Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems?

Size: px
Start display at page:

Download "Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems?"

Transcription

1 Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems? Muscarella M.E. & Lennon J.T. Department of Biology, Indiana University, USA Join the conversation tag our talk about me

2 Acknowledgements

3 BGE in Aquatic Ecosystems del Giorgio & Cole., 1998 (Annu. Rev. Ecol. Syst)

4 What differs across these habitats? Microbial Communities Alex et al., 2011 (PNAS)

5 What differs across these habitats? Microbial Communities Resources N C P Alex et al., 2011 (PNAS)

6 What differs across these habitats? Microbial Communities Resources (Chemo Diversity) Alex et al., 2011 (PNAS) FT IRC Mass Spec Lechtenfeld et al., 2011 (Nat Comm.)

7 Do Resources Alter BGE? Changes in phosphorus resources alter BGE Growth efficiency increases for all samples Changes in organic matter concentrations alter BGE Muscarella et al., 2014 (AME) Lennon et al., 2013 (PLOS ONE) Growth efficiency decreases with DOC

8 However, Communities Change If we experimentally change resources, we alter microbial diversity!

9 How do we move forward? del Giorgio & Cole., 1998 (Annu. Rev. Ecol. Syst)

10 Traits Based Approaches What are the patterns in BGE and other physiological traits across the microbial tree of life? How do these traits differ with based on resource identity?

11 The HMWF Culture Collection In this talk: 3 Alphaproteobacteria 3 Betaproteobacteria 17 Gammaproteobacteria 3 Xanthomonadales 5 Aeromondales 9 Pseudomodales

12 Resources & Physiological Traits Glucose Succinate Protocatechuate

13 Experimental Outline 1. Measure resource specific physiology on each resource a) Bacterial Respiration b) Bacterial Production c) Bacterial Growth Efficiency 2. Test for phylogenetic signal for each trait 3. Partition variance in BGE between species taxonomy and resource identity

14 Consumer Traits: Random Example Phylogenetic Signal Blomberg s K K = 1: Brownian Motion K < 1: Overdispersed K > 1: Clustered Example Data: K = <0.001 P = 0.034

15 Example Predictions Taxonomy Dominates Resource Identity Dominates

16 Bacterial Respiration

17 Bacterial Respiration: No Signal Glucose Succinate Protocatechuate K <0.001 < P NS NS NS Phylogenetic Signal Blomberg s K K = 1: Brownian Motion K < 1: Overdispersed K > 1: Clustered

18 Bacterial Production

19 Bacterial Production: No Signal Glucose Succinate Protocatechuate K <0.001 <0.001 <0.001 P NS NS NS Phylogenetic Signal Blomberg s K K = 1: Brownian Motion K < 1: Overdispersed K > 1: Clustered

20 Bacterial Growth Efficiency

21 BGE: No Signal Glucose Succinate Protocatechuate K < P NS NS NS Phylogenetic Signal Blomberg s K K = 1: Brownian Motion K < 1: Overdispersed K > 1: Clustered

22 So what is going on? It appears that certain taxa are more efficient regardless of resource However, some groups have taxa with drastically different efficiencies In general, efficiency seems to decline with resource complexity

23 Taxonomy vs. Resource Model R 2 AIC BGE ~ Taxonomy (Subphylum) BGE ~ Taxonomy (Class) BGE ~ Resource BGE ~ Taxonomy + Resource

24 Taxonomy vs. Resource Model R 2 AIC BGE ~ Taxonomy (Subphylum) BGE ~ Taxonomy (Class) BGE ~ Resource BGE ~ Taxonomy + Resource

25 The Next Steps Lots of unexplained variation! 1. Measuring strain specific parameters such as protein content and leucine corrections 2. Measuring basal metabolic rate 3. Measuring BGE across resource concentrations 4. Measuring BGE in other phyla of bacteria

26 Take Home Messages There is large variation in respiration, production, and efficiency across the microbial tree of life Though we have yet to detect a phylogenetic signal, there appears to be patterns that warrant further exploration Taking both taxonomy and resource identity into account, we can explain a portion of the variation in growth efficiency

27 Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems? Muscarella M.E. & Lennon J.T. Department of Biology, Indiana University, USA Join the conversation tag our talk about me

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity?

Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity? Species Divergence and the Measurement of Microbial Diversity Cathy Lozupone University of Colorado, Boulder. Washington University, St Louis. Outline Classes of diversity measures α vs β diversity Quantitative

More information

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; fast- clock molecules for fine-structure. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University

Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires

More information

Evolution in Action: The Power of Mutation in E. coli

Evolution in Action: The Power of Mutation in E. coli Evolution in Action: The Power of Mutation in E. coli by Merle K. Heidemann, College of Natural Science, Emeritus Peter J. T. White, Lyman Briggs College James J. Smith, Lyman Briggs College Michigan State

More information

Istituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program.

Istituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program. Istituto di Microbiologia Università Cattolica del Sacro Cuore, Roma Gut Microbiota assessment and the Meta-HIT program Giovanni Delogu 1 Most of the bacteria species living in the gut cannot be cultivated

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure

More information

BIOLOGY STANDARDS BASED RUBRIC

BIOLOGY STANDARDS BASED RUBRIC BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:

More information

Evolutionary Physiology

Evolutionary Physiology Evolutionary Physiology Yves Desdevises Observatoire Océanologique de Banyuls 04 68 88 73 13 desdevises@obs-banyuls.fr http://desdevises.free.fr 1 2 Physiology Physiology: how organisms work Lot of diversity

More information

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

FIG S1: Rarefaction analysis of observed richness within Drosophila. All calculations were

FIG S1: Rarefaction analysis of observed richness within Drosophila. All calculations were Page 1 of 14 FIG S1: Rarefaction analysis of observed richness within Drosophila. All calculations were performed using mothur (2). OTUs were defined at the 3% divergence threshold using the average neighbor

More information

Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -

Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information - Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a

More information

"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200 Spring 2014 University of California, Berkeley

PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION Integrative Biology 200 Spring 2014 University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200 Spring 2014 University of California, Berkeley D.D. Ackerly April 16, 2014. Community Ecology and Phylogenetics Readings: Cavender-Bares,

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Metabolic diversity is based on the Electron donors, acceptors, and carbon sources available - thermodynamics

Metabolic diversity is based on the Electron donors, acceptors, and carbon sources available - thermodynamics To date you have covered microbial community sampling using molecular techniques to identify who is present in the environment. You have also looked at various genetic mechanisms to understand how organisms

More information

Diversity, Productivity and Stability of an Industrial Microbial Ecosystem

Diversity, Productivity and Stability of an Industrial Microbial Ecosystem Diversity, Productivity and Stability of an Industrial Microbial Ecosystem Doruk Beyter 1, Pei-Zhong Tang 2, Scott Becker 2, Tony Hoang 3, Damla Bilgin 3, Yan Wei Lim 4, Todd C. Peterson 2, Stephen Mayfield

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change

More information

Lecture 2 Carbon and Energy Transformations

Lecture 2 Carbon and Energy Transformations 1.018/7.30J Fall 2003 Fundamentals of Ecology Lecture 2 Carbon and Energy Transformations READINGS FOR NEXT LECTURE: Krebs Chapter 25: Ecosystem Metabolism I: Primary Productivity Luria. 1975. Overview

More information

Advanced Placement Biology

Advanced Placement Biology Advanced Placement Biology 2014-2015 Course Description This course is designed to be equivalent to a two-semester college introductory biology course sequence. AP Biology covers topics regularly covered

More information

Chad Burrus April 6, 2010

Chad Burrus April 6, 2010 Chad Burrus April 6, 2010 1 Background What is UniFrac? Materials and Methods Results Discussion Questions 2 The vast majority of microbes cannot be cultured with current methods Only half (26) out of

More information

Michigan Curriculum Framework

Michigan Curriculum Framework Elementary Reference Content Standards Wetlands (with teacher Rainforest (with teacher 1. All students will apply an understanding of cells to the functioning of multicellular organisms; and explain how

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical

More information

7.014 Quiz III Handout

7.014 Quiz III Handout 7.014 Quiz III Handout Quiz III: Wednesday, April 14 12:05-12:55 Walker Gym **This will be a closed book exam** Quiz Review Session: Tuesday, April 13 7:00-9:00 pm room 54-100 Open Tutoring Session: Monday,

More information

The Characteristics of Life. AP Biology Notes: #1

The Characteristics of Life. AP Biology Notes: #1 The Characteristics of Life AP Biology Notes: #1 Life s Diversity & Unity Life has extensive diversity. Despite its diversity, all living things are composed of the same chemical elements that make-up

More information

Infochemical mediation of the degradation of sinking particulate organic matter.

Infochemical mediation of the degradation of sinking particulate organic matter. Infochemical mediation of the degradation of sinking particulate organic matter. Benjamin Van Mooy Department of Marine Chemistry and Geochemistry Woods Hole Oceanographic Institution Acknowledgements:

More information

PACING GUIDE ADVANCED PLACEMENT BIOLOGY

PACING GUIDE ADVANCED PLACEMENT BIOLOGY PACING GUIDE ADVANCED PLACEMENT BIOLOGY BIG IDEAS: 1: The process of evolution drives the diversity and unity of life. 2: Biological systems utilize free energy and molecular building blocks to grow, to

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

below was exposed to light for several hours.

below was exposed to light for several hours. Which process provides the initial energy to support all the levels in the energy pyramid shown below? D C (1) circulation (3) active transport (2) photosynthesis (4) digestion The green diagram aquatic

More information

Microbiome: 16S rrna Sequencing 3/30/2018

Microbiome: 16S rrna Sequencing 3/30/2018 Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics

More information

Microbiology Helmut Pospiech

Microbiology Helmut Pospiech Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition

More information

7.014 Lecture 17: Carbon and Energy Metabolism

7.014 Lecture 17: Carbon and Energy Metabolism MIT Department of Biology 7.014 Introductory Biology, Spring 2005 7.014 Lecture 17: Carbon and Energy Metabolism March 14, 2005 Summary of the options for Life (the simplified view see also Freeman Ch

More information

About me (why am I giving this talk) Dr. Bruce A. Snyder

About me (why am I giving this talk) Dr. Bruce A. Snyder Ecology About me (why am I giving this talk) Dr. Bruce A. Snyder basnyder@ksu.edu PhD: Ecology (University of Georgia) MS: Environmental Science & Policy BS: Biology; Environmental Science (University

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Prereq: Concurrent 3 CH

Prereq: Concurrent 3 CH 0201107 0201101 General Biology (1) General Biology (1) is an introductory course which covers the basics of cell biology in a traditional order, from the structure and function of molecules to the structure

More information

Comparing Prokaryotic and Eukaryotic Cells

Comparing Prokaryotic and Eukaryotic Cells A prokaryotic cell Basic unit of living organisms is the cell; the smallest unit capable of life. Features found in all cells: Ribosomes Cell Membrane Genetic Material Cytoplasm ATP Energy External Stimuli

More information

FINAL VERSION_ Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea

FINAL VERSION_ Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea LS1: From Molecules to Organisms: Structures and Processes LS1.A: Structure and Function How do the structures

More information

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,

More information

Interactions among Land, Water, and Vegetation in Shoreline Arthropod Communities

Interactions among Land, Water, and Vegetation in Shoreline Arthropod Communities AMERICAN JOURNAL OF UNDERGRADUATE RESEARCH VOL., NO.. () Interactions among Land, Water, and Vegetation in Shoreline Arthropod Communities Randall D. Willoughby and Wendy B. Anderson Department of Biology

More information

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek

More information

Antagonistic and Synergistic Interactions Among Predators

Antagonistic and Synergistic Interactions Among Predators Bulletin of Mathematical Biology 2007 69: 2093 2104 DOI 10.1007/s11538-007-9214-0 ORIGINAL ARTICLE Antagonistic and Synergistic Interactions Among Predators Gary R. Huxel Department of Biological Sciences,

More information

BRIEF COMMUNICATIONS

BRIEF COMMUNICATIONS Evolution, 59(12), 2005, pp. 2705 2710 BRIEF COMMUNICATIONS THE EFFECT OF INTRASPECIFIC SAMPLE SIZE ON TYPE I AND TYPE II ERROR RATES IN COMPARATIVE STUDIES LUKE J. HARMON 1 AND JONATHAN B. LOSOS Department

More information

Evolution and Diversification of Life

Evolution and Diversification of Life Evolution and Diversification of Life Frogfish OCN 201 Science of the Sea Biology Lecture 2 Grieg Steward (Oceanography) Office: CMORE Hale 121 Phone: x6-6775 Evolution Nothing in biology makes sense except

More information

Biol 1409: Study Guide for Exam I. Introduction to Diversity

Biol 1409: Study Guide for Exam I. Introduction to Diversity Biol 1409: Study Guide for Exam I Introduction to Diversity 1. Define Biosphere and describe where it is found 2. Describe why our planet is so hospitable to life 3. Name and briefly describe the major

More information

AP Biology. Sample Student Responses and Scoring Commentary. Inside: Free Response Question 5. Scoring Guideline. Student Samples. Scoring Commentary

AP Biology. Sample Student Responses and Scoring Commentary. Inside: Free Response Question 5. Scoring Guideline. Student Samples. Scoring Commentary 2017 AP Biology Sample Student Responses and Scoring Commentary Inside: Free Response Question 5 Scoring Guideline Student Samples Scoring Commentary 2017 The College Board. College Board, Advanced Placement

More information

Life Requires FREE ENERGY!

Life Requires FREE ENERGY! Life Requires FREE ENERGY! Ok, so Growth, reproduction and homeostasis of living systems requires free energy To be alive/stay living, you need to use energy. Duh But really, why is energy so important?

More information

Models of Continuous Trait Evolution

Models of Continuous Trait Evolution Models of Continuous Trait Evolution By Ricardo Betancur (slides courtesy of Graham Slater, J. Arbour, L. Harmon & M. Alfaro) How fast do animals evolve? C. Darwin G. Simpson J. Haldane How do we model

More information

Lowndes County Biology II Pacing Guide Approximate

Lowndes County Biology II Pacing Guide Approximate Lowndes County Biology II Pacing Guide 2009-2010 MS Frameworks Pacing Guide Worksheet Grade Level: Biology II Grading Period: 1 st 9 weeks Chapter/Unit Lesson Topic Objective Number 1 The Process of 1.

More information

AP Biology Essential Knowledge Cards BIG IDEA 1

AP Biology Essential Knowledge Cards BIG IDEA 1 AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific

More information

ADVANCED PLACEMENT BIOLOGY

ADVANCED PLACEMENT BIOLOGY ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week

More information

Bi 8 Lecture 11. Quantitative aspects of transcription factor binding and gene regulatory circuit design. Ellen Rothenberg 9 February 2016

Bi 8 Lecture 11. Quantitative aspects of transcription factor binding and gene regulatory circuit design. Ellen Rothenberg 9 February 2016 Bi 8 Lecture 11 Quantitative aspects of transcription factor binding and gene regulatory circuit design Ellen Rothenberg 9 February 2016 Major take-home messages from λ phage system that apply to many

More information

Range of Competencies

Range of Competencies BIOLOGY Content Domain Range of Competencies l. Nature of Science 0001 0003 20% ll. Biochemistry and Cell Biology 0004 0005 13% lll. Genetics and Evolution 0006 0009 27% lv. Biological Unity and Diversity

More information

Grade Level: AP Biology may be taken in grades 11 or 12.

Grade Level: AP Biology may be taken in grades 11 or 12. ADVANCEMENT PLACEMENT BIOLOGY COURSE SYLLABUS MRS. ANGELA FARRONATO Grade Level: AP Biology may be taken in grades 11 or 12. Course Overview: This course is designed to cover all of the material included

More information

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu Microbiota and man: the story about us Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities

More information

Georgia Performance Standards for Urban Watch Restoration Field Trips

Georgia Performance Standards for Urban Watch Restoration Field Trips Georgia Performance Standards for Field Trips 6 th grade S6E3. Students will recognize the significant role of water in earth processes. a. Explain that a large portion of the Earth s surface is water,

More information

Press Release BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION

Press Release BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION Press Release 12 172 BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION Genomic analysis of E. coli shows multiple steps to evolve new trait View Video Postdoc researcher Zachary Blount discusses discovering

More information

Biology 160 Cell Lab. Name Lab Section: 1:00pm 3:00 pm. Student Learning Outcomes:

Biology 160 Cell Lab. Name Lab Section: 1:00pm 3:00 pm. Student Learning Outcomes: Biology 160 Cell Lab Name Lab Section: 1:00pm 3:00 pm Student Learning Outcomes: Upon completion of today s lab you will be able to do the following: Properly use a compound light microscope Discuss the

More information

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of

More information

Study of Biology. copyright cmassengale

Study of Biology. copyright cmassengale Study of Biology 1 What is Biology? Biology is the study of all living things Living things are called organisms Organisms include bacteria, protists, fungi, plants, & animals 2 All Living Things Share

More information

Biological Networks. Gavin Conant 163B ASRC

Biological Networks. Gavin Conant 163B ASRC Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme

More information

Role of mycorrhizal fungi in belowground C and N cycling

Role of mycorrhizal fungi in belowground C and N cycling Role of mycorrhizal fungi in belowground C and N cycling Doc. Jussi Heinonsalo Department of Forest Sciences, University of Helsinki Finnish Meteorological Institute Finland The aim and learning goals

More information

BIOL 101 Introduction to Biological Research Techniques I

BIOL 101 Introduction to Biological Research Techniques I BIOL 101 Introduction to Biological Research Techniques I 1. Develop a research plan including hypothesis, controls and procedures. 2. Conduct a primary literature review relating to their research project.

More information

Goal 1: Develop knowledge and understanding of core content in biology

Goal 1: Develop knowledge and understanding of core content in biology Indiana State University» College of Arts & Sciences» Biology BA/BS in Biology Standing Requirements s Library Goal 1: Develop knowledge and understanding of core content in biology 1: Illustrate and examine

More information

Announcements KEY CONCEPTS

Announcements KEY CONCEPTS What do these things have in common? Announcements Lab this week: bring textbook and photo atlas. Relevant reading BEFORE lab: Ch. 30 http://i.cnn.net/cnn/specials/2001/trade.center/images/anthrax.jpg

More information

BIO 111: Biological Diversity and Evolution

BIO 111: Biological Diversity and Evolution BIO 111: Biological Diversity and Evolution Varsha 2017 Ullasa Kodandaramaiah & Hema Somanathan School of Biology MODULE: BIODIVERSITY AND CONSERVATION BIOLOGY Part I - FUNDAMENTAL CONCEPTS OF BIODIVERSITY

More information

Short overview on microbial ecology of the vineyards

Short overview on microbial ecology of the vineyards Short overview on microbial ecology of the vineyards Stéphane Compant Center for Health & Bioresources, AIT Austrian Institute of Technology GmbH, 3430 Tulln, Austria Stephane.Compant@ait.ac.at Summary

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

A Correlation of. To the. New York High School Standards Life Science

A Correlation of. To the. New York High School Standards Life Science A Correlation of 2017 To the New York High School Standards Life Science 9 12 High School Life Science (HS.SF) Structure and Function A Correlation of Miller & Levine Biology, 2017 to the (HS LS1 1) Construct

More information

Phys 214. Planets and Life

Phys 214. Planets and Life Phys 214. Planets and Life Dr. Cristina Buzea Department of Physics Room 259 E-mail: cristi@physics.queensu.ca (Please use PHYS214 in e-mail subject) Lecture 16. Phylogenetic tree. Metabolism. Carbon and

More information

Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article

Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article Unit Subtopics and Duration Unit 1: Principles of Science Themes in science Research and Lab techniques 6 days Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell

More information

Biology Unit Overview and Pacing Guide

Biology Unit Overview and Pacing Guide This document provides teachers with an overview of each unit in the Biology curriculum. The Curriculum Engine provides additional information including knowledge and performance learning targets, key

More information

A Brief Survey of Life s Diversity 1

A Brief Survey of Life s Diversity 1 Name A Brief Survey of Life s Diversity 1 AP WINTER BREAK ASSIGNMENT (CH 25-34). Complete the questions using the chapters of your textbook Campbell s Biology (8 th edition). CHAPTER 25: The History of

More information

Outline. Classification of Living Things

Outline. Classification of Living Things Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics

More information

Ch20_Ecology, community & ecosystems

Ch20_Ecology, community & ecosystems Community Ecology Populations of different species living in the same place NICHE The sum of all the different use of abiotic resources in the habitat by s given species what the organism does what is

More information

Microbes and mountains: metagenetics on Mount Fuji, Japan. Jonathan Adams, Biology Department, SNU, Korea

Microbes and mountains: metagenetics on Mount Fuji, Japan. Jonathan Adams, Biology Department, SNU, Korea Microbes and mountains: metagenetics on Mount Fuji, Japan Jonathan Adams, Biology Department, SNU, Korea jonadams@snu.ac.kr Until about a decade ago, culturing could only yield 8,000 described species

More information

Characteristics of Life

Characteristics of Life Characteristics of Life All living things share some basic characteristics: 1. Organization 2. Movement 3. Made up of cells 4. Reproduce 5. Grow and / or develop 6. Obtain and use energy 7. Respond to

More information

Potential of metatranscriptomics as indicator for ecosystem level diversity and function. diversitv Prof. Dr. Jens Boenigk. Department.

Potential of metatranscriptomics as indicator for ecosystem level diversity and function. diversitv Prof. Dr. Jens Boenigk. Department. Department Bio diversitv Prof. Dr. Jens Boenigk From traditional bioindication......via metabarcoding & molecular diversity......to monitoring functional genes From traditional bioindication......via metabarcoding

More information

Ecology Review. 1. Fly larvae consume the body of a dead rabbit. In this activity, they function as

Ecology Review. 1. Fly larvae consume the body of a dead rabbit. In this activity, they function as Name: ate: 1. Fly larvae consume the body of a dead rabbit. In this activity, they function as. producers. scavengers. herbivore. parasites 4. n earthworm lives and reproduces in the soil. It aerates the

More information

Evolution of Body Size in Bears. How to Build and Use a Phylogeny

Evolution of Body Size in Bears. How to Build and Use a Phylogeny Evolution of Body Size in Bears How to Build and Use a Phylogeny Lesson II Using a Phylogeny Objectives for Lesson II: 1. Overview of concepts 1. Simple ancestral state reconstruction on the bear phylogeny

More information

CELL AND MICROBIOLOGY Nadia Iskandarani

CELL AND MICROBIOLOGY Nadia Iskandarani 7Course Title: Head of Department: Teacher(s) + e-mail: Cycle/Division: Biology IA: CELL AND MICROBIOLOGY Nadia Iskandarani Ms.Ibtessam: ibtissam.h@greenwood.sch.ae High School Grade Level: Grade 10 Credit

More information

Effects of Non-native Riparian Tree Species on Soil Microbial Community Activity

Effects of Non-native Riparian Tree Species on Soil Microbial Community Activity Effects of Non-native Riparian Tree Species on Soil Microbial Community Activity Russian olive (Elaeagnus angustifolia) on the right and Plains cottonwoods (Populus deltoids) on the left co-existing at

More information

Total

Total Student Performance by Question Biology (Multiple-Choice ONLY) Teacher: Core 1 / S-14 Scientific Investigation Life at the Molecular and Cellular Level Analysis of Performance by Question of each student

More information

Biology. Lessons: 15% Quizzes: 25% Projects: 30% Tests: 30% Assignment Weighting per Unit Without Projects. Lessons: 21% Quizzes: 36% Tests: 43%

Biology. Lessons: 15% Quizzes: 25% Projects: 30% Tests: 30% Assignment Weighting per Unit Without Projects. Lessons: 21% Quizzes: 36% Tests: 43% Biology This course consists of 12 units, which provide an overview of the basic concepts and natural laws of Biology. Unit 1 deals with the organization of living organisms. Unit 2 addresses the chemistry

More information

Species sorting along a subsidy gradient alters bacterial community stability

Species sorting along a subsidy gradient alters bacterial community stability Ecology, 97(8), 2016, pp. 2034 2043 2016 by the Ecological Society of America Species sorting along a subsidy gradient alters bacterial community stability Mario E. Muscarella, 1 Stuart E. Jones, 2 and

More information

Ecology +Biology. Baker-2015

Ecology +Biology. Baker-2015 Ecology +Biology Baker-2015 Ecology is the scientific study of interactions among organisms and between organisms and their physical environment. Eco meaning home, and ology meaning the study of. Thus

More information

Phylogenetic organization of bacterial activity

Phylogenetic organization of bacterial activity (2016) 10, 2336 2340 2016 International Society for Microbial Ecology All rights reserved 1751-7362/16 www.nature.com/ismej SHORT COMMUNICATION of bacterial activity OPEN Ember M Morrissey 1,6, Rebecca

More information

Soil Biology. Chapter 10

Soil Biology. Chapter 10 Soil Biology Chapter 10 The Sounds of Soil Soil as a Transition Between Aquatic and Aerial System Bacteria in a Drying Environment Wet (open structure) Dry (dense) Holden P.A., J.R. Hunt, and M. K. Firestone,

More information

Supplementary Information

Supplementary Information Supplementary Information Altitudinal patterns of diversity and functional traits of metabolically active microorganisms in stream biofilms Linda Wilhelm 1, Katharina Besemer 2, Lena Fragner 3, Hannes

More information

Meeting Report: ALTER-Net Workshop about the Application of Molecular. Techniques to Study Biodiversity, Structure and Function of Planktonic

Meeting Report: ALTER-Net Workshop about the Application of Molecular. Techniques to Study Biodiversity, Structure and Function of Planktonic 1 Meeting Report: ALTER-Net Workshop about the Application of Molecular Techniques to Study Biodiversity, Structure and Function of Planktonic Communities in Lakes at Blanes, Spain, February 15-16, 2007

More information

AP BIOLOGY SUMMER ASSIGNMENT

AP BIOLOGY SUMMER ASSIGNMENT AP BIOLOGY SUMMER ASSIGNMENT Welcome to EDHS Advanced Placement Biology! The attached summer assignment is required for all AP Biology students for the 2011-2012 school year. The assignment consists of

More information

What is the purpose of the Classifying System? To allow the accurate identification of a particular organism

What is the purpose of the Classifying System? To allow the accurate identification of a particular organism What is the purpose of the Classifying System? To allow the accurate identification of a particular organism Taxonomy The practice of classifying organisms -Taxonomy was founded nearly 300 years ago by

More information

Bio119 F2006 Midterm I please put your name on each page

Bio119 F2006 Midterm I please put your name on each page Equations/Tables/Information 1. G = -nf E o (F= the Faraday constant = 96 kj/vmol) 2. Reduction Potentials All are given as oxidized/reduced (number of electrons transferred). When written out the reactions

More information

Microbial diversity pa1erns in rela3on to hydrocarbon seepage

Microbial diversity pa1erns in rela3on to hydrocarbon seepage Microbial diversity pa1erns in rela3on to hydrocarbon seepage I. Microbial mat pushcores II. Sediment gravity cores The MC118 subsurface microbial community microbial players within and outside of subsurface

More information

Jeopardy. Evolution Q $100 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $200 Q $300 Q $300 Q $300 Q $300 Q $300

Jeopardy. Evolution Q $100 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $200 Q $300 Q $300 Q $300 Q $300 Q $300 Jeopardy Mutations Crosses & Punnett Sqs. Meiosis & Variability Evolution Photo, Cell Resp, Energy, Matter Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $300

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

Chapter 1 The Scientific Study of Life

Chapter 1 The Scientific Study of Life Chapter 1 The Scientific Study of Life Learning Outcomes Describe the characteristics shared by all living organisms Compare and contrast the three main taxonomic branches of life Identify standardized,

More information

Greater host breadth still not associated with increased diversification rate in the Nymphalidae A response to Janz et al.

Greater host breadth still not associated with increased diversification rate in the Nymphalidae A response to Janz et al. doi:10.1111/evo.12914 Greater host breadth still not associated with increased diversification rate in the Nymphalidae A response to Janz et al. Christopher A. Hamm 1,2 and James A. Fordyce 3 1 Department

More information

Topic outline: Review: evolution and natural selection. Evolution 1. Geologic processes 2. Climate change 3. Catastrophes. Niche.

Topic outline: Review: evolution and natural selection. Evolution 1. Geologic processes 2. Climate change 3. Catastrophes. Niche. Topic outline: Review: evolution and natural selection Evolution 1. Geologic processes 2. Climate change 3. Catastrophes Niche Speciation Extinction Biodiversity Genetic engineering http://www.cengage.com/cgi-wadsworth/course_products_wp.pl?fid=m20b&product_isbn_issn=9780495015987&discipline_number=22

More information