O07391_MYCAV/127-243 NLPC_HAEIN/80-181 SPR_SHIFL/79-183 P74160_SYNY3/112-245 O24914_HELPY/301-437 Q51835_PORGI/68-178 DPP6_BACSH/163-263 YKFC_BACSU/185-292 YDHO_ECOLI/153-263
Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing
Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
Nature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
SUPPLEMENTARY FIGURES. Figure S1
SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue
Insights into pneumococcal fratricide from crystal structure of the modular killing factor LytC
Insights into pneumococcal fratricide from crystal structure of the modular killing factor LytC Inmaculada Pérez-Dorado, Ana González, María Morales, Reyes Sanles, Waldemar Striker, Waldemar Vollmer, Shahriar
Supplementary information
Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar
Trapped intermediates in crystals of the FMN-dependent oxidase PhzG provide insight into the final steps of phenazine biosynthesis
Supporting Materials: Trapped intermediates in crystals of the FMNdependent oxidase PhzG provide insight into the final steps of phenazine biosynthesis Ningna Xu ab, Ekta Gahanji Ahuja bc, Petra Janning