Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
|
|
|
- Mitchell Fox
- 5 years ago
- Views:
Transcription
1 Acta Cryst. (2015). D71, doi: /s Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent Josef Houser, Jan Komarek, Gianluca Cioci, Annabelle Varrot, Anne Imberty and Michaela Wimmerova
2 Figure S1 AFL binding sites. (A) The sequence of AFL six repetitions with indication of main secondary structure elements. Conserved amino acids directly involved in Fuc binding are highlighted by color box corresponding to panel B. (B) The six AFL binding sites of chain A of AFL/Fucα1-6GlcNAc complex. Fucosyl part of the Fucα1-6GlcNAc ligand shown in yellow. Colour code: cyan stacking residue Tyr/Trp, dark blue conserved Arg, orange conserved Glu/Gln, dark green H-bond-forming Trp, light green other residues forming H-bonds to the Fuc. Water molecule involved in sugar binding in site 4 shown as red sphere, residues coordinating this water molecule shown in white. Hydrogen bonds participating in the ligand binding shown as brown dashed lines. The rest of the protein shown as a cartoon. (C) The overview of main fucose-binding amino acids in AFL complexes.
3 Figure S2 Saccharides used in the structural study. (A) The monosaccharide units including the numbering of atoms. (B) The theoretical structures of di-, tri- and tetra- saccharides used for crystallization and structure analysis, based on Glycam - Carbohydrate builder (Woods group, ). Fucosyl residues are shown in yellow, other saccharide units in white.
4 Figure S3A SPR steady-state measurement of interaction between AFL and various ligands. The ligands in increasing concentrations were injected onto AFL-modified chip surface. Relative responses at steady state were plotted against concentration and data fitted by one-site (Fig. S3A) or two-site (Fig. S3B) binding model, respectively. Individual measurements in each panel are distinguished by color.
5 Figure S3B SPR steady-state measurement of interaction between AFL and various ligands. The ligands in increasing concentrations were injected onto AFL-modified chip surface. Relative responses at steady state were plotted against concentration and data fitted by one-site (Fig. S3A) or two-site (Fig. S3B) binding model, respectively. Individual measurements in each panel are distinguished by color.
6 Figure S4 Sequence alignment of AAL and AFL proteins. Residues on the dimer interface are boxed, residues forming intermonomeric hydrogen bonds are marked with full (AFL) or empty (AAL) stars.
7 Figure S5 Dimer formation of AFL and AAL. (A) Monomers are differently shifted with respect to each other in AFL and AAL dimer. (B) The contacting surface of both molecules in AFL and AAL dimers. The upper and lower molecule correspond to the upper and lower molecule in panel A. Differences in dimer formation are determined also by positive and negative side-chain organization (shown in blue and red, respectively). The interfacing parts of the monomer are framed.
8 Figure S6 AFL oligomeric state at various ph determined by AUC. Peaks are normalized to area. Dimer is stable at ph 4 (red line) and ph 7.4 (green line), at ph 10 (blue line), the peak of the monomer appears.
9 Figure S7A Binding sites of all AFL complexes analyzed. Assigned ligands are shown as sticks. In the sites with no ligand, the present water molecules are shown as spheres. Electron densities corresponding to ligands (2mFo- DFc map at σ = 1.0, 2.0 Å cut off) shown in blue. Positive residual electron densities shown in green (mfo-dfc map at σ = 3.0, 4 Å cut off) and negative in red (mfo-dfc map at σ = 3.0, 4 Å cut off). (A) AFL/L-Gal, (B) AFL/βMeFuc, (C) AFL/Fucα1-6GlcNAc and AFL/fucosylated disaccharide mixture, (D) AFL/BGA and AFL/Le Y.
10 Figure S7B Binding sites of all AFL complexes analyzed. Assigned ligands are shown as sticks. In the sites with no ligand, the present water molecules are shown as spheres. Electron densities corresponding to ligands (2mFo- DFc map at σ = 1.0, 2.0 Å cut off) shown in blue. Positive residual electron densities shown in green (mfo-dfc map at σ = 3.0, 4 Å cut off) and negative in red (mfo-dfc map at σ = 3.0, 4 Å cut off). (A) AFL/L-Gal, (B) AFL/βMeFuc, (C) AFL/Fucα1-6GlcNAc and AFL/fucosylated disaccharide mixture, (D) AFL/BGA and AFL/Le Y.
11 Figure S7C Binding sites of all AFL complexes analyzed. Assigned ligands are shown as sticks. In the sites with no ligand, the present water molecules are shown as spheres. Electron densities corresponding to ligands (2mFo- DFc map at σ = 1.0, 2.0 Å cut off) shown in blue. Positive residual electron densities shown in green (mfo-dfc map at σ = 3.0, 4 Å cut off) and negative in red (mfo-dfc map at σ = 3.0, 4 Å cut off). (A) AFL/L-Gal, (B) AFL/βMeFuc, (C) AFL/Fucα1-6GlcNAc and AFL/fucosylated disaccharide mixture, (D) AFL/BGA and AFL/Le Y.
12 Figure S7D Binding sites of all AFL complexes analyzed. Assigned ligands are shown as sticks. In the sites with no ligand, the present water molecules are shown as spheres. Electron densities corresponding to ligands (2mFo- DFc map at σ = 1.0, 2.0 Å cut off) shown in blue. Positive residual electron densities shown in green (mfo-dfc map at σ = 3.0, 4 Å cut off) and negative in red (mfo-dfc map at σ = 3.0, 4 Å cut off). (A) AFL/L-Gal, (B) AFL/βMeFuc, (C) AFL/Fucα1-6GlcNAc and AFL/fucosylated disaccharide mixture, (D) AFL/BGA and AFL/Le Y.
13 Figure S8 Comparison of AFL binding sites without any ligand with the AFL/MeSeFuc complex. Only residues within 4 Å distance from MeSeFuc are shown. Four chains of free AFL are colored from white to yellow, AFL/MeSeFuc chain A is shown in cyan. Side chains with major position change are labeled.
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
Acta Cryst. (2014). D70, doi: /s
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021166 Supporting information Volume 70 (2014) Supporting information for article: Elucidation of the bicarbonate binding site and insights into the carboxylation
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Supporting Information
Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
Model Worksheet Student Handout
Introduction Despite the complexity of life on Earth, the most important large molecules found in all living things (biomolecules) can be classified into only four main categories: carbohydrates, lipids,
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme
Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
Supplementary Information
1 Supplementary Information Figure S1 The V=0.5 Harker section of an anomalous difference Patterson map calculated using diffraction data from the NNQQNY crystal at 1.3 Å resolution. The position of the
Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
Bacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
Pymol Practial Guide
Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
NMR and Molecular Recognition of N-Glycans: Remote Modifications of the Saccharide Chain Modulate the Binding Features
NMR and Molecular Recognition of N-Glycans: Remote Modifications of the Saccharide Chain Modulate the Binding Features Ana Gimeno, [a] Niels-Christian Reichardt, [b] F. Javier Cañada, [c] Lukas Perkams,
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
Unit 5 Test. Name: Score: 37 / 37 points (100%)
Name: Score: 37 / 37 points (100%) Unit 5 Test Matching (1 point each) Match each item with the correct statement below a activity series j product b chemical equation k reactant c coefficient l reduction
FW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
Supplementary information
Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
Hydrogen-bonded structure and mechanical chiral response of a silver nanoparticle superlattice
Hydrogen-bonded structure and mechanical chiral response of a silver nanoparticle superlattice Bokwon Yoon 1, W. D. Luedtke 1, Robert N. Barnett 1, Jianping Gao 1, Anil Desireddy 2, Brian E. Conn 2, Terry
Supplementary Information
Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should
What are the building blocks of life?
Why? What are the building blocks of life? From the smallest single-celled organism to the tallest tree, all life depends on the properties and reactions of four classes of organic (carbon-based) compounds
SUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
Model Worksheet Teacher Key
Introduction Despite the complexity of life on Earth, the most important large molecules found in all living things (biomolecules) can be classified into only four main categories: carbohydrates, lipids,
Supporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
SUPPLEMENTARY INFORMATION
Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Supporting Information
Supporting Information Control of methylglyoxal synthesis in Bacillus subtilis: Structural basis for the regulatory interaction of the methylglyoxal synthase MgsA with the carbon flux regulator Crh Achim
Unit 1: Chemistry - Guided Notes
Scientific Method Notes: Unit 1: Chemistry - Guided Notes 1 Common Elements in Biology: Atoms are made up of: 1. 2. 3. In order to be stable, an atom of an element needs a full valence shell of electrons.
Supplementary Information
Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
IgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
Foundations in Microbiology Seventh Edition
Lecture PowerPoint to accompany Foundations in Microbiology Seventh Edition Talaro Chapter 2 The Chemistry of Biology Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
8.2 Photosynthesis Overview
8.2 Photosynthesis Overview Chlorophyll and Chloroplasts What role do pigments play in the process of photosynthesis? Photosynthetic organisms capture energy from sunlight with pigments. Light Energy from
NGF - twenty years a-growing
NGF - twenty years a-growing A molecule vital to brain growth It is twenty years since the structure of nerve growth factor (NGF) was determined [ref. 1]. This molecule is more than 'quite interesting'
Chapter 2: Chemistry. What does chemistry have to do with biology? Vocabulary BIO 105
Chapter 2: Chemistry What does chemistry have to do with biology? BIO 105 Vocabulary 1. Matter anything that takes up space and has mass Atoms are the smallest units of matter that can participate in chemical
Chemistry in Biology. Section 1. Atoms, Elements, and Compounds
Section 1 Atoms, Elements, and Compounds Atoms! Chemistry is the study of matter.! Atoms are the building blocks of matter.! Neutrons and protons are located at the center of the atom.! Protons are positively
ITC for Structural Glycosciences tools
ITC for Structural Glycosciences tools Anne Imberty 2nd Annual European MicroCal Mee Paris, 26 27 sept 2016 Glycoconjugates and diseases Congenital disorder «Congenital Disorders of Glycosylation» (CDG)
Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways
Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford
Understanding Chemistry in 3D
Contents 1 Understanding Chemistry in 3D 2 Organic Chemistry 2.1 So how do cells keep from falling apart in a water environment? 2.2 How are macromolecules assembled? 3 Where do we find macromolecules?
Chemistry Review. Structure of an Atom. The six most abundant elements of life. Types of chemical bonds. U n i t 2 - B i o c h e m i s t r y
Chemistry Review Structure of an Atom are organized into shells or levels around the nucleus. Atoms are most stable when their outer or valence shell is. The six most abundant elements of life Types of
Chapter 8: Photosynthesis
Name: KEY Class: Date Chapter 8: Photosynthesis Section 8-1 Energy and Life (pages 201-203) Autotrophs and Heterotrophs (page 201) 1. Where does the energy of food originally come from? The sun, plants
NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
Section III - Designing Models for 3D Printing
Section III - Designing Models for 3D Printing In this section of the Jmol Training Guide, you will become familiar with the commands needed to design a model that will be built on a 3D Printer. As you
Impact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
Carbohydrate- Protein interac;ons are Cri;cal in Life and Death. Other Cells. Hormones. Viruses. Toxins. Cell. Bacteria
ther Cells Carbohydrate- Protein interac;ons are Cri;cal in Life and Death ormones Viruses Toxins Cell Bacteria ow to Model Protein- ligand interac;ons? Protein Protein Protein DNA/RNA Protein Carbohydrate
PDBe TUTORIAL. PDBePISA (Protein Interfaces, Surfaces and Assemblies)
PDBe TUTORIAL PDBePISA (Protein Interfaces, Surfaces and Assemblies) http://pdbe.org/pisa/ This tutorial introduces the PDBePISA (PISA for short) service, which is a webbased interactive tool offered by
Sunhats for plants. How plants detect dangerous ultraviolet rays
Sunhats for plants How plants detect dangerous ultraviolet rays Anyone who has ever suffered sunburn will know about the effects of too much ultraviolet (UV) radiation, in particular UV-B (from 280-315
Chapter 6 Chemistry in Biology
Section 1: Atoms, Elements, and Compounds Section 2: Chemical Reactions Section 3: Water and Solutions Section 4: The Building Blocks of Life Click on a lesson name to select. 6.1 Atoms, Elements, and
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Get familiar with PDBsum and the PDB Extract atomic coordinates from protein data files Compute bond angles and dihedral angles
CS483 Assignment #2 Due date: Mar. 1 at the start of class. Protein Geometry Bedbug spit? Just say NO! Purpose of this assignment Get familiar with PDBsum and the PDB Extract atomic coordinates from protein
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon
Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery
Cryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
Building small molecules
Building small molecules Use the Builder (right panel) to build up molecules. Start building clicking a fragment/atom in the builder and it will appear to the workspace. Continue modifying the molecule
RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
Chapter 1 Annotating Outline Honors Biology
Chapter 1 Annotating Outline Honors Biology Name: Pd: As you read the textbook, paragraph by paragraph, please annotate in the spaces below. You ll have to answer related questions as you read as well.
PENNSYLVANIA. Explain the nature of the carbon atom and how organic molecules are important to organisms. Page 1 of B.A7.
Know: Understand: Do: S11.C.1.1.1 -- Essential Explain that matter is made of particles called atoms and that atoms are composed of even smaller particles (e.g., proton, neutrons, electrons). S11.C.1.1.2
Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6
Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
Part 8 Working with Nucleic Acids
Part 8 Working with Nucleic Acids http://cbm.msoe.edu/newwebsite/learntomodel Introduction Most Protein Databank files loaded into the CBM's Jmol Design Environment include protein structures and small
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
Bonds and Structural Supports
Bonds and Structural Supports Part of the Jmol Training Guide from the MSOE Center for BioMolecular Modeling Interactive version available at http://cbm.msoe.edu/teachingresources/jmol/jmoltraining/struts.html
Let s continue our discussion on the interaction between Fe(III) and 6,7-dihydroxynaphthalene-2- sulfonate.
Chemistry 5995(133)-8990(013) Bioinorganic Chemistry: The Good, the Bad, and the Potential of Metals Assignment 2- Aqueous Speciation, Magnetism, Redox, UV-Vis Spectroscopy, and Pymol Let s continue our
Lesson Overview. 8.2 Photosynthesis: An Overview
8.2 Photosynthesis: An Overview Light Energy from the sun travels to Earth in the form of light. Sunlight is a mixture of different wavelengths Light Our eyes see the different wavelengths of the visible
Plasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti
Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA 2-190 with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h
Supporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,