Istituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program.

Size: px
Start display at page:

Download "Istituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program."

Transcription

1 Istituto di Microbiologia Università Cattolica del Sacro Cuore, Roma Gut Microbiota assessment and the Meta-HIT program Giovanni Delogu 1

2 Most of the bacteria species living in the gut cannot be cultivated in common media 2 main phylum: Firmicutes (Gram-positive) > 200 genera (Lactobacillus, Mycoplasma, Bacillus and Clostridium) Bacteroidetes (Gram-negative) ~20 genera

3 Data and analysis workflow for microbiome analysis; Weinstock G.M. (2012) Genomic approaches to studying the human microbiota. Nature 489,

4 Weinstock G.M. (2012) Genomic approaches to studying the human microbiota. Nature 489,

5 Giving the diversity among individuals, only studies involving a significant number of subjects provide relevant and valuable data; Illumina-based metagenomic sequencing; 124 european individuals; Qin J. Et al. (2010) A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464,

6 Sanger sequenced 22 metagenomes from Danish, French, Italian and Spanish individuals. Functional and phylogenetic profiles of human gut microbiome Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut microbiome. Nature 473,

7 Bacteroides is the most abundant but also the most variable genus across samples. Sanger sequenced 22 metagenomes from Danish, French, Italian and Spanish individuals. Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut microbiome. Nature 473,

8 33 metagenomes (Sanger) 85 metagenomes (Illumina) Multidimensional cluster analysis and principal components analysis (PCA) revealed the forming of three distint clusters that have been designated as «enteroptypes». 154 metagenomes (16S pyroseq.) Each enterotype is identifiable by the variation of one of three genera: Bacteroides, Prevotella and Ruminococcus. Enterotypes are driven by groups of species that together contribute to the preferred community compositions. Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut 8 microbiome. Nature 473,

9 ENTEROTYPE 1 Drivers of this enterotype seem to derive energy primarily from carbohydrates and proteins through fermentation, as these closely related genera have a very broad saccharolytic potential. Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut microbiome. Nature 473,

10 ENTEROTYPE 2 Degrade mucin glycoproteins Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut microbiome. Nature 473,

11 ENTEROTYPE 3 It is the most frequent and comprises species capable of degrading mucin. Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut microbiome. Nature 473,

12 Functional differences between enterotypes These phylogenetic and functional differences among enetrotypes thus reflect different combinations of microbial trophic chains with a probable impact on synergistic interrelations with the human hosts. Arumugam M. et al & MetaHIT consortium (2011) Enterotypes of the human gut 12 microbiome. Nature 473,

13 Assessment of the gut microbiota Culture techniques DNA amplification Not reliable; Limited information; 16S rrnarealtime PCR; Not cultivable bacteria; (semi) quantitative analysis; 13

14 Analysis of predominant bacteria in colon biopsies and faeces Lyra A et al, World J Gastroenterol 2012

15 Analysis of predominant bacteria in feces Quantità DNA batterico (rdna 16S) 1.40E E E E E E E E+00 CTR DSS DSS ta 1X DSS ta 10X Lattobacilli Enterococchi Enterobatteri Clostridi Bacteroides % DNA batterico (rdna 16S) 100% 80% 60% 40% 20% 0% CTR DSS DSS ta 1X DSS ta 10X Lattobacilli Enterococchi Enterobatteri Clostridi Bacteroides Scaldaferri F., Bilotta M, Delogu G., Gasbarrini A. et al preliminary results

16 Metametrix, USA 16

17 Does the gut microbiota assessment, based on these methodologies, provide reliable information? 17

18 Assessment of the gut microbiota Metagenomic approach (Sanger, 16S rrna pyroseq, Illumina) Data analysis Genera and species identification; Phylogenetic grouping; Metagenome; Gene composition and function; 18

19 Illumina GA short-read sequencing on total faecal DNA; 124 individuals of European origin; The catalogue of non-redundant human intestinal microbial genes contains 3,3 million genes (150-fold more than the human gene complement); 99,1% are of bacterial origin, 0,1% eukaryotic and viral origin and the remaining archael; The cohort harbours 1150 prevalent bacterial species and each individual harbours at least 160 bacterial species; 75 species common to >50% of individuals and 57 species common to >90%; 19

20 242 adults (4788 specimens); Microbial taxas varies; Metabolic pathways remain stable; Functional redundancy; The HMP consortium. Structure, function and diversity of the healthy human microbiome. Nature 486 (June 2011)

21 Qin J. Et al. (2010) A human gut microbial gene catalogue established by metagenomic seqeuncing. Nature 464,

22 242 adults (4788 specimens); Microbial taxas varies; The HMP consortium. Structure, function and diversity of the healthy human microbiome. Nature 486 (June 2011)

23 Phylogentic three based on whole genome orthomcl clusters The genus Bacteroides comprises more that sixty species which are morphologically, biochemically and physiologically very heterogeneous; Taxonomy has been continuously revised in the last few decades though recent data emerging from genomic studies is providing a clearer picture; Karlsson FH, et al. (2011) A closer look at Bacteroides: phylogenetic relationship and genomic implications of a life in the human gut. Microb. Ecol. EAGEN Rome 2012 B. caccae B. vulgatus 23

24 Bacteroides play an important role in the human gut CPS Contributing to gut homeostasis by interacting with the host immune response; PULs Degrading polysaccharide components; 70% energy 10% energy EAGEN Rome

25 PULs in B. thetaiotaomicron genome 88 PULs 866 genes 18% total genome B. thetaiotaomicron s ability to opportunistically use many glycan sources likely makes it an important generalist EAGEN Rome 2012 among intestinal Bacteroidetes. 25

26 PULs in B. ovatus genome 112 PULs encompassing 1129 ORFs EAGEN Rome Martens EC et al, PLoS Biology 2011

27 EAGEN Rome

28 B. ovatus Plant cell wall, hemicellulose B. distasonis B. vulgatus Stronger in plant degradation, no carbon degradation; pre-digest products Target pectin, fruit-associated glycans B. thetaiotaomicron B. fragilis More soluble andaccessible components of plant cell wals. O- glycans mucus layer EAGEN Rome 2012 Adapted from Koropatkin NM, et al (2012) Nat Rev Microb

29 Deterioration of global Synteny in Bacteroides Synteny measure the conserved gene order along the chromosomes of different species or strains of the same species. Xu J., et al. (2007) Evolution of symbiotic bacteria in the distal human intestine. Plos Biology, 5 (7) EAGEN Rome

30 DIET ANTIBIOTICS PREBIOTICS INFLAMMATION PATHOGENS B. ovatus B. distasonis B. vulgatus B. thetaiotaomicron B. fragilis Bacterial genetic variability (interspecies, intra-species); Competion/mutualism EAGEN Rome 2012 Adapted from 30 Koropatkin NM, et al (2012) Nat Rev Microb

31 Challenge: Implementing a reliable and feasible methodology to assess gut microbiota in clinical practice. LAB CLINIC Weinstock G.M. (2012) Genomic approaches to studying the human microbiota. Nature 489,

32 Tools to assess the gut microbiome: Different parameters; Economic e relatively simple procedures; Easy to interpret data; Addressing specific and tailored points; MULTIPARAMETRI C PROFILE Weinstock G.M. (2012) Genomic approaches to studying the human microbiota. Nature 489,

33 33

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu Microbiota and man: the story about us Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities

More information

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms 1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic

More information

Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples

Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples Christopher Malow cmalow@stanford.edu Abstract Metagenomic studies of human fecal samples have used whole genome shotgun sequencing

More information

Human Microbiome Project

Human Microbiome Project Human Microbiome Project Definitions Microbiome: the collective genomes of the community of organisms that share our space Metagenome: culture independent study of genomes of many organisms in order to

More information

Microbiome: 16S rrna Sequencing 3/30/2018

Microbiome: 16S rrna Sequencing 3/30/2018 Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics

More information

Bacteria Outline. 1. Overview. 2. Structural & Functional Features. 3. Taxonomy. 4. Communities

Bacteria Outline. 1. Overview. 2. Structural & Functional Features. 3. Taxonomy. 4. Communities Bacteria Outline 1. Overview 2. Structural & Functional Features 3. Taxonomy 4. Communities Bacteria - Taxonomy PHYLUM CLASS ORDER FAMILY GENUS SPECIES SUB-SPECIES & STRAINS Bacteria - Phyla Firmicutes

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16161 DOI: 10.1038/NMICROBIOL.2016.161 A reference gene catalogue of the pig gut microbiome Liang Xiao 1, Jordi Estellé 2, Pia Kiilerich 3, Yuliaxis Ramayo-Caldas

More information

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; fast- clock molecules for fine-structure. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,

More information

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Intro to Prokaryotes Lecture 1 Spring 2014

Intro to Prokaryotes Lecture 1 Spring 2014 Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite

More information

Amplicon Sequencing. Dr. Orla O Sullivan SIRG Research Fellow Teagasc

Amplicon Sequencing. Dr. Orla O Sullivan SIRG Research Fellow Teagasc Amplicon Sequencing Dr. Orla O Sullivan SIRG Research Fellow Teagasc What is Amplicon Sequencing? Sequencing of target genes (are regions of ) obtained by PCR using gene specific primers. Why do we do

More information

Microbial Dynamics of the Broiler Intestinal Tract Margie Lee, Ph.D., D.V.M.

Microbial Dynamics of the Broiler Intestinal Tract Margie Lee, Ph.D., D.V.M. Microbial Dynamics of the Broiler Intestinal Tract Margie Lee, Ph.D., D.V.M. Biography Ph.D., Medical Microbiology, The University of Georgia, 1990. M.S., Medical Microbiology, The University of Georgia,

More information

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

Essentiality in B. subtilis

Essentiality in B. subtilis Essentiality in B. subtilis 100% 75% Essential genes Non-essential genes Lagging 50% 25% Leading 0% non-highly expressed highly expressed non-highly expressed highly expressed 1 http://www.pasteur.fr/recherche/unites/reg/

More information

Statistical methods for the analysis of microbiome compositional data in HIV studies

Statistical methods for the analysis of microbiome compositional data in HIV studies 1/ 56 Statistical methods for the analysis of microbiome compositional data in HIV studies Javier Rivera Pinto November 30, 2018 Outline 1 Introduction 2 Compositional data and microbiome analysis 3 Kernel

More information

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

An investigation into the potential mechanisms that drive gender based differences in skin microbiota

An investigation into the potential mechanisms that drive gender based differences in skin microbiota An investigation into the potential mechanisms that drive gender based differences in skin microbiota Laura S. Weyrich, PhD Australian Centre for Ancient DNA University of Adelaide, Australia Email: laura.weyrich@adelaide.edu.au

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria

Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Seminar presentation Pierre Barbera Supervised by:

More information

Efficacy of Bacillus subtilis based probiotic growth performance, fecal microbiota and intestinal morphology of broiler chickens

Efficacy of Bacillus subtilis based probiotic growth performance, fecal microbiota and intestinal morphology of broiler chickens Efficacy of Bacillus subtilis based probiotic growth performance, fecal microbiota and intestinal morphology of broiler chickens K. Doranalli 1*, T. C. Loh 2 and C. K. Girish 1 1 Health and Nutrition,

More information

Microbial analysis with STAMP

Microbial analysis with STAMP Microbial analysis with STAMP Conor Meehan cmeehan@itg.be A quick aside on who I am Tangents already! Who I am A postdoc at the Institute of Tropical Medicine in Antwerp, Belgium Mycobacteria evolution

More information

Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University

Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires

More information

Introductory Microbiology Dr. Hala Al Daghistani

Introductory Microbiology Dr. Hala Al Daghistani Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health

More information

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think

More information

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: https://digitalcontentmarket.org/download/test-bank-formicrobiology-a-systems-approach-3rd-edition-by-cowan Chapter

More information

Prereq: Concurrent 3 CH

Prereq: Concurrent 3 CH 0201107 0201101 General Biology (1) General Biology (1) is an introductory course which covers the basics of cell biology in a traditional order, from the structure and function of molecules to the structure

More information

Structure, function and host control of rhizosphere microbiome

Structure, function and host control of rhizosphere microbiome Structure, function and host control of rhizosphere microbiome Davide Bulgarelli PhD, Microbiome AgBioTech Europe London, September 21st, 2017 Outline The rhizosphere microbiome Barley as a model to study

More information

Microbiota: the human body is a home for bacteria

Microbiota: the human body is a home for bacteria Microbiota: the human body is a home for bacteria Digestive system and bacteria As well as allowing us to conduct our everyday lives, our body is home to a huge number of organisms, which all together

More information

Ch 10. Classification of Microorganisms

Ch 10. Classification of Microorganisms Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,

More information

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek

More information

Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng

Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS Elizabeth Tseng Dept. of CSE, University of Washington Johanna Lampe Lab, Fred Hutchinson Cancer

More information

Introduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani

Introduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.

More information

Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems?

Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems? Bacterial growth efficiency: do consumer and resource diversity influence the fate of carbon in aquatic ecosystems? Muscarella M.E. & Lennon J.T. Department of Biology, Indiana University, USA Join the

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity?

Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity? Species Divergence and the Measurement of Microbial Diversity Cathy Lozupone University of Colorado, Boulder. Washington University, St Louis. Outline Classes of diversity measures α vs β diversity Quantitative

More information

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination. Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial

More information

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical

More information

Seminar 2 : Good Bugs

Seminar 2 : Good Bugs Seminar 2 : Good Bugs Part 2 Viruses What is a virus? Microscopic particles that infect other organisms and can only replicate within a host cell Contain either contain DNA or RNA surrounded by a protective

More information

LECTURE 13. THE BACTERIA (cont.) Photosynthetic Bacteria, phylogenetically widespread. And many Proteobacteria. Photosynthetic Bacteria

LECTURE 13. THE BACTERIA (cont.) Photosynthetic Bacteria, phylogenetically widespread. And many Proteobacteria. Photosynthetic Bacteria Photosynthetic Bacteria, phylogenetically widespread LECTURE 13 THE BACTERIA (cont.) And many Proteobacteria Photosynthetic Bacteria > Green Sulfur > Green Nonsulfur > Purple Sulfur > Purple Nonsulfur

More information

Microbiology BIOL 202 Lecture Course Outcome Guide (COG) Approved 22 MARCH 2012 Pg.1

Microbiology BIOL 202 Lecture Course Outcome Guide (COG) Approved 22 MARCH 2012 Pg.1 Microbiology BIOL 202 Lecture Course Outcome Guide (COG) Approved 22 MARCH 2012 Pg.1 Course: Credits: 3 Instructor: Course Description: Concepts and Issues 1. Microbial Ecology including mineral cycles.

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Probing diversity in a hidden world: applications of NGS in microbial ecology

Probing diversity in a hidden world: applications of NGS in microbial ecology Probing diversity in a hidden world: applications of NGS in microbial ecology Guus Roeselers TNO, Microbiology & Systems Biology Group Symposium on Next Generation Sequencing October 21, 2013 Royal Museum

More information

Chapter The Cell: Basic Unit of Life

Chapter The Cell: Basic Unit of Life Chapter 5.1 5.2 The Cell: Basic Unit of Life Why do we study cells? Cell Theory All organisms are made up of cells The cell is the basic living unit of organization for all organisms All cells come from

More information

An Adaptive Association Test for Microbiome Data

An Adaptive Association Test for Microbiome Data An Adaptive Association Test for Microbiome Data Chong Wu 1, Jun Chen 2, Junghi 1 Kim and Wei Pan 1 1 Division of Biostatistics, School of Public Health, University of Minnesota; 2 Division of Biomedical

More information

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes

More information

Short overview on microbial ecology of the vineyards

Short overview on microbial ecology of the vineyards Short overview on microbial ecology of the vineyards Stéphane Compant Center for Health & Bioresources, AIT Austrian Institute of Technology GmbH, 3430 Tulln, Austria Stephane.Compant@ait.ac.at Summary

More information

Mestrado em Microbiologia Aplicada. FRM Fisiologia e Regulação Microbiana. IFRM Introdução à Fisiologia e Regulação Microbiana. Ano Lectivo 2017/2018

Mestrado em Microbiologia Aplicada. FRM Fisiologia e Regulação Microbiana. IFRM Introdução à Fisiologia e Regulação Microbiana. Ano Lectivo 2017/2018 Mestrado em Microbiologia Aplicada FRM Fisiologia e Regulação Microbiana IFRM Introdução à Fisiologia e Regulação Microbiana Ano Lectivo 2017/2018 Program FRM /IFRM- Fisiologia e Regulação Microbiana 1.

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. The inflammatory response in the mammalian gut leads to tetrathionate generation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. The inflammatory response in the mammalian gut leads to tetrathionate generation. Supplementary Figure 1 The inflammatory response in the mammalian gut leads to tetrathionate generation. Cytokine signaling following an inflammatory insult leads to, among other responses, release of

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

SYLLABUS. Meeting Basic of competence Topic Strategy Reference

SYLLABUS. Meeting Basic of competence Topic Strategy Reference SYLLABUS Faculty : Mathematics and science Study Program : Biology education Lecture/Code : Microbiology/BIO 236 Credits : 2 unit of semester credit Semester : 5 Prerequisites lecture : Biochemistry, Cell

More information

Microbiology Helmut Pospiech

Microbiology Helmut Pospiech Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition

More information

Identify stages of plant life cycle Botany Oral/written pres, exams

Identify stages of plant life cycle Botany Oral/written pres, exams DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce

More information

B. Correct! Bacillus anthraces produces spores that can cause anthrax. D. Incorrect! Diphtheria is caused by Corynebacterium diphtheriae.

B. Correct! Bacillus anthraces produces spores that can cause anthrax. D. Incorrect! Diphtheria is caused by Corynebacterium diphtheriae. Microbiology - Problem Drill 09 - The Prokaryotes No. 1 of 10 1. Bacillus anthraces is most closely associated with which of the following? (A) Botulism poisoning (B) Anthrax (C) Gangrene (D) Diphtheria

More information

9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success

9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success 5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes

More information

Ledyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005

Ledyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005 Ledyard Public Schools Science Curriculum Biology Level-2 1422 Instructional Council Approval June 1, 2005 Suggested Time: Approximately 9 weeks Essential Question Cells & Cell Processes 1. What compounds

More information

Microbial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy 1. Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eucaryote, is in a mess we are stuck with it for traditional

More information

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life

More information

In vitro the effect of intestinal normal flora on some pathogenic bacteria.

In vitro the effect of intestinal normal flora on some pathogenic bacteria. In vitro the effect of intestinal normal flora on some pathogenic bacteria. Abstract: Dr.abbass shaker Ali adel Leena abd Al-Redha The effect of two types of intestinal bacterial normal floral ( and klebsiella)

More information

TAXONOMY OF PLANT PATHOGENIC FUNGI: CAN WE MERGE THE PAST WITH THE FUTURE?

TAXONOMY OF PLANT PATHOGENIC FUNGI: CAN WE MERGE THE PAST WITH THE FUTURE? Journal of Plant Pathology (2006), 88 (3, Supplement), S9 Edizioni ETS Pisa, 2006 S9 TAXONOMY OF PLANT PATHOGENIC FUNGI: CAN WE MERGE THE PAST WITH THE FUTURE? P.W. Crous Centraalbureau voor Schimmelcultures,

More information

ADVANCED PLACEMENT BIOLOGY

ADVANCED PLACEMENT BIOLOGY ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week

More information

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus

More information

Chapters AP Biology Objectives. Objectives: You should know...

Chapters AP Biology Objectives. Objectives: You should know... Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.

More information

Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses

Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Chapter 27: Bacteria and Archaea

Chapter 27: Bacteria and Archaea Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and

More information

Bacteria, Friends or Foes?

Bacteria, Friends or Foes? Bacteria, Friends or Foes? This unit integrates molecular biology techniques with the role of bacteria in our environment, specifically in the marine environment. The unit starts with introductory activities

More information

Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies

Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Khaya Ntushelo Department of Agriculture and Animal Health, University of South Africa,

More information

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and

More information

Prokaryotic and Eukaryotic Cells. Structure and Function

Prokaryotic and Eukaryotic Cells. Structure and Function Prokaryotic and Eukaryotic Cells Structure and Function In general microbes or microorganisms may be either prokaryotic (bacteria) or eukaryotic (protists, fungi, and some animals). However, there are

More information

Course Descriptions Biology

Course Descriptions Biology Course Descriptions Biology BIOL 1010 (F/S) Human Anatomy and Physiology I. An introductory study of the structure and function of the human organ systems including the nervous, sensory, muscular, skeletal,

More information

Catalogue with Probabilistic Topic Models

Catalogue with Probabilistic Topic Models Inferring Functional Groups from Microbial Gene Catalogue with Probabilistic Topic Models Xin Chen 1, TingTing He 2, Xiaohua Hu 1, Yuan An 1, Xindong Wu 3 1 College of Information Science and Technology,

More information

Principles of Biotechnology Lectures of week 4 MICROBIOLOGY AND BIOTECHNOLOGY

Principles of Biotechnology Lectures of week 4 MICROBIOLOGY AND BIOTECHNOLOGY Principles of Biotechnology Lectures of week 4 MICROBIOLOGY AND BIOTECHNOLOGY INTRODUCTION TO MICROBIOLOGY What are microbes? Germs, microbe s s microorganisms are minute living things that individually

More information

Supplementary Figure 1. Chao 1 richness estimator of microbial OTUs (16S rrna

Supplementary Figure 1. Chao 1 richness estimator of microbial OTUs (16S rrna Supplementary Information Supplementary Figure 1. Chao 1 richness estimator of microbial OTUs (16S rrna gene survey) from skin and hindgut of wild vultures and from feces of zoo birds. Supplementary Note

More information

Microbiology Helmut Pospiech

Microbiology Helmut Pospiech Microbiology 20.03.2018 Helmut Pospiech The control of what gets in Passive transport along a concentration gradient often inefficient Active transport Requires energy consumption and what gets out ABC

More information

Biology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name:

Biology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name: Biology 6. Inheritance, Variation and Evolution Revisiting Booklet Name: Reproduction Name the process by which body cells divide:... What kind of cells are produced this way? Name the process by which

More information

AP Biology Essential Knowledge Cards BIG IDEA 1

AP Biology Essential Knowledge Cards BIG IDEA 1 AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific

More information

The Prokaryotic World

The Prokaryotic World The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,

More information

WHAT DO CELLS DO? CHALLENGE QUESTION. What are the functions of the structures inside of cells?

WHAT DO CELLS DO? CHALLENGE QUESTION. What are the functions of the structures inside of cells? WHAT DO CELLS DO? CHALLENGE QUESTION What are the functions of the structures inside of cells? WHAT DO CELLS DO? Understanding normal cell structures and their functions help scientists understand how

More information

Single-cell genomics applied to the picobiliphytes using next-generation sequencing

Single-cell genomics applied to the picobiliphytes using next-generation sequencing Department of Ecology, Evolution and Natural Resources and Institute of Marine and Coastal Sciences Rutgers University, NJ 08901 Single-cell genomics applied to the picobiliphytes using next-generation

More information

ASSIGNMENT-1. M.Sc. ( Previous ) DEGREE EXAMINATION, MAY 2018 First Year MICROBIOLOGY Introduction Microorganisms

ASSIGNMENT-1. M.Sc. ( Previous ) DEGREE EXAMINATION, MAY 2018 First Year MICROBIOLOGY Introduction Microorganisms ASSIGNMENT-1 Introduction Microorganisms (DMB 01) Q1) Germ theory of diseases. Q2) Leeuwenhoek. Q3) Mycoplasmas. Q4) Rhizobium. Q5) T4 Q6) Viroids. Q7) Protozoa classification. ASSIGNMENT-2 Introduction

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION City of origin as a confounding variable. The original study was designed such that the city where sampling was performed was perfectly confounded with where the DNA extractions and sequencing was performed.

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

Archea and Bacteria- The PROKARYOTES

Archea and Bacteria- The PROKARYOTES ` Archea and Bacteria- The PROKARYOTES As late as 1977, all prokaryotes were put into one single kingdom called Monera. Taxonomists no longer accept that concept. Some prokaryotes are more closely related

More information

Name Date Class. PAP Unit 10: Bacteria, Viruses, Protist, and Fungi TEST REVIEW. d. Do viruses contain nucleic acids/genetic material (Yes or No)?

Name Date Class. PAP Unit 10: Bacteria, Viruses, Protist, and Fungi TEST REVIEW. d. Do viruses contain nucleic acids/genetic material (Yes or No)? Name Date Class PAP Unit 10: Bacteria, Viruses, Protist, and Fungi TEST REVIEW Part A: Viruses 1. a. Are viruses biotic or abiotic? b. Are viruses made of cells (Yes or No)? c. Do viruses contain proteins

More information

Microbioma da Rizosfera

Microbioma da Rizosfera Microbioma da Rizosfera e seu papel na supressão de doenças em plantas Dr. Lucas William Mendes Centro de Energia Nuclear na Agricultura CENA-USP Netherlands Institute of Ecology NIOO-KNAW microbiome The

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. 1.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. 1. Chapter 3 Study Guide Explain the 3 main characteristics that help differentiate prokaryotes from eukaryotes. What are the 7 structures/substances found in all bacterial cells? What are 8 specific structures

More information

ILLINOIS VALLEY COMMUNITY COLLEGE

ILLINOIS VALLEY COMMUNITY COLLEGE ILLINOIS VALLEY COMMUNITY COLLEGE COURSE OUTLINE IVISION: Natural Sciences Business COURSE: BIO 1009 Microbiology ate: September 11, 2013 Credit Hours: 4 Prerequisite(s): BIO 1001, BIO 1003, BIO 1007 or

More information

Bacterial endophytes of flowers, fruits and seeds of grapevine:

Bacterial endophytes of flowers, fruits and seeds of grapevine: Bacterial endophytes of flowers, fruits and seeds of grapevine: identification, localization, differences with other plant parts and sources of colonization Dr. Stéphane Compant Bioresources Unit, Health

More information

BIOL 101 Introduction to Biological Research Techniques I

BIOL 101 Introduction to Biological Research Techniques I BIOL 101 Introduction to Biological Research Techniques I 1. Develop a research plan including hypothesis, controls and procedures. 2. Conduct a primary literature review relating to their research project.

More information

Burton's Microbiology for the Health Sciences

Burton's Microbiology for the Health Sciences Burton's Microbiology for the Health Sciences Chapter 3. Cell Structure and Taxonomy Chapter 3 Outline Introduction Eucaryotic Cell Structure Procaryotic Cell Structure Summary of Structural Differences

More information

Announcements KEY CONCEPTS

Announcements KEY CONCEPTS What do these things have in common? Announcements Lab this week: bring textbook and photo atlas. Relevant reading BEFORE lab: Ch. 30 http://i.cnn.net/cnn/specials/2001/trade.center/images/anthrax.jpg

More information

Ch 3. Bacteria and Archaea

Ch 3. Bacteria and Archaea Ch 3 Bacteria and Archaea SLOs for Culturing of Microorganisms Compare and contrast the overall cell structure of prokaryotes and eukaryotes. List structures all bacteria possess. Describe three basic

More information

Range of Competencies

Range of Competencies BIOLOGY Content Domain Range of Competencies l. Nature of Science 0001 0003 20% ll. Biochemistry and Cell Biology 0004 0005 13% lll. Genetics and Evolution 0006 0009 27% lv. Biological Unity and Diversity

More information

Figure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case)

Figure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case) Chapter 11 The Prokaryotes: Domains Bacteria and Archaea Objective Questions 1) Which of the following are found primarily in the intestines of humans? A) Gram-negative aerobic rods and cocci B) Aerobic,

More information